ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart06b04 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_475605.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2313 Score = 234 bits (118), Expect = 2e-58 Identities = 220/254 (86%) Strand = Plus / Minus Query: 184 ccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgagg 243 |||||||| |||||||| || |||||||| || | |||||||||||||||||||| |||| Sbjct: 2288 ccatgcgcggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgagg 2229 Query: 244 atgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacg 303 ||||||||||| || || || || |||||||||||||| ||||||||||| |||||||| Sbjct: 2228 atgttgagcgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcacc 2169 Query: 304 gcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcaccc 363 || |||||||||||||| ||||||||||| ||||| ||| | || | ||||| ||| || Sbjct: 2168 gccgccttgtgcgcctcggagcccttgggccccagcgacctcgcctcctccgtcgccccg 2109 Query: 364 gcctcgatgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggcc 423 ||||||||||||||||||||||||||||| || || |||||||| || ||||| || ||| Sbjct: 2108 gcctcgatgtacttcttggcgttgtcccacgcgccgccgctgttcgacgccgagatcgcc 2049 Query: 424 acctgcacgccgga 437 |||||||| ||||| Sbjct: 2048 acctgcaccccgga 2035
>ref|NM_183912.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2322 Score = 234 bits (118), Expect = 2e-58 Identities = 226/262 (86%) Strand = Plus / Minus Query: 181 cctccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatg 240 |||||||| || || ||||||||||||||||| || || |||||||||||||||||||| Sbjct: 2306 cctccatgggcggcaaagaatggcgcgaagacgagagattcgacggccatgagcttgatc 2247 Query: 241 aggatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatc 300 | ||||||||||||||| || || || |||||||||||||| || ||||| || |||||| Sbjct: 2246 aagatgttgagcgacggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatc 2187 Query: 301 acggcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgca 360 || || |||||||| || ||||| ||||||||||| || | ||| || || || || ||| Sbjct: 2186 accgccgccttgtgagcgtccgaacccttgggaccaagtgcctttgcatggtcggatgca 2127 Query: 361 cccgcctcgatgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatatg 420 || |||||||| || |||||||| ||||||||||||||||| ||||||||||| |||||| Sbjct: 2126 cctgcctcgatatatttcttggcattgtcccaggctcccccactgttggaagcagatatg 2067 Query: 421 gccacctgcacgccggaaacga 442 || ||||||||||||||||||| Sbjct: 2066 gcaacctgcacgccggaaacga 2045
>gb|AY333187.1| Oryza sativa (japonica cultivar-group) H+-pyrophosphatase mRNA, complete cds Length = 2610 Score = 234 bits (118), Expect = 2e-58 Identities = 226/262 (86%) Strand = Plus / Minus Query: 181 cctccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatg 240 |||||||| || || ||||||||||||||||| || || |||||||||||||||||||| Sbjct: 2403 cctccatgggcggcaaagaatggcgcgaagacgagagattcgacggccatgagcttgatc 2344 Query: 241 aggatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatc 300 | ||||||||||||||| || || || |||||||||||||| || ||||| || |||||| Sbjct: 2343 aagatgttgagcgacggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatc 2284 Query: 301 acggcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgca 360 || || |||||||| || ||||| ||||||||||| || | ||| || || || || ||| Sbjct: 2283 accgccgccttgtgagcgtccgaacccttgggaccaagtgcctttgcatggtcggatgca 2224 Query: 361 cccgcctcgatgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatatg 420 || |||||||| || |||||||| ||||||||||||||||| ||||||||||| |||||| Sbjct: 2223 cctgcctcgatatatttcttggcattgtcccaggctcccccactgttggaagcagatatg 2164 Query: 421 gccacctgcacgccggaaacga 442 || ||||||||||||||||||| Sbjct: 2163 gcaacctgcacgccggaaacga 2142
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 234 bits (118), Expect = 2e-58 Identities = 220/254 (86%) Strand = Plus / Plus Query: 184 ccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgagg 243 |||||||| |||||||| || |||||||| || | |||||||||||||||||||| |||| Sbjct: 3275261 ccatgcgcggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgagg 3275320 Query: 244 atgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacg 303 ||||||||||| || || || || |||||||||||||| ||||||||||| |||||||| Sbjct: 3275321 atgttgagcgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcacc 3275380 Query: 304 gcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcaccc 363 || |||||||||||||| ||||||||||| ||||| ||| | || | ||||| ||| || Sbjct: 3275381 gccgccttgtgcgcctcggagcccttgggccccagcgacctcgcctcctccgtcgccccg 3275440 Query: 364 gcctcgatgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggcc 423 ||||||||||||||||||||||||||||| || || |||||||| || ||||| || ||| Sbjct: 3275441 gcctcgatgtacttcttggcgttgtcccacgcgccgccgctgttcgacgccgagatcgcc 3275500 Query: 424 acctgcacgccgga 437 |||||||| ||||| Sbjct: 3275501 acctgcaccccgga 3275514
