ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart06c02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL359632.9| Human DNA sequence from clone RP11-269P11 on chr... 44 0.14
2gb|AC109249.17| Mus musculus chromosome 13, clone RP23-78E1, com... 40 2.2
3gb|AC160107.2| Mus musculus BAC clone RP24-252N17 from chromosom... 40 2.2
4emb|AL772308.4| Mouse DNA sequence from clone RP23-451I21 on chr... 40 2.2
5gb|AC117721.8| Mus musculus chromosome 1, clone RP24-196D2, comp... 38 8.6
6ref|XM_586753.2| PREDICTED: Bos taurus similar to sacsin (LOC539... 38 8.6
7gb|AC146029.4| Pan troglodytes BAC clone RP43-124D5 from 7, comp... 38 8.6
8gb|AC162380.4| Pan troglodytes BAC clone CH251-629G18 from chrom... 38 8.6
9gb|AC161122.3| Pan troglodytes BAC clone CH251-727J16 from chrom... 38 8.6
10gb|AC000120.1| Homo sapiens BAC clone CTB-161K23 from 7, complet... 38 8.6
11emb|AL354937.12| Human DNA sequence from clone RP11-50K12 on chr... 38 8.6
12gb|AC099742.2| Papio anubis clone RP41-167P22, complete sequence 38 8.6
13gb|AC183776.2| Pan troglodytes BAC clone CH251-246H3 from chromo... 38 8.6
14gb|AC098675.2| Homo sapiens BAC clone RP11-370K14 from 4, comple... 38 8.6
15gb|AC139053.15| Mus musculus chromosome 1, clone RP23-2I19, comp... 38 8.6
16gb|AC161278.2| Pan troglodytes BAC clone CH251-486B7 from chromo... 38 8.6
17gb|AF103594.1|AF103594 Homo sapiens isolate donor D clone D11L i... 38 8.6
18gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 38 8.6
19gb|AC002064.1|HSAC002064 Human BAC clone RG016J04 from 7q21, com... 38 8.6

>emb|AL359632.9| Human DNA sequence from clone RP11-269P11 on chromosome 9 Contains the
             3' end of the MAPKAP1 gene for mitogen-activated protein
             kinase associated protein 1 and a CpG island, complete
             sequence
          Length = 95397

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 52    aggaaggtataccagcaaagaa 73
             ||||||||||||||||||||||
Sbjct: 88902 aggaaggtataccagcaaagaa 88923



to top

>gb|AC109249.17| Mus musculus chromosome 13, clone RP23-78E1, complete sequence
          Length = 203574

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 8     ggacaacattcacatgctca 27
             ||||||||||||||||||||
Sbjct: 26829 ggacaacattcacatgctca 26810



to top

>gb|AC160107.2| Mus musculus BAC clone RP24-252N17 from chromosome 13, complete sequence
          Length = 178725

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 8      ggacaacattcacatgctca 27
              ||||||||||||||||||||
Sbjct: 149086 ggacaacattcacatgctca 149067



to top

>emb|AL772308.4| Mouse DNA sequence from clone RP23-451I21 on chromosome 15, complete
             sequence
          Length = 148496

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   caggtacacaacccagaagg 126
             ||||||||||||||||||||
Sbjct: 37662 caggtacacaacccagaagg 37643



to top

>gb|AC117721.8| Mus musculus chromosome 1, clone RP24-196D2, complete sequence
          Length = 170426

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 11    caacattcacatgctcata 29
             |||||||||||||||||||
Sbjct: 11178 caacattcacatgctcata 11196



to top

>ref|XM_586753.2| PREDICTED: Bos taurus similar to sacsin (LOC539378), mRNA
          Length = 13728

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   caggtacacaacccagaag 125
             |||||||||||||||||||
Sbjct: 10396 caggtacacaacccagaag 10378



to top

>gb|AC146029.4| Pan troglodytes BAC clone RP43-124D5 from 7, complete sequence
          Length = 190776

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     atgctcataatgaatagaa 39
              |||||||||||||||||||
Sbjct: 128418 atgctcataatgaatagaa 128436



to top

>gb|AC162380.4| Pan troglodytes BAC clone CH251-629G18 from chromosome 7, complete
              sequence
          Length = 210978

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     atgctcataatgaatagaa 39
              |||||||||||||||||||
Sbjct: 142903 atgctcataatgaatagaa 142885



to top

>gb|AC161122.3| Pan troglodytes BAC clone CH251-727J16 from chromosome 7, complete
              sequence
          Length = 211581

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 59     tataccagcaaagaataat 77
              |||||||||||||||||||
Sbjct: 152825 tataccagcaaagaataat 152807



to top

>gb|AC000120.1| Homo sapiens BAC clone CTB-161K23 from 7, complete sequence
          Length = 142396

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 59     tataccagcaaagaataat 77
              |||||||||||||||||||
Sbjct: 111575 tataccagcaaagaataat 111557



to top

>emb|AL354937.12| Human DNA sequence from clone RP11-50K12 on chromosome 9 Contains a novel
              pseuodgene, complete sequence
          Length = 164276

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 58     gtataccagcaaagaataa 76
              |||||||||||||||||||
Sbjct: 123085 gtataccagcaaagaataa 123103



to top

>gb|AC099742.2| Papio anubis clone RP41-167P22, complete sequence
          Length = 171612

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     atgctcataatgaatagaa 39
              |||||||||||||||||||
Sbjct: 125792 atgctcataatgaatagaa 125774



to top

>gb|AC183776.2| Pan troglodytes BAC clone CH251-246H3 from chromosome 7, complete
              sequence
          Length = 160056

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     atgctcataatgaatagaa 39
              |||||||||||||||||||
Sbjct: 152153 atgctcataatgaatagaa 152171



to top

>gb|AC098675.2| Homo sapiens BAC clone RP11-370K14 from 4, complete sequence
          Length = 91915

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    acaacattcacatgctcat 28
             |||||||||||||||||||
Sbjct: 35698 acaacattcacatgctcat 35680



to top

>gb|AC139053.15| Mus musculus chromosome 1, clone RP23-2I19, complete sequence
          Length = 232850

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 11     caacattcacatgctcata 29
              |||||||||||||||||||
Sbjct: 106306 caacattcacatgctcata 106288



to top

>gb|AC161278.2| Pan troglodytes BAC clone CH251-486B7 from chromosome 7, complete
             sequence
          Length = 211383

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    atgctcataatgaatagaa 39
             |||||||||||||||||||
Sbjct: 21981 atgctcataatgaatagaa 21999



to top

>gb|AF103594.1|AF103594 Homo sapiens isolate donor D clone D11L immunoglobulin lambda light
           chain variable region mRNA, partial cds
          Length = 318

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 139 aacaccacacgaccgaagt 157
           |||||||||||||||||||
Sbjct: 270 aacaccacacgaccgaagt 252



to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 13      acattcacatgctcataat 31
               |||||||||||||||||||
Sbjct: 1916531 acattcacatgctcataat 1916513



to top

>gb|AC002064.1|HSAC002064 Human BAC clone RG016J04 from 7q21, complete sequence
          Length = 156214

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    atgctcataatgaatagaa 39
             |||||||||||||||||||
Sbjct: 67498 atgctcataatgaatagaa 67480


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,064,591
Number of Sequences: 3902068
Number of extensions: 1064591
Number of successful extensions: 73967
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73921
Number of HSP's gapped (non-prelim): 46
length of query: 176
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 154
effective length of database: 17,147,199,772
effective search space: 2640668764888
effective search space used: 2640668764888
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top