>emb|AJ890250.1| Triticum aestivum partial mRNA for putative glucan
            endo-1,3-beta-D-glucosidase (wgluc5 gene)
          Length = 1242

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 71/83 (85%), Gaps = 6/83 (7%)
 Strand = Plus / Minus

                                                                        
Query: 13   ttctctttattcatgacagacg--gcatagcaccacctgcaatggttgc---actcttgc 67
            ||||||||||||||||||||||    ||| ||||||||| |||||| ||   ||||||||
Sbjct: 1228 ttctctttattcatgacagacgatatataacaccacctggaatggtcgcactactcttgc 1169

                                   
Query: 68   atgaatcg-tgttatgacatgca 89
            |||||||| |||| |||||||||
Sbjct: 1168 atgaatcgatgttctgacatgca 1146

>gb|AC121364.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0052E20, complete sequence
          Length = 162434

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    tgcaatggttgcactcttgc 67
             ||||||||||||||||||||
Sbjct: 33398 tgcaatggttgcactcttgc 33417

>dbj|AK153596.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630010I08 product:unclassifiable, full
           insert sequence
          Length = 1375

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 9   atctttctctttattcatga 28
           ||||||||||||||||||||
Sbjct: 327 atctttctctttattcatga 308

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 48       tgcaatggttgcactcttgc 67
                ||||||||||||||||||||
Sbjct: 22929385 tgcaatggttgcactcttgc 22929404

>gb|AC154848.2| Mus musculus BAC clone RP23-38J19 from 13, complete sequence
          Length = 140465

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      atctttctctttattcatga 28
              ||||||||||||||||||||
Sbjct: 139940 atctttctctttattcatga 139921

>emb|CT025639.13| Mouse DNA sequence from clone RP23-233I11 on chromosome 13, complete
              sequence
          Length = 219226

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      atctttctctttattcatga 28
              ||||||||||||||||||||
Sbjct: 150464 atctttctctttattcatga 150483

>gb|AC121588.2| Mus musculus chromosome 3 clone RP23-275K22, complete sequence
          Length = 189679

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 26/27 (96%), Gaps = 1/27 (3%)
 Strand = Plus / Minus

                                         
Query: 71     aatcgtgttatgacatgcattgatctg 97
              |||||||||||||| ||||||||||||
Sbjct: 187882 aatcgtgttatgac-tgcattgatctg 187857

>ref|XM_947008.1| Theileria annulata strain Ankara histone H2A variant (TA14155)
           partial mRNA
          Length = 459

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 41  caccacctgcaatggttgc 59
           |||||||||||||||||||
Sbjct: 379 caccacctgcaatggttgc 361

>emb|AL133549.11| Human DNA sequence from clone RP11-32F11 on chromosome 9p24.1-24.3
             Contains the 3'end of the RFX3 gene for regulatory factor
             X 3 (influences HLA class II expression), a novel gene and
             a CpG island, complete sequence
          Length = 162237

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 76    tgttatgacatgcattgat 94
             |||||||||||||||||||
Sbjct: 80851 tgttatgacatgcattgat 80833

>emb|CR405705.11| Zebrafish DNA sequence from clone DKEY-64E13 in linkage group 17,
             complete sequence
          Length = 155058

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 39    agcaccacctgcaatggttgcac 61
             |||||||| ||||||||||||||
Sbjct: 72946 agcaccacttgcaatggttgcac 72924

>emb|AL672072.18| Zebrafish DNA sequence from clone BUSM1-55H21 Contains a CpG island,
             complete sequence
          Length = 100697

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 39    agcaccacctgcaatggttgcac 61
             |||||||| ||||||||||||||
Sbjct: 41283 agcaccacttgcaatggttgcac 41261

>gb|AC011422.2|AC011422 Homo sapiens chromosome 5 clone CTD-2335E17, complete sequence
          Length = 119668

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 10     tctttctctttattcatga 28
              |||||||||||||||||||
Sbjct: 118813 tctttctctttattcatga 118831

>gb|AC147267.6| Mus musculus BAC clone RP24-263E13 from chromosome 3, complete sequence
          Length = 155979

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 26/27 (96%), Gaps = 1/27 (3%)
 Strand = Plus / Plus

                                         
Query: 71     aatcgtgttatgacatgcattgatctg 97
              |||||||||||||| ||||||||||||
Sbjct: 104563 aatcgtgttatgac-tgcattgatctg 104588

>emb|AL672171.8| Zebrafish DNA sequence from clone BUSM1-270G24 in linkage group 3
             Contains a CpG island, complete sequence
          Length = 114103

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 39    agcaccacctgcaatggttgcac 61
             |||||||| ||||||||||||||
Sbjct: 43216 agcaccacttgcaatggttgcac 43194

>emb|AL358275.4|CNS05TDY Human chromosome 14 DNA sequence BAC R-666E17 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 178651

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 14     tctctttattcatgacaga 32
              |||||||||||||||||||
Sbjct: 168336 tctctttattcatgacaga 168354


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 806,552
Number of Sequences: 3902068
Number of extensions: 806552
Number of successful extensions: 55248
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 55224
Number of HSP's gapped (non-prelim): 25
length of query: 98
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 77
effective length of database: 17,151,101,840
effective search space: 1320634841680
effective search space used: 1320634841680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)