>emb|X91347.1|HVUDPGPP H.vulgare mRNA for UDP-glucose pyrophosphorylase
          Length = 1783

 Score =  618 bits (312), Expect = e-174
 Identities = 337/347 (97%)
 Strand = Plus / Minus

                                                                        
Query: 1    atggcatcatcatatcaaataaccnaaagaaattttacgtccctggcactcccaggaaga 60
            ||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||
Sbjct: 1768 atggcatcatcatatcatataaccaaaagaaattttacgtccctggcactcccaggaaga 1709

                                                                        
Query: 61   acggaagtgtcaatggaccgcacggaggggattacagttattatgtaacagggctcccgc 120
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 1708 acggaagtgtcaatggaccgcacggaggggattacagttattatgtaacggggctcccgc 1649

                                                                        
Query: 121  aggacaacaccccagcagaatgcacacgaaaaattacnggacggttaacccagcaaagga 180
            ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 1648 aggacaacaccccagcagaatgcacacgaaaaattacaggacggttaactcagcaaagga 1589

                                                                        
Query: 181  ggaccggaaggtttctggggatgcgagaaggtgggcgggcaggcgggtgaacgtcactca 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1588 ggaccggaaggtttctggggatgcgagaaggtgggcgggcaggcgggtgaacgtcactca 1529

                                                                        
Query: 241  natatccnctgggccgctgatgtccttgttctcaagcaccgctccgtctgggatctccaa 300
             |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1528 aatatcctctgggccgttgatgtccttgttctcaagcaccgctccgtctgggatctccaa 1469

                                                           
Query: 301  cttgactccngccttggcggcaatggtcacgttgcccttgagtacga 347
            ||||||||| ||||||||||| |||||||||||||||||||||||||
Sbjct: 1468 cttgactccagccttggcggcgatggtcacgttgcccttgagtacga 1422

>gb|BT009219.1| Triticum aestivum clone wle1n.pk0063.d7:fis, full insert mRNA
            sequence
          Length = 1814

 Score =  194 bits (98), Expect = 1e-46
 Identities = 169/191 (88%), Gaps = 3/191 (1%)
 Strand = Plus / Minus

                                                                        
Query: 14   atcaaataaccnaaagaaattttacgtccctggcactcccaggaagaacggaagtgtcaa 73
            |||| |||||| |||||||||||||||||||||||| ||||||||||||  ||||||  |
Sbjct: 1739 atcatataaccaaaagaaattttacgtccctggcacgcccaggaagaac--aagtgtaga 1682

                                                                        
Query: 74   tggaccgcacggaggggattacagttattatgtaacagggctcccgcaggacaacacccc 133
            || || |||| |||||||||||| |||||||||||  |||||  | ||||||||||||||
Sbjct: 1681 tgaacagcacagaggggattacaattattatgtaagggggctatcccaggacaacacccc 1622

                                                                        
Query: 134  agcagaatgcacacgaaaaattacnggacggttaacccagcaaaggaggaccggaaggtt 193
            ||||||||||||||| |||||||| ||||||||||| || | ||||||||||||||||||
Sbjct: 1621 agcagaatgcacacg-aaaattacaggacggttaactcaacgaaggaggaccggaaggtt 1563

                       
Query: 194  tctggggatgc 204
            |||||| ||||
Sbjct: 1562 tctgggaatgc 1552



 Score =  131 bits (66), Expect = 2e-27
 Identities = 89/97 (91%)
 Strand = Plus / Minus

                                                                        
Query: 251  gggccgctgatgtccttgttctcaagcaccgctccgtctgggatctccaacttgactccn 310
            |||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||| 
Sbjct: 1513 gggccgttgatgtccttgttctccagcacagctccgtctgggatctccaacttgactcca 1454

                                                 
Query: 311  gccttggcggcaatggtcacgttgcccttgagtacga 347
            |||||||| || |||||||||||||||| ||| ||||
Sbjct: 1453 gccttggctgcgatggtcacgttgccctcgagcacga 1417

>gb|AY178448.1| Bambusa oldhamii UDP-glucose pyrophosphorylase (UGP) mRNA, complete
            cds
          Length = 1731

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                        
Query: 258  tgatgtccttgttctcaagcaccgctccgtctgggatctccaacttgactccngccttgg 317
            |||||||||||||||||||||| | ||| ||||| ||||||| ||| ||||| | |||||
Sbjct: 1504 tgatgtccttgttctcaagcacagttccatctggaatctccagcttcactccagacttgg 1445

                                      
Query: 318  cggcaatggtcacgttgcccttgagt 343
            | |  |||||||| ||||||||||||
Sbjct: 1444 cagagatggtcaccttgcccttgagt 1419

