Clone Name | rbart06g09 |
---|---|
Clone Library Name | barley_pub |
>gb|BT009394.1| Triticum aestivum clone wlm96.pk037.m21:fis, full insert mRNA sequence Length = 953 Score = 307 bits (155), Expect = 2e-80 Identities = 175/182 (96%) Strand = Plus / Minus Query: 253 cgcccgtctagacnacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaga 312 |||||| |||||| | |||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 816 cgcccgcctagacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcaga 757 Query: 313 cctcgatgcgcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggaaaagc 372 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 756 cctcgatgcgcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagc 697 Query: 373 gggtgtcgaggtcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcg 432 |||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| Sbjct: 696 gggtgtcgaggtcggacatgggggtgcccgccggcagcgccaccgtgccgccccagagcg 637 Query: 433 tg 434 || Sbjct: 636 tg 635 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 160 aataatacaattgattaagggaagcggctggtaaggaa 197 ||||||||||||||||||| ||||||||||||||||| Sbjct: 927 aataatacaattgattaagataagcggctggtaaggaa 890
>ref|XM_483167.1| Oryza sativa (japonica cultivar-group), mRNA Length = 996 Score = 170 bits (86), Expect = 2e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 820 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 761 Query: 329 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 388 |||||||||| ||| |||||||||||||| |||| |||| || | ||| ||||| || Sbjct: 760 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 701 Query: 389 caagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtg 434 || |||||| ||| ||||||||||||||||||| |||| |||||| Sbjct: 700 cagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtg 655
>ref|XM_507591.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA Length = 1096 Score = 170 bits (86), Expect = 2e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 827 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 768 Query: 329 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 388 |||||||||| ||| |||||||||||||| |||| |||| || | ||| ||||| || Sbjct: 767 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 708 Query: 389 caagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtg 434 || |||||| ||| ||||||||||||||||||| |||| |||||| Sbjct: 707 cagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtg 662
>ref|XM_507281.2| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA Length = 1098 Score = 170 bits (86), Expect = 2e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 829 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 770 Query: 329 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 388 |||||||||| ||| |||||||||||||| |||| |||| || | ||| ||||| || Sbjct: 769 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 710 Query: 389 caagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtg 434 || |||||| ||| ||||||||||||||||||| |||| |||||| Sbjct: 709 cagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtg 664
>gb|AY644637.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA O-methyltransferase (COA20) gene, complete cds Length = 1158 Score = 170 bits (86), Expect = 2e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1049 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 990 Query: 329 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 388 |||||||||| ||| |||||||||||||| |||| |||| || | ||| ||||| || Sbjct: 989 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 930 Query: 389 caagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtg 434 || |||||| ||| ||||||||||||||||||| |||| |||||| Sbjct: 929 cagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtg 884
>dbj|AB110168.1| Oryza sativa (japonica cultivar-group) mRNA for caffeoyl-CoA 3-O-methyltransferase, complete cds, clone: 12FPR057 Length = 976 Score = 170 bits (86), Expect = 2e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 797 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 738 Query: 329 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 388 |||||||||| ||| |||||||||||||| |||| |||| || | ||| ||||| || Sbjct: 737 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 678 Query: 389 caagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtg 434 || |||||| ||| ||||||||||||||||||| |||| |||||| Sbjct: 677 cagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtg 632
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 170 bits (86), Expect = 2e-39 Identities = 146/166 (87%) Strand = Plus / Plus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 24579640 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 24579699 Query: 329 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 388 |||||||||| ||| |||||||||||||| |||| |||| || | ||| ||||| || Sbjct: 24579700 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 24579759 Query: 389 caagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtg 434 || |||||| ||| ||||||||||||||||||| |||| |||||| Sbjct: 24579760 cagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtg 24579805 Score = 48.1 bits (24), Expect = 0.024 Identities = 66/80 (82%) Strand = Plus / Plus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||| | |||||||||||||||| || |||| |||| |||||| ||| ||| Sbjct: 24590673 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 24590732 Query: 329 ggcggcgagcttggcgttga 348 |||||||| | ||||||||| Sbjct: 24590733 ggcggcgaccatggcgttga 24590752 Score = 48.1 bits (24), Expect = 0.024 Identities = 66/80 (82%) Strand = Plus / Plus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||| ||||| |||||||| || | |||||| | |||| | ||||||||| Sbjct: 24586274 gcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgcgggtc 24586333 Query: 329 ggcggcgagcttggcgttga 348 | |||||| ||||||||||| Sbjct: 24586334 gccggcgatcttggcgttga 24586353
>dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0026F07 Length = 137354 Score = 170 bits (86), Expect = 2e-39 Identities = 146/166 (87%) Strand = Plus / Plus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 87900 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 87959 Query: 329 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 388 |||||||||| ||| |||||||||||||| |||| |||| || | ||| ||||| || Sbjct: 87960 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 88019 Query: 389 caagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtg 434 || |||||| ||| ||||||||||||||||||| |||| |||||| Sbjct: 88020 cagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtg 88065 Score = 48.1 bits (24), Expect = 0.024 Identities = 66/80 (82%) Strand = Plus / Plus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||| | |||||||||||||||| || |||| |||| |||||| ||| ||| Sbjct: 98933 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 98992 Query: 329 ggcggcgagcttggcgttga 348 |||||||| | ||||||||| Sbjct: 98993 ggcggcgaccatggcgttga 99012 Score = 48.1 bits (24), Expect = 0.024 Identities = 66/80 (82%) Strand = Plus / Plus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||| ||||| |||||||| || | |||||| | |||| | ||||||||| Sbjct: 94534 gcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgcgggtc 94593 Query: 329 ggcggcgagcttggcgttga 348 | |||||| ||||||||||| Sbjct: 94594 gccggcgatcttggcgttga 94613
>dbj|AK104801.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C03, full insert sequence Length = 1096 Score = 170 bits (86), Expect = 2e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 827 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 768 Query: 329 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 388 |||||||||| ||| |||||||||||||| |||| |||| || | ||| ||||| || Sbjct: 767 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 708 Query: 389 caagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtg 434 || |||||| ||| ||||||||||||||||||| |||| |||||| Sbjct: 707 cagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtg 662
>dbj|AK104326.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-028-F10, full insert sequence Length = 996 Score = 170 bits (86), Expect = 2e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 820 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 761 Query: 329 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 388 |||||||||| ||| |||||||||||||| |||| |||| || | ||| ||||| || Sbjct: 760 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 701 Query: 389 caagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtg 434 || |||||| ||| ||||||||||||||||||| |||| |||||| Sbjct: 700 cagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtg 655
>dbj|AK071482.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093N24, full insert sequence Length = 1098 Score = 170 bits (86), Expect = 2e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 829 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 770 Query: 329 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 388 |||||||||| ||| |||||||||||||| |||| |||| || | ||| ||||| || Sbjct: 769 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 710 Query: 389 caagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtg 434 || |||||| ||| ||||||||||||||||||| |||| |||||| Sbjct: 709 cagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtg 664
>gb|AY108449.1| Zea mays PCO131734 mRNA sequence Length = 1072 Score = 107 bits (54), Expect = 3e-20 Identities = 56/57 (98%) Strand = Plus / Minus Query: 262 agacnacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 318 |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 822 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 766
>gb|BT009389.1| Triticum aestivum clone wlm96.pk036.e8:fis, full insert mRNA sequence Length = 1078 Score = 75.8 bits (38), Expect = 1e-10 Identities = 62/70 (88%) Strand = Plus / Minus Query: 268 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggt 327 |||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||| ||| Sbjct: 874 cgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcgctggt 815 Query: 328 cggcggcgag 337 |||||||||| Sbjct: 814 cggcggcgag 805
>gb|AY098515.1| Ananas comosus caffeoyl CoA O-methyltransferase mRNA, partial cds Length = 607 Score = 73.8 bits (37), Expect = 4e-10 Identities = 61/69 (88%) Strand = Plus / Minus Query: 270 cggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtcg 329 |||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| |||||| Sbjct: 361 cggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcgggggtcg 302 Query: 330 gcggcgagc 338 |||||||| Sbjct: 301 acggcgagc 293
>emb|AJ242980.1|ZMA242980 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene), 1136 BP Length = 1136 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 858 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 799 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 798 tcggcggcgagc 787
>gb|BT009186.1| Triticum aestivum clone wl1n.pk0141.a9:fis, full insert mRNA sequence Length = 1118 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 859 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 800 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 799 tcggcggcgagc 788
>gb|AY104406.1| Zea mays PCO108855 mRNA sequence Length = 1146 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 864 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 805 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 804 tcggcggcgagc 793
>gb|AY323271.1| Zea mays genotype Quebec28 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1320 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1293 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1234 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1233 tcggcggcgagc 1222