>dbj|AK109809.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-147-G08, full insert sequence Length = 1486 Score = 234 bits (118), Expect = 2e-58 Identities = 220/254 (86%) Strand = Plus / Plus Query: 184 ccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgagg 243 |||||||| |||||||| || |||||||| || | |||||||||||||||||||| |||| Sbjct: 15 ccatgcgcggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgagg 74 Query: 244 atgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacg 303 ||||||||||| || || || || |||||||||||||| ||||||||||| |||||||| Sbjct: 75 atgttgagcgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcacc 134 Query: 304 gcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcaccc 363 || |||||||||||||| ||||||||||| ||||| ||| | || | ||||| ||| || Sbjct: 135 gccgccttgtgcgcctcggagcccttgggccccagcgacctcgcctcctccgtcgccccg 194 Query: 364 gcctcgatgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggcc 423 ||||||||||||||||||||||||||||| || || |||||||| || ||||| || ||| Sbjct: 195 gcctcgatgtacttcttggcgttgtcccacgcgccgccgctgttcgacgccgagatcgcc 254 Query: 424 acctgcacgccgga 437 |||||||| ||||| Sbjct: 255 acctgcaccccgga 268
>dbj|AK107275.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-126-A04, full insert sequence Length = 2661 Score = 234 bits (118), Expect = 2e-58 Identities = 220/254 (86%) Strand = Plus / Minus Query: 184 ccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgagg 243 |||||||| |||||||| || |||||||| || | |||||||||||||||||||| |||| Sbjct: 2383 ccatgcgcggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgagg 2324 Query: 244 atgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacg 303 ||||||||||| || || || || |||||||||||||| ||||||||||| |||||||| Sbjct: 2323 atgttgagcgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcacc 2264 Query: 304 gcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcaccc 363 || |||||||||||||| ||||||||||| ||||| ||| | || | ||||| ||| || Sbjct: 2263 gccgccttgtgcgcctcggagcccttgggccccagcgacctcgcctcctccgtcgccccg 2204 Query: 364 gcctcgatgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggcc 423 ||||||||||||||||||||||||||||| || || |||||||| || ||||| || ||| Sbjct: 2203 gcctcgatgtacttcttggcgttgtcccacgcgccgccgctgttcgacgccgagatcgcc 2144 Query: 424 acctgcacgccgga 437 |||||||| ||||| Sbjct: 2143 acctgcaccccgga 2130
>gb|AC087425.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0676G05, complete sequence Length = 167317 Score = 234 bits (118), Expect = 2e-58 Identities = 220/254 (86%) Strand = Plus / Plus Query: 184 ccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgagg 243 |||||||| |||||||| || |||||||| || | |||||||||||||||||||| |||| Sbjct: 69085 ccatgcgcggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgagg 69144 Query: 244 atgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacg 303 ||||||||||| || || || || |||||||||||||| ||||||||||| |||||||| Sbjct: 69145 atgttgagcgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcacc 69204 Query: 304 gcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcaccc 363 || |||||||||||||| ||||||||||| ||||| ||| | || | ||||| ||| || Sbjct: 69205 gccgccttgtgcgcctcggagcccttgggccccagcgacctcgcctcctccgtcgccccg 69264 Query: 364 gcctcgatgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggcc 423 ||||||||||||||||||||||||||||| || || |||||||| || ||||| || ||| Sbjct: 69265 gcctcgatgtacttcttggcgttgtcccacgcgccgccgctgttcgacgccgagatcgcc 69324 Query: 424 acctgcacgccgga 437 |||||||| ||||| Sbjct: 69325 acctgcaccccgga 69338
>emb|AJ621242.1| Oryza sativa mRNA for proton translocating pyrophosphatase (VP4 gene) Length = 2289 Score = 202 bits (102), Expect = 7e-49 Identities = 213/250 (85%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 ||||||||||||||||| || || |||||||||||||||||||||||||||||||| ||| Sbjct: 2255 gcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatgaggatgttcagc 2196 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| ||||| |||||||||||||| ||||||||||| |||||||| || |||||| Sbjct: 2195 gacgggcccgacgtgtccttgagcgggtcgccgatggtgtcgccgatcaccgccgccttg 2136 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || ||||| |||||||| ||||| ||| | |||||||| ||| || ||||||||| Sbjct: 2135 tggcagtccgatcccttgggccccagcgacctcgcgtgctcactcgccccagcctcgatg 2076 Query: 373 tacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggccacctgcacg 432 || ||||| ||||||||||| || || ||| |||| || || || ||||| ||||| ||| Sbjct: 2075 tatttctttgcgttgtcccatgcgccaccggtgttcgacgcagagatggcgacctgtacg 2016 Query: 433 ccggaaacga 442 ||||| |||| Sbjct: 2015 ccggagacga 2006