>dbj|AK119232.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-114-E10, full
            insert sequence
          Length = 1696

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 258  tgatgtccttgttctcaagcaccgctccgtctgggatctccaactt 303
            |||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 1477 tgatgtccttgttctcaagcacggctccatctgggatctccaactt 1432

>dbj|AK119197.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-C12, full
            insert sequence
          Length = 1727

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 258  tgatgtccttgttctcaagcaccgctccgtctgggatctccaactt 303
            |||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 1478 tgatgtccttgttctcaagcacggctccatctgggatctccaactt 1433

>dbj|AK104344.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-B12, full
            insert sequence
          Length = 1695

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 258  tgatgtccttgttctcaagcaccgctccgtctgggatctccaactt 303
            |||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 1476 tgatgtccttgttctcaagcacggctccatctgggatctccaactt 1431

>dbj|AK103930.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E03, full
            insert sequence
          Length = 1694

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 258  tgatgtccttgttctcaagcaccgctccgtctgggatctccaactt 303
            |||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 1470 tgatgtccttgttctcaagcacggctccatctgggatctccaactt 1425

>dbj|AK065780.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013039M01, full
            insert sequence
          Length = 1750

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 258  tgatgtccttgttctcaagcaccgctccgtctgggatctccaactt 303
            |||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 1477 tgatgtccttgttctcaagcacggctccatctgggatctccaactt 1432

>dbj|AB062606.1| Oryza sativa (japonica cultivar-group) UGP mRNA for UDP-glucose
            pyrophosphorylase, complete cds
          Length = 1700

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 258  tgatgtccttgttctcaagcaccgctccgtctgggatctccaactt 303
            |||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 1457 tgatgtccttgttctcaagcacggctccatctgggatctccaactt 1412

>gb|BT016879.1| Zea mays clone Contig712 mRNA sequence
          Length = 1052

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                       
Query: 263 tccttgttctcaagcaccgctccgtctgggatctccaacttgactccngccttggcggca 322
           |||||||||||||| ||  |||| ||||| ||||||||||| ||||| | |||||||  |
Sbjct: 265 tccttgttctcaagtacgtctccatctggaatctccaacttcactccaggcttggcgata 324

                                
Query: 323 atggtcacgttgcccttgagt 343
           || ||||| ||||||||||||
Sbjct: 325 attgtcaccttgcccttgagt 345

>gb|AC137596.2| Oryza sativa (japonica cultivar-group) chromosome 9 clone
             OSJNBb0031H05, complete sequence
          Length = 141200

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                     
Query: 264   ccttgttctcaagcaccgctccgtctgggatctccaactt 303
             |||||||||||||||| ||||| |||||||||||||||||
Sbjct: 77270 ccttgttctcaagcacggctccatctgggatctccaactt 77231

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                        
Query: 264      ccttgttctcaagcaccgctccgtctgggatctccaactt 303
                |||||||||||||||| ||||| |||||||||||||||||
Sbjct: 21620644 ccttgttctcaagcacggctccatctgggatctccaactt 21620605

>dbj|AP005564.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1228_C03, complete sequence
          Length = 31468

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                     
Query: 264   ccttgttctcaagcaccgctccgtctgggatctccaactt 303
             |||||||||||||||| ||||| |||||||||||||||||
Sbjct: 28968 ccttgttctcaagcacggctccatctgggatctccaactt 28929

>gb|BT018223.1| Zea mays clone EL01N0561D12.c mRNA sequence
          Length = 1307

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 63/75 (84%)
 Strand = Plus / Minus

                                                                        
Query: 264  ccttgttctcaagcaccgctccgtctgggatctccaacttgactccngccttggcggcaa 323
            ||||||||||||| ||  |||| ||||| ||||||||||| ||||| | |||||||  ||
Sbjct: 1062 ccttgttctcaagtacgtctccatctggaatctccaacttcactccaggcttggcgataa 1003

                           
Query: 324  tggtcacgttgccct 338
            | ||||| |||||||
Sbjct: 1002 ttgtcaccttgccct 988

>gb|BT016795.1| Zea mays clone Contig628 mRNA sequence
          Length = 1522

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 tccttgttctcaagcaccgctccgtctgggatctccaacttgactccngccttggcggca 322
           |||||||| ||||  || ||||| ||||| | ||||||||| ||||| | ||||||||  
Sbjct: 954 tccttgttttcaaatacagctccatctggaacctccaacttcactccagacttggcggtg 895

                               
Query: 323 atggtcacgttgcccttgag 342
           || ||||| |||||||||||
Sbjct: 894 attgtcaccttgcccttgag 875