>gb|AY323270.1| Zea mays genotype Sibiriacka caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1306 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1279 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1220 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1219 tcggcggcgagc 1208
>gb|AY323269.1| Zea mays genotype PolarDent caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1308 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1281 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1222 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1221 tcggcggcgagc 1210
>gb|AY323268.1| Zea mays genotype RainbowFlint caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1314 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1287 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1228 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1227 tcggcggcgagc 1216
>gb|AY323267.1| Zea mays genotype NoordlanderVC145 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1311 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1284 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1225 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1224 tcggcggcgagc 1213
>gb|AY323266.1| Zea mays genotype RottalerSilomais caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1309 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1282 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1223 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1222 tcggcggcgagc 1211
>gb|AY323265.1| Zea mays genotype Du101 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323264.1| Zea mays genotype W64A caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1311 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1284 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1225 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1224 tcggcggcgagc 1213
>gb|AY323263.1| Zea mays genotype line16 (private BIOGEMMA line) caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323262.1| Zea mays genotype line212 (private BIOGEMMA line) caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1306 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1279 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1220 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1219 tcggcggcgagc 1208
>gb|AY323261.1| Zea mays genotype F66 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323260.1| Zea mays genotype F113 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323259.1| Zea mays genotype EP1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323258.1| Zea mays genotype B14 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323257.1| Zea mays genotype wis93-3520 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1311 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1284 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1225 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1224 tcggcggcgagc 1213
>gb|AY323256.1| Zea mays genotype F7 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1309 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1282 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1223 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1222 tcggcggcgagc 1211
>gb|AY323255.1| Zea mays genotype Wis94-443 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323254.1| Zea mays genotype F1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323253.1| Zea mays genotype Mo17 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1314 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1287 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1228 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1227 tcggcggcgagc 1216
>gb|AY323252.1| Zea mays genotype DE811 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1311 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1284 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1225 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1224 tcggcggcgagc 1213
>gb|AY323251.1| Zea mays genotype B73 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1537 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323250.1| Zea mays genotype F324 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323249.1| Zea mays genotype Lan496 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1549 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1284 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1225 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1224 tcggcggcgagc 1213
>gb|AY323248.1| Zea mays genotype MBS847 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323247.1| Zea mays genotype F4 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323246.1| Zea mays genotype F2 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1544 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1279 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1220 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1219 tcggcggcgagc 1208
>gb|AY323245.1| Zea mays genotype W117 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323244.1| Zea mays genotype F7012 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1546 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1281 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1222 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1221 tcggcggcgagc 1210
>gb|AY323243.1| Zea mays genotype F7025 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323242.1| Zea mays genotype F288 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1537 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1272 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1213 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1212 tcggcggcgagc 1201
