Clone Name | rbart07a04 |
---|---|
Clone Library Name | barley_pub |
>emb|AJ276013.1|HVU276013 Hordeum vulgare partial mRNA for alpha-tubulin 5 (atub5 gene) Length = 794 Score = 50.1 bits (25), Expect = 2e-04 Identities = 28/29 (96%) Strand = Plus / Minus Query: 4 gtacaaaaactctccgttcattattatgt 32 ||||||||||||| ||||||||||||||| Sbjct: 766 gtacaaaaactcttcgttcattattatgt 738
>emb|BX927292.6| Zebrafish DNA sequence from clone CH211-197O22 in linkage group 19, complete sequence Length = 195006 Score = 38.2 bits (19), Expect = 0.67 Identities = 19/19 (100%) Strand = Plus / Minus Query: 9 aaaactctccgttcattat 27 ||||||||||||||||||| Sbjct: 146117 aaaactctccgttcattat 146099
>emb|AL935196.10| Zebrafish DNA sequence from clone DKEYP-79F4 in linkage group 18, complete sequence Length = 105612 Score = 38.2 bits (19), Expect = 0.67 Identities = 19/19 (100%) Strand = Plus / Minus Query: 9 aaaactctccgttcattat 27 ||||||||||||||||||| Sbjct: 23520 aaaactctccgttcattat 23502
>gb|AC161194.14| Mus musculus chromosome 15, clone RP23-345C13, complete sequence Length = 193998 Score = 36.2 bits (18), Expect = 2.7 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 actgtacaaaaactctcc 18 |||||||||||||||||| Sbjct: 70133 actgtacaaaaactctcc 70116
>gb|AC023818.5| Homo sapiens chromosome 16 clone CTD-2600H12, complete sequence Length = 173304 Score = 36.2 bits (18), Expect = 2.7 Identities = 18/18 (100%) Strand = Plus / Minus Query: 11 aactctccgttcattatt 28 |||||||||||||||||| Sbjct: 27200 aactctccgttcattatt 27183
>emb|AL049762.20|HSDJ81F6 Human DNA sequence from clone RP1-81F6 on chromosome 1q24.1-25.2 Contains the 5' end of the gene for HBxAg transactivated protein 2 (XTP2), complete sequence Length = 100575 Score = 36.2 bits (18), Expect = 2.7 Identities = 21/22 (95%) Strand = Plus / Minus Query: 1 actgtacaaaaactctccgttc 22 |||||||||||| ||||||||| Sbjct: 64418 actgtacaaaaattctccgttc 64397
>emb|AL591399.3| Zebrafish DNA sequence from clone BUSM1-172D23 in linkage group 2 Contains 24 TCR-alpha V segments (II-85 to II-108) two of which are pseudogenes (II-92 and II-104), 3 C segments, 13 J segments and a CpG island, complete sequence Length = 97774 Score = 36.2 bits (18), Expect = 2.7 Identities = 24/26 (92%) Strand = Plus / Plus Query: 1 actgtacaaaaactctccgttcatta 26 |||||||||||||| || |||||||| Sbjct: 2814 actgtacaaaaactgtctgttcatta 2839
>emb|CR352230.8| Zebrafish DNA sequence from clone CH211-106G8 in linkage group 2, complete sequence Length = 168916 Score = 36.2 bits (18), Expect = 2.7 Identities = 24/26 (92%) Strand = Plus / Plus Query: 1 actgtacaaaaactctccgttcatta 26 |||||||||||||| || |||||||| Sbjct: 103492 actgtacaaaaactgtctgttcatta 103517
>emb|AL591520.5| Zebrafish DNA sequence from clone BUSM1-138M20, complete sequence Length = 100721 Score = 36.2 bits (18), Expect = 2.7 Identities = 24/26 (92%) Strand = Plus / Minus Query: 1 actgtacaaaaactctccgttcatta 26 |||||||||||||| || |||||||| Sbjct: 9229 actgtacaaaaactgtctgttcatta 9204 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 237,224 Number of Sequences: 3902068 Number of extensions: 237224 Number of successful extensions: 50363 Number of sequences better than 10.0: 9 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 50311 Number of HSP's gapped (non-prelim): 52 length of query: 32 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 12 effective length of database: 17,155,003,908 effective search space: 205860046896 effective search space used: 205860046896 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)