>gb|AY103595.1| Zea mays PCO108378 mRNA sequence
          Length = 1960

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 263  tccttgttctcaagcaccgctccgtctgggatctccaacttgactccngccttggcggca 322
            |||||||| ||||  || ||||| ||||| | ||||||||| ||||| | ||||||||  
Sbjct: 1540 tccttgttttcaaatacagctccatctggaacctccaacttcactccagacttggcggtg 1481

                                
Query: 323  atggtcacgttgcccttgag 342
            || ||||| |||||||||||
Sbjct: 1480 attgtcaccttgcccttgag 1461

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 214     ggcgggcaggcgggtgaacg 233
               ||||||||||||||||||||
Sbjct: 3059650 ggcgggcaggcgggtgaacg 3059631

>gb|AC105470.17| Rattus norvegicus 10 BAC CH230-192N7 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 212491

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   ggtgggcgggcaggcgggtg 229
             ||||||||||||||||||||
Sbjct: 98734 ggtgggcgggcaggcgggtg 98753

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 312     ccttggcggcaatggtcacg 331
               ||||||||||||||||||||
Sbjct: 4637317 ccttggcggcaatggtcacg 4637336

>emb|AL162852.14| Human DNA sequence from clone RP11-267I18 on chromosome 13 Contains a
             novel gene, complete sequence
          Length = 110166

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    gttattatgtaacagggctc 116
             ||||||||||||||||||||
Sbjct: 97072 gttattatgtaacagggctc 97091

>emb|AL132765.38|HSA462D18 Human DNA sequence from clone RP11-462D18 on chromosome 20 Contains the
              5' end of the BFSP1 gene for beaded filament structural
              protein 1 (filensin), the DSTN gene for destrin (actin
              depolymerizing factor ADF),  a ras-like pseudogene, the
              RRBP1 gene for ribosome binding protein 1 (dog 180 kDa
              homolog), the 5' end of the C20orf179 gene for chromosome
              20 open reading frame 179 and two CpG islands, complete
              sequence
          Length = 166001

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 43     ctggcactcccaggaagaac 62
              ||||||||||||||||||||
Sbjct: 126669 ctggcactcccaggaagaac 126650

>emb|AL646093.9| Mouse DNA sequence from clone RP23-55I2 on chromosome 11 Contains the
             Kcnj12 gene for potassium inwardly-rectifying channel
             subfamily J member 12, a ribosomal protein L27a (Rpl27a)
             pseudogene, the Tnfrsf13b gene for tumor necrosis factor
             receptor superfamily member 13b, the Usp22 gene for
             ubiquitin specific protease 22, a ribosomal protein S13
             (Rps13) pseudogene, the Aldh3a1 gene for aldehyde
             dehydrogenase family 3 subfamily A1, the 3' end of one
             variant of the Aldh3a2 gene for aldehyde dehydrogenase
             family 3 subfamily A2 and three CpG islands, complete
             sequence
          Length = 241400

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 210   ggtgggcgggcaggcgggtg 229
             ||||||||||||||||||||
Sbjct: 17683 ggtgggcgggcaggcgggtg 17664

>gb|AY942707.1| Streptomyces noursei ATCC 11455 lantibiotic biosynthesis gene
            cluster, complete sequence
          Length = 13830

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 210  ggtgggcgggcaggcgggtg 229
            ||||||||||||||||||||
Sbjct: 5072 ggtgggcgggcaggcgggtg 5091

>dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, complete genome
          Length = 2685015

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 4       gcatcatcatatcaaataac 23
               ||||||||||||||||||||
Sbjct: 2169370 gcatcatcatatcaaataac 2169389

>gb|AC096627.28| Mus musculus strain C57BL/6J clone rp23-77b23 map 11, complete sequence
          Length = 264908

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 210    ggtgggcgggcaggcgggtg 229
              ||||||||||||||||||||
Sbjct: 195150 ggtgggcgggcaggcgggtg 195131

>emb|AL589870.30| Mouse DNA sequence from clone RP23-118A2 on chromosome 2, complete
              sequence
          Length = 202686

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 210    ggtgggcgggcaggcgggtg 229
              ||||||||||||||||||||
Sbjct: 135177 ggtgggcgggcaggcgggtg 135196


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,105,110
Number of Sequences: 3902068
Number of extensions: 2105110
Number of successful extensions: 35687
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35608
Number of HSP's gapped (non-prelim): 77
length of query: 347
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 325
effective length of database: 17,147,199,772
effective search space: 5572839925900
effective search space used: 5572839925900
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)