>gb|AY323241.1| Zea mays genotype F271 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1211 tcggcggcgagc 1200
>gb|AY323240.1| Zea mays genotype F64 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1306 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1279 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1220 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1219 tcggcggcgagc 1208
>gb|AY323239.1| Zea mays genotype F286 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1309 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1282 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1223 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1222 tcggcggcgagc 1211
>gb|AY323238.1| Zea mays genotype F564 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1306 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1279 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1220 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1219 tcggcggcgagc 1208
>gb|AY644636.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA O-methyltransferase (COA1) gene, complete cds Length = 1272 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| ||| || Sbjct: 1165 acgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtgg 1106 Query: 327 tcggcggcgag 337 ||||||||||| Sbjct: 1105 tcggcggcgag 1095
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| ||| || Sbjct: 3314238 acgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtgg 3314179 Query: 327 tcggcggcgag 337 ||||||||||| Sbjct: 3314178 tcggcggcgag 3314168
>dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0015I14 Length = 150650 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| ||| || Sbjct: 101601 acgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtgg 101542 Query: 327 tcggcggcgag 337 ||||||||||| Sbjct: 101541 tcggcggcgag 101531
>dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone P0680A03 Length = 156054 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| ||| || Sbjct: 5792 acgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtgg 5733 Query: 327 tcggcggcgag 337 ||||||||||| Sbjct: 5732 tcggcggcgag 5722
>dbj|AK065744.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013039L12, full insert sequence Length = 1052 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| ||| || Sbjct: 846 acgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtgg 787 Query: 327 tcggcggcgag 337 ||||||||||| Sbjct: 786 tcggcggcgag 776
>emb|AJ242981.1|ZMA242981 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene), 1167 BP Length = 1167 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 858 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 799 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 798 tcggcggcgagc 787
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 310 ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 18420524 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 18420567
>dbj|AP005633.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0463G11 Length = 154188 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 310 ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 135260 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 135303
>dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0463D04 Length = 145828 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 310 ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 82398 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 82441
>dbj|AK108479.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-143-F02, full insert sequence Length = 959 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 310 ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 817 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 774
>gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1143 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1084 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1083 tcggcggcgagc 1072
>gb|AY279034.1| Zea mays Mo17 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1136 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1129 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1070 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1069 tcggcggcgagc 1058
>gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1143 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1084 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1083 tcggcggcgagc 1072
>gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1152 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1145 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1086 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1085 tcggcggcgagc 1074
>gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1145 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1138 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1079 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1078 tcggcggcgagc 1067
>gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1143 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1084 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1083 tcggcggcgagc 1072
>gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1222 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1155 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1096 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1095 tcggcggcgagc 1084
>gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1209 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1155 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1096 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1095 tcggcggcgagc 1084
>gb|AY279027.1| Zea mays F113 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1172 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1105 tcggcggcgagc 1094