>dbj|AK102146.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086B11, full insert sequence Length = 2699 Score = 194 bits (98), Expect = 2e-46 Identities = 212/250 (84%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 ||||||||||||||||| || || |||||||||||||||||||||||||||||||| ||| Sbjct: 2364 gcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatgaggatgttcagc 2305 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| ||||| |||||||||||||| || |||||||| |||||||| || |||||| Sbjct: 2304 gacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatcaccgccgccttg 2245 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || ||||| |||||||| ||||| ||| | |||||||| ||| || ||||||||| Sbjct: 2244 tggcagtccgatcccttgggccccagcgacctcgcgtgctcactcgccccagcctcgatg 2185 Query: 373 tacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggccacctgcacg 432 || ||||| ||||||||||| || || ||| |||| || || || ||||| ||||| ||| Sbjct: 2184 tatttctttgcgttgtcccatgcgccaccggtgttcgacgcagagatggcgacctgtacg 2125 Query: 433 ccggaaacga 442 ||||| |||| Sbjct: 2124 ccggagacga 2115
>dbj|D13472.2|BLYINOPP Hordeum vulgare mRNA for vacuolar membrane proton-translocating inorganic pyrophosphatase, complete cds Length = 2649 Score = 194 bits (98), Expect = 2e-46 Identities = 212/250 (84%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| |||||||| || |||||||| |||||||||||||||||||||||||||||| Sbjct: 2279 gcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagc 2220 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| || || |||||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 2219 gacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttg 2160 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || || || ||||||||||| |||||| | || ||||| || ||||||||| Sbjct: 2159 tggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgatg 2100 Query: 373 tacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggccacctgcacg 432 |||||||| ||||||||||| || || ||| |||||||||| || ||||| | |||||| Sbjct: 2099 tacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcact 2040 Query: 433 ccggaaacga 442 || ||||||| Sbjct: 2039 ccagaaacga 2030
>dbj|AK064361.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-108-B10, full insert sequence Length = 2009 Score = 186 bits (94), Expect = 4e-44 Identities = 211/250 (84%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 ||||||||||||||||| || || |||||||||||| ||||||||||||||||||| ||| Sbjct: 1658 gcgaagaatggcgcgaacaccagcgactcgacggccgtgagcttgatgaggatgttcagc 1599 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| ||||| |||||||||||||| || |||||||| |||||||| || |||||| Sbjct: 1598 gacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatcaccgccgccttg 1539 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || ||||| |||||||| ||||| ||| | |||||||| ||| || ||||||||| Sbjct: 1538 tggcagtccgatcccttgggccccagcgacctcgcgtgctcactcgccccagcctcgatg 1479 Query: 373 tacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggccacctgcacg 432 || ||||| ||||||||||| || || ||| |||| || || || ||||| ||||| ||| Sbjct: 1478 tatttctttgcgttgtcccatgcgccaccggtgttcgacgcagagatggcgacctgtacg 1419 Query: 433 ccggaaacga 442 ||||| |||| Sbjct: 1418 ccggagacga 1409
>gb|AY255181.1| Hordeum brevisubulatum vacuolar proton-inorganic pyrophosphatase (AVP1) mRNA, complete cds Length = 2777 Score = 180 bits (91), Expect = 3e-42 Identities = 175/203 (86%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || ||||| || ||||||||||| ||||||||||||||||||||||||||| Sbjct: 2326 gcgaagaagggggcgaacacgagggactcgaccgccatgagcttgatgaggatgttgagc 2267 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || ||||| || || |||||||| ||||||||||||||||| |||||||| ||||||||| Sbjct: 2266 gaggggcccgaggtgtccttgagagggtccccgatggtgtcgccgatcactgcggccttg 2207 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || || ||||| || || |||||| ||| || ||||| || ||||| ||||| ||| Sbjct: 2206 tggcagtctgagcctttcgggcccaggctctttgcatgctcagatgcaccagcctcaatg 2147 Query: 373 tacttcttggcgttgtcccaggc 395 ||||||||||||||||||||||| Sbjct: 2146 tacttcttggcgttgtcccaggc 2124
>dbj|AB032839.1| Hordeum vulgare HVP1 mRNA for vacuolar proton-inorganic pyrophosphatase, complete cds Length = 2757 Score = 178 bits (90), Expect = 1e-41 Identities = 195/230 (84%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || ||||| || |||||||| || ||||||||||||||||||||||||||| Sbjct: 2364 gcgaagaagggggcgaacacgagggactcaaccgccatgagcttgatgaggatgttgagc 2305 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || ||||| || || |||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 2304 gaggggcccgaggtgtccttgagagggtccccgatggtgtcaccgatcacggcggccttg 2245 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || || ||||| || || |||||| ||| || ||||| || || || ||||| ||| Sbjct: 2244 tggcagtcagagcctttcgggcccaggctctttgcatgctcagatgcgccagcctcaatg 2185 Query: 373 tacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggc 422 |||||||||||||||||||| || || ||| |||| || ||||| ||||| Sbjct: 2184 tacttcttggcgttgtcccatgcaccaccggtgttcgatgccgaaatggc 2135
>ref|XM_476313.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2304 Score = 174 bits (88), Expect = 2