ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart06f12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000316.1| Polaromonas sp. JS666, complete genome 42 0.69
2ref|NM_174425.2| Bos taurus phospholipase C, gamma 1 (PLCG1), mRNA 40 2.7
3ref|XM_955382.1| Neurospora crassa OR74A hypothetical protein (N... 40 2.7
4ref|XM_325367.1| Neurospora crassa OR74A hypothetical protein (N... 40 2.7
5ref|XM_974441.1| PREDICTED: Mus musculus hypothetical protein LO... 40 2.7
6dbj|AK123568.1| Homo sapiens cDNA FLJ41574 fis, clone CTONG20101... 40 2.7
7gb|AC011416.3| Homo sapiens chromosome 5 clone CTB-88F18, comple... 40 2.7
8emb|Y00301.1|BTPLCII Bos taurus mRNA for phosphatidylinositol-sp... 40 2.7
9dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 40 2.7
10emb|CT025624.11| Mouse DNA sequence from clone RP24-212N20 on ch... 40 2.7
11gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 2.7
12gb|L10348.1|TTHNUSG Thermus thermophilus transcription factor (n... 40 2.7

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 124     ccaccgtcgcctccttgggct 144
               |||||||||||||||||||||
Sbjct: 3945696 ccaccgtcgcctccttgggct 3945716



to top

>ref|NM_174425.2| Bos taurus phospholipase C, gamma 1 (PLCG1), mRNA
          Length = 4344

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 132  gcctccttgggctcctcctc 151
            ||||||||||||||||||||
Sbjct: 1645 gcctccttgggctcctcctc 1626



to top

>ref|XM_955382.1| Neurospora crassa OR74A hypothetical protein (NCU05513.1) partial
           mRNA
          Length = 1857

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 136 ccttgggctcctcctcgtcc 155
           ||||||||||||||||||||
Sbjct: 148 ccttgggctcctcctcgtcc 129



to top

>ref|XM_325367.1| Neurospora crassa OR74A hypothetical protein (NCU05513.1) partial
           mRNA
          Length = 1857

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 136 ccttgggctcctcctcgtcc 155
           ||||||||||||||||||||
Sbjct: 148 ccttgggctcctcctcgtcc 129



to top

>ref|XM_974441.1| PREDICTED: Mus musculus hypothetical protein LOC665082 (LOC665082),
           mRNA
          Length = 546

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 132 gcctccttgggctcctcctcgtcc 155
           ||||||| ||||||||||||||||
Sbjct: 363 gcctcctcgggctcctcctcgtcc 386



to top

>dbj|AK123568.1| Homo sapiens cDNA FLJ41574 fis, clone CTONG2010116, weakly  similar
           to Rattus norvegicus mRNA for MEGF6
          Length = 2952

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 176 tccccgcgtctcccgcaggcaggc 199
           |||||| |||||||||||||||||
Sbjct: 188 tccccgggtctcccgcaggcaggc 165



to top

>gb|AC011416.3| Homo sapiens chromosome 5 clone CTB-88F18, complete sequence
          Length = 142357

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 176   tccccgcgtctcccgcaggcaggc 199
             |||||| |||||||||||||||||
Sbjct: 55016 tccccgggtctcccgcaggcaggc 55039



to top

>emb|Y00301.1|BTPLCII Bos taurus mRNA for phosphatidylinositol-specific phospholipase C
          Length = 4344

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 132  gcctccttgggctcctcctc 151
            ||||||||||||||||||||
Sbjct: 1645 gcctccttgggctcctcctc 1626



to top

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 132    gcctccttgggctcctcctcgtcc 155
              ||||| ||||||||||||||||||
Sbjct: 238318 gcctcgttgggctcctcctcgtcc 238341



to top

>emb|CT025624.11| Mouse DNA sequence from clone RP24-212N20 on chromosome 14, complete
             sequence
          Length = 198113

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 132   gcctccttgggctcctcctcgtcc 155
             ||||||| ||||||||||||||||
Sbjct: 65546 gcctcctcgggctcctcctcgtcc 65523



to top

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 132     gcctccttgggctcctcctcgtcc 155
               ||||| ||||||||||||||||||
Sbjct: 1651762 gcctcgttgggctcctcctcgtcc 1651739



to top

>gb|L10348.1|TTHNUSG Thermus thermophilus transcription factor (nusG) gene, complete cds
          Length = 1314

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 132 gcctccttgggctcctcctcgtcc 155
           ||||| ||||||||||||||||||
Sbjct: 838 gcctcgttgggctcctcctcgtcc 815


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,136,685
Number of Sequences: 3902068
Number of extensions: 1136685
Number of successful extensions: 87510
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 87258
Number of HSP's gapped (non-prelim): 252
length of query: 214
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 192
effective length of database: 17,147,199,772
effective search space: 3292262356224
effective search space used: 3292262356224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top