>gb|AY279026.1| Zea mays De811 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1181 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1129 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1070 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1069 tcggcggcgagc 1058
>gb|AY279025.1| Zea mays Du101 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1172 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1105 tcggcggcgagc 1094
>gb|AY279024.1| Zea mays B14 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1181 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1129 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1070 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1069 tcggcggcgagc 1058
>gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1152 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1145 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1086 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1085 tcggcggcgagc 1074
>gb|AY279022.1| Zea mays B73 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1445 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1105 tcggcggcgagc 1094
>gb|AY279021.1| Zea mays Lan496 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1438 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1161 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1102 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1101 tcggcggcgagc 1090
>gb|AY279020.1| Zea mays F288 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1451 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1168 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1109 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1108 tcggcggcgagc 1097
>gb|AY279019.1| Zea mays W117 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1442 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1105 tcggcggcgagc 1094
>gb|AY279018.1| Zea mays MBS847 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1445 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1105 tcggcggcgagc 1094
>gb|AY279017.1| Zea mays F7012 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1444 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1105 tcggcggcgagc 1094
>gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1463 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1181 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1122 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1121 tcggcggcgagc 1110
>gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1464 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1181 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1122 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1121 tcggcggcgagc 1110
>gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1434 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1151 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1092 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1091 tcggcggcgagc 1080
>gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1143 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1084 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1083 tcggcggcgagc 1072
>gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1143 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1084 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1083 tcggcggcgagc 1072
>gb|AY279011.1| Zea mays F64 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1136 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1129 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1070 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1069 tcggcggcgagc 1058
>gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1153 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1146 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1087 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1086 tcggcggcgagc 1075
>gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1182 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1175 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1116 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1115 tcggcggcgagc 1104
>gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1206 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1155 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1096 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1095 tcggcggcgagc 1084
>gb|AY279007.1| Zea mays RainbowFlint caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1172 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1105 tcggcggcgagc 1094
>gb|AY279006.1| Zea mays NoordlanderVC145 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1172 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1105 tcggcggcgagc 1094
>gb|AY279005.1| Zea mays isolate 1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1181 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1129 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1070 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1069 tcggcggcgagc 1058
>gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1451 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcggg 326 ||||||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1172 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1113 Query: 327 tcggcggcgagc 338 |||||||||||| Sbjct: 1112 tcggcggcgagc 1101
>dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-CoA 3-O-methyltransferase, partial cds Length = 622 Score = 52.0 bits (26), Expect = 0.002 Identities = 59/70 (84%) Strand = Plus / Minus Query: 268 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggt 327 |||||||||||| |||| ||||||| ||| || ||||||||||| ||||| ||| || Sbjct: 387 cgcggcggcagagtgtgatgccgtcgccgacggggagctggcagatctcgacgcggtcgt 328 Query: 328 cggcggcgag 337 |||||||||| Sbjct: 327 cggcggcgag 318
