ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart07a04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ276013.1|HVU276013 Hordeum vulgare partial mRNA for alpha-... 50 2e-04
2emb|BX927292.6| Zebrafish DNA sequence from clone CH211-197O22 i... 38 0.67
3emb|AL935196.10| Zebrafish DNA sequence from clone DKEYP-79F4 in... 38 0.67
4gb|AC161194.14| Mus musculus chromosome 15, clone RP23-345C13, c... 36 2.7
5gb|AC023818.5| Homo sapiens chromosome 16 clone CTD-2600H12, com... 36 2.7
6emb|AL049762.20|HSDJ81F6 Human DNA sequence from clone RP1-81F6 ... 36 2.7
7emb|AL591399.3| Zebrafish DNA sequence from clone BUSM1-172D23 i... 36 2.7
8emb|CR352230.8| Zebrafish DNA sequence from clone CH211-106G8 in... 36 2.7
9emb|AL591520.5| Zebrafish DNA sequence from clone BUSM1-138M20, ... 36 2.7

>emb|AJ276013.1|HVU276013 Hordeum vulgare partial mRNA for alpha-tubulin 5 (atub5 gene)
          Length = 794

 Score = 50.1 bits (25), Expect = 2e-04
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 4   gtacaaaaactctccgttcattattatgt 32
           ||||||||||||| |||||||||||||||
Sbjct: 766 gtacaaaaactcttcgttcattattatgt 738



to top

>emb|BX927292.6| Zebrafish DNA sequence from clone CH211-197O22 in linkage group 19,
              complete sequence
          Length = 195006

 Score = 38.2 bits (19), Expect = 0.67
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 9      aaaactctccgttcattat 27
              |||||||||||||||||||
Sbjct: 146117 aaaactctccgttcattat 146099



to top

>emb|AL935196.10| Zebrafish DNA sequence from clone DKEYP-79F4 in linkage group 18,
             complete sequence
          Length = 105612

 Score = 38.2 bits (19), Expect = 0.67
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 9     aaaactctccgttcattat 27
             |||||||||||||||||||
Sbjct: 23520 aaaactctccgttcattat 23502



to top

>gb|AC161194.14| Mus musculus chromosome 15, clone RP23-345C13, complete sequence
          Length = 193998

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     actgtacaaaaactctcc 18
             ||||||||||||||||||
Sbjct: 70133 actgtacaaaaactctcc 70116



to top

>gb|AC023818.5| Homo sapiens chromosome 16 clone CTD-2600H12, complete sequence
          Length = 173304

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 11    aactctccgttcattatt 28
             ||||||||||||||||||
Sbjct: 27200 aactctccgttcattatt 27183



to top

>emb|AL049762.20|HSDJ81F6 Human DNA sequence from clone RP1-81F6 on chromosome 1q24.1-25.2
             Contains the 5' end of the gene for HBxAg transactivated
             protein 2 (XTP2), complete sequence
          Length = 100575

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     actgtacaaaaactctccgttc 22
             |||||||||||| |||||||||
Sbjct: 64418 actgtacaaaaattctccgttc 64397



to top

>emb|AL591399.3| Zebrafish DNA sequence from clone BUSM1-172D23 in linkage group 2
            Contains 24 TCR-alpha V segments (II-85 to II-108) two of
            which are pseudogenes (II-92 and II-104), 3 C segments,
            13 J segments and a CpG island, complete sequence
          Length = 97774

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 1    actgtacaaaaactctccgttcatta 26
            |||||||||||||| || ||||||||
Sbjct: 2814 actgtacaaaaactgtctgttcatta 2839



to top

>emb|CR352230.8| Zebrafish DNA sequence from clone CH211-106G8 in linkage group 2,
              complete sequence
          Length = 168916

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                        
Query: 1      actgtacaaaaactctccgttcatta 26
              |||||||||||||| || ||||||||
Sbjct: 103492 actgtacaaaaactgtctgttcatta 103517



to top

>emb|AL591520.5| Zebrafish DNA sequence from clone BUSM1-138M20, complete sequence
          Length = 100721

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                      
Query: 1    actgtacaaaaactctccgttcatta 26
            |||||||||||||| || ||||||||
Sbjct: 9229 actgtacaaaaactgtctgttcatta 9204


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 237,224
Number of Sequences: 3902068
Number of extensions: 237224
Number of successful extensions: 50363
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50311
Number of HSP's gapped (non-prelim): 52
length of query: 32
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 12
effective length of database: 17,155,003,908
effective search space: 205860046896
effective search space used: 205860046896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top