>ref|XM_507282.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.26-2 mRNA Length = 1149 Score = 48.1 bits (24), Expect = 0.024 Identities = 66/80 (82%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||| ||||| |||||||| || | |||||| | |||| | ||||||||| Sbjct: 938 gcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgcgggtc 879 Query: 329 ggcggcgagcttggcgttga 348 | |||||| ||||||||||| Sbjct: 878 gccggcgatcttggcgttga 859
>ref|XM_483170.1| Oryza sativa (japonica cultivar-group), mRNA Length = 612 Score = 48.1 bits (24), Expect = 0.024 Identities = 66/80 (82%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||| ||||| |||||||| || | |||||| | |||| | ||||||||| Sbjct: 603 gcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgcgggtc 544 Query: 329 ggcggcgagcttggcgttga 348 | |||||| ||||||||||| Sbjct: 543 gccggcgatcttggcgttga 524
>ref|XM_483169.1| Oryza sativa (japonica cultivar-group), mRNA Length = 879 Score = 48.1 bits (24), Expect = 0.024 Identities = 66/80 (82%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||| ||||| |||||||| || | |||||| | |||| | ||||||||| Sbjct: 870 gcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgcgggtc 811 Query: 329 ggcggcgagcttggcgttga 348 | |||||| ||||||||||| Sbjct: 810 gccggcgatcttggcgttga 791
>gb|AY644638.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA O-methyltransferase (COA26) gene, complete cds Length = 1116 Score = 48.1 bits (24), Expect = 0.024 Identities = 66/80 (82%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||| | |||||||||||||||| || |||| |||| |||||| ||| ||| Sbjct: 1007 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 948 Query: 329 ggcggcgagcttggcgttga 348 |||||||| | ||||||||| Sbjct: 947 ggcggcgaccatggcgttga 928
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 311 gacctcgatgcgcgggtcggcggc 334 |||||||||||||||||||||||| Sbjct: 4035540 gacctcgatgcgcgggtcggcggc 4035517
>dbj|AK106735.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-A04, full insert sequence Length = 1895 Score = 48.1 bits (24), Expect = 0.024 Identities = 66/80 (82%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||| | |||||||||||||||| || |||| |||| |||||| ||| ||| Sbjct: 1671 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 1612 Query: 329 ggcggcgagcttggcgttga 348 |||||||| | ||||||||| Sbjct: 1611 ggcggcgaccatggcgttga 1592
>dbj|AK065515.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013030H15, full insert sequence Length = 1466 Score = 48.1 bits (24), Expect = 0.024 Identities = 66/80 (82%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||| ||||| |||||||| || | |||||| | |||| | ||||||||| Sbjct: 1091 gcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgcgggtc 1032 Query: 329 ggcggcgagcttggcgttga 348 | |||||| ||||||||||| Sbjct: 1031 gccggcgatcttggcgttga 1012
>dbj|AK061757.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-A06, full insert sequence Length = 1149 Score = 48.1 bits (24), Expect = 0.024 Identities = 66/80 (82%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 328 ||||||||||| ||||| |||||||| || | |||||| | |||| | ||||||||| Sbjct: 938 gcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgcgggtc 879 Query: 329 ggcggcgagcttggcgttga 348 | |||||| ||||||||||| Sbjct: 878 gccggcgatcttggcgttga 859
>gb|AY104670.1| Zea mays PCO117754 mRNA sequence Length = 976 Score = 46.1 bits (23), Expect = 0.095 Identities = 41/47 (87%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcagac 313 ||||||||||| | |||| |||||||||||||||| ||||||||| Sbjct: 776 acgcggcggcacagcgtgagcccgtcggcgatggcgacctggcagac 730
>gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0099O15, complete sequence Length = 137357 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 67 ccctctcctctcatcaaatttc 88 |||||||||||||||||||||| Sbjct: 118827 ccctctcctctcatcaaatttc 118848
>gb|AC093952.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1004_E02, complete sequence Length = 127642 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 67 ccctctcctctcatcaaatttc 88 |||||||||||||||||||||| Sbjct: 9747 ccctctcctctcatcaaatttc 9768
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 327 tcggcggcgagcttggcgttga 348 |||||||||||||||||||||| Sbjct: 4580941 tcggcggcgagcttggcgttga 4580920 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 401 cgccggcagcgccaccgtgc 420 |||||||||||||||||||| Sbjct: 2819105 cgccggcagcgccaccgtgc 2819124
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 67 ccctctcctctcatcaaatttc 88 |||||||||||||||||||||| Sbjct: 23728874 ccctctcctctcatcaaatttc 23728895
>dbj|AK062452.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-103-C05, full insert sequence Length = 551 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 67 ccctctcctctcatcaaatttc 88 |||||||||||||||||||||| Sbjct: 216 ccctctcctctcatcaaatttc 195
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence Length = 2726152 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 330 gcggcgagcttggcgttgagg 350 ||||||||||||||||||||| Sbjct: 363316 gcggcgagcttggcgttgagg 363296
>emb|AL138917.11| Human DNA sequence from clone RP3-354M18 on chromosome 6 Contains the 5' end of the APG5L gene for APG5 autophagy 5-like (S. cerevisiae) and a CpG island, complete sequence Length = 34768 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 aaaaaagtattattgaaaact 115 ||||||||||||||||||||| Sbjct: 11155 aaaaaagtattattgaaaact 11175
>emb|BX004812.8| Zebrafish DNA sequence from clone CH211-201M7 in linkage group 25, complete sequence Length = 189554 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 409 gcgccaccgtgccgccccaga 429 ||||||||||||||||||||| Sbjct: 13517 gcgccaccgtgccgccccaga 13537
>emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete genome; segment 27/29 Length = 303450 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 406 gcagcgccaccgtgccgcccc 426 ||||||||||||||||||||| Sbjct: 294427 gcagcgccaccgtgccgcccc 294447
>gb|AC147479.17| Mus musculus chromosome 17, clone RP24-178C19, complete sequence Length = 178820 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 ccactcctccctctcctctc 78 |||||||||||||||||||| Sbjct: 73124 ccactcctccctctcctctc 73105
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 317 gatgcgcgggtcggcggcga 336 |||||||||||||||||||| Sbjct: 369896 gatgcgcgggtcggcggcga 369877
>gb|AC151292.2| Mus musculus BAC clone RP23-138P14 from chromosome 17, complete sequence Length = 216585 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 ccactcctccctctcctctc 78 |||||||||||||||||||| Sbjct: 160872 ccactcctccctctcctctc 160891
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence Length = 3694126 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 315 tcgatgcgcgggtcggcggcgagc 338 ||||||||||| |||||||||||| Sbjct: 1810413 tcgatgcgcggctcggcggcgagc 1810390
>gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, complete sequence Length = 216191 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 155 ggaaaaataatacaattgattaag 178 ||||||||||| |||||||||||| Sbjct: 154435 ggaaaaataatgcaattgattaag 154412
>gb|AY627039.1| Brucella sp. mp-7 organophosphate pesticide hydrolase (mpd) gene, complete cds Length = 1062 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 271 ccggcagcgccaccgtgccg 252
>gb|AY627038.1| Ochrobactrum sp. mp-6 organophosphate pesticide hydrolase (mpd) gene, complete cds Length = 1062 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 271 ccggcagcgccaccgtgccg 252
>gb|AY627037.1| Ochrobactrum sp. mp-5 organophosphate pesticide hydrolase (mpd) gene, complete cds Length = 1062 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 271 ccggcagcgccaccgtgccg 252
>gb|AY627036.1| Ochrobactrum sp. mp-4 organophosphate pesticide hydrolase (mpd) gene, complete cds Length = 1068 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 277 ccggcagcgccaccgtgccg 258
>gb|AY627035.1| Ochrobactrum sp. mp-3 organophosphate pesticide hydrolase (mpd) gene, complete cds; and insertion sequence IS6100, partial sequence Length = 5231 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 2149 ccggcagcgccaccgtgccg 2130
>gb|AY627034.1| Achromobacter sp. mp-2 organophosphate pesticide hydrolase (mpd) gene, complete cds Length = 1062 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 271 ccggcagcgccaccgtgccg 252
>gb|AY627033.1| Pseudaminobacter sp. mp-1 organophosphate pesticide hydrolase (mpd) gene, complete cds; and insertion sequence IS6100 transposase gene, complete cds Length = 6758 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 3820 ccggcagcgccaccgtgccg 3801
>gb|AY657045.1| Synthetic construct Peudomonas aeruginosa clone FLH031886.01F PA5269 gene, partial cds Length = 276 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 325 ggtcggcggcgagcttggcgttga 348 |||||||||||||| ||||||||| Sbjct: 208 ggtcggcggcgagcatggcgttga 185
>gb|DQ173275.1| Burkholderia sp. FDS-1 methyl parathion hydrolase (mpd1) gene, complete cds Length = 2543 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 987 ccggcagcgccaccgtgccg 968
>gb|DQ173274.1| Burkholderia sp. FDS-1 methyl parathion hydrolase (mpd2) gene, complete cds Length = 3334 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 1687 ccggcagcgccaccgtgccg 1668
>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence Length = 2580084 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 401 cgccggcagcgccaccgtgc 420 |||||||||||||||||||| Sbjct: 1734234 cgccggcagcgccaccgtgc 1734215
>emb|AL591792.1|SME591792 Sinorhizobium meliloti 1021 complete chromosome; segment 11/12 Length = 333800 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 314 ctcgatgcgcgggtcggcggcgag 337 ||||||||||| |||||||||||| Sbjct: 116899 ctcgatgcgcgtgtcggcggcgag 116922
>gb|AY251554.2| Pseudomonas sp. WBC-3 transposon mph insertion sequence IS6100 transposase (tnpA) gene, complete cds, methyl parathion hydrolase (mpd) and hypothetical protein genes, complete cds, and insertion sequence IS6100 transposase (tnpB) gene, complete cds Length = 6614 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 3254 ccggcagcgccaccgtgccg 3235
>emb|AL606500.8| Human DNA sequence from clone RP11-274N19 on chromosome 1 Contains the 3' end of the KCNN3 gene for potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3, a novel gene and the 5' end of the ADAR gene for adenosine deaminase, RNA-specific, complete sequence Length = 173014 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 actcctccctctcctctcatcaaa 84 |||||||||||||| ||||||||| Sbjct: 107848 actcctccctctcccctcatcaaa 107871
>emb|AL603964.2| Human DNA sequence from clone RP13-13L9 on chromosome 6, complete sequence Length = 26986 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 59 ccactcctccctctcctctcatca 82 |||||| ||||||||||||||||| Sbjct: 3590 ccactcttccctctcctctcatca 3613
>emb|AL513342.7| Human DNA sequence from clone RP11-96F14 on chromosome 1 Contains part of the FMN2 gene for formin 2, complete sequence Length = 127208 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 61 actcctccctctcctctcat 80 |||||||||||||||||||| Sbjct: 48178 actcctccctctcctctcat 48159
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 361 cggcggaaaagcgggtgtcgaggt 384 ||||||||||||||||||| |||| Sbjct: 753080 cggcggaaaagcgggtgtccaggt 753103
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 398 gcccgccggcagcgccaccgtgccgccc 425 |||||||||||||||| ||| ||||||| Sbjct: 4826093 gcccgccggcagcgccgccgcgccgccc 4826120
>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the 5' end of the RORB gene for RAR-related orphan receptor B protein (RZRB, ROR-BETA), two novel genes and two CpG islands, complete sequence Length = 174874 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 tttaagagtacagtacataa 52 |||||||||||||||||||| Sbjct: 106430 tttaagagtacagtacataa 106411
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtc 292 ||||||||||||||||| |||||| Sbjct: 427746 gcggcggcagatggtgaggccgtc 427723
>gb|BT009093.1| Triticum aestivum clone wkm2c.pk005.b15:fis, full insert mRNA sequence Length = 1018 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 411 gccaccgtgccgccccagagcgtg 434 ||||| |||||||||||||||||| Sbjct: 649 gccacggtgccgccccagagcgtg 626
>emb|Y00624.1|ACMHC Acanthamoeba castellanii nonmuscle myosin heavy chain gene Length = 5894 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 334 cgagcttggcgttgaggtccctgagggcggcg 365 |||||||||||||| |||| ||||||||||| Sbjct: 3847 cgagcttggcgttggcgtccttgagggcggcg 3816
>emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete genome; segment 11/29 Length = 313800 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 315 tcgatgcgcgggtcggcggcgagc 338 |||| ||||||||||||||||||| Sbjct: 2353 tcgaagcgcgggtcggcggcgagc 2330
>emb|AJ417789.1|PSP417789 Polytomella sp. 'Pringsheim 198.80' mRNA for aldehyde dehydrogenase (aldh gene) Length = 2164 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 327 tcggcggcgagcttggcgttgagg 350 |||||||||||||||||| ||||| Sbjct: 767 tcggcggcgagcttggcgatgagg 744
>gb|AC116105.12| Mus musculus chromosome 1, clone RP23-23A4, complete sequence Length = 214780 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 60 cactcctccctctcctctca 79 |||||||||||||||||||| Sbjct: 84202 cactcctccctctcctctca 84221
>gb|DQ092437.1| Insertion vector pWSMK-T, complete sequence Length = 15969 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 3753 ccggcagcgccaccgtgccg 3734 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 2431 ccggcagcgccaccgtgccg 2412
>gb|DQ356953.1| Sphingomonas sp. Dsp-2 mpd gene, complete cds Length = 1053 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 205 ccggcagcgccaccgtgccg 186
>gb|DQ356952.1| Pseudomonas sp. Dsp-1 mpd gene, complete cds Length = 1014 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 810 ccggcagcgccaccgtgccg 829
>gb|DQ356951.1| Stenotrophomonas sp. Dsp-4 mpd gene, complete cds Length = 1023 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 810 ccggcagcgccaccgtgccg 829
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 401 cgccggcagcgccaccgtgc 420 |||||||||||||||||||| Sbjct: 3170008 cgccggcagcgccaccgtgc 3169989
>gb|DQ264732.1| Shuttle expression-secretion vector pP43NMK, complete sequence Length = 7680 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 4643 ccggcagcgccaccgtgccg 4624
>gb|AF338729.1|AF338729 Plesiomonas sp. M6 methyl parathion hydrolase (mpd) gene, complete cds Length = 2191 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 927 ccggcagcgccaccgtgccg 908
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 365 ggaaaagcgggtgtcgaggt 384 |||||||||||||||||||| Sbjct: 700594 ggaaaagcgggtgtcgaggt 700613
>gb|AC092118.3| Homo sapiens chromosome 16 clone CTD-2600O9, complete sequence Length = 148794 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 32 gtttaagagtacagtacata 51 |||||||||||||||||||| Sbjct: 114656 gtttaagagtacagtacata 114637
>gb|DQ001540.1| Burkholderia cepacia MpdB gene, complete cds Length = 996 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 205 ccggcagcgccaccgtgccg 186
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 315 tcgatgcgcgggtcggcggcgagc 338 |||| ||||||||||||||||||| Sbjct: 6387054 tcgaagcgcgggtcggcggcgagc 6387077
>gb|AE004939.1| Pseudomonas aeruginosa PAO1, section 500 of 529 of the complete genome Length = 10294 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 325 ggtcggcggcgagcttggcgttga 348 |||||||||||||| ||||||||| Sbjct: 8946 ggtcggcggcgagcatggcgttga 8923
>gb|AY007523.1| Pseudomonas fluorescens AlgH (algH), hypothetical protein, regulatory protein PyrR (pyrR), aspartate carbamoyl transferase PyrB (pyrB), and dihydro-orotase PyrC (pyrC) genes, complete cds; and unknown gene Length = 4080 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 284 gacgccgtcggcgatggcga 303 |||||||||||||||||||| Sbjct: 444 gacgccgtcggcgatggcga 425
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 325 ggtcggcggcgagcttggcg 344 |||||||||||||||||||| Sbjct: 1444782 ggtcggcggcgagcttggcg 1444763
>dbj|AB158406.1| Triticum aestivum CCoAMT mRNA for putative caffeoyl CoA O-methyltransferase, partial cds Length = 875 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 411 gccaccgtgccgccccagagcgtg 434 ||||| |||||||||||||||||| Sbjct: 641 gccacggtgccgccccagagcgtg 618
>gb|AY646835.2| Burkholderia sp. FDS-1 organophosphorus insecticide hydrolase (opdB) gene, complete cds Length = 1060 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 264 ccggcagcgccaccgtgccg 245
>gb|AY029773.1| Pseudomonas putida methyl parathion-degrading protein gene, complete cds Length = 1026 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccggcagcgccaccgtgccg 422 |||||||||||||||||||| Sbjct: 235 ccggcagcgccaccgtgccg 216
>dbj|AB070936.1| Streptomyces avermitilis siderophore biosynthetic gene cluster Length = 10056 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 315 tcgatgcgcgggtcggcggcgagc 338 |||| ||||||||||||||||||| Sbjct: 5465 tcgaagcgcgggtcggcggcgagc 5488 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,441,651 Number of Sequences: 3902068 Number of extensions: 3441651 Number of successful extensions: 81398 Number of sequences better than 10.0: 160 Number of HSP's better than 10.0 without gapping: 160 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 79686 Number of HSP's gapped (non-prelim): 1695 length of query: 434 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 412 effective length of database: 17,147,199,772 effective search space: 7064646306064 effective search space used: 7064646306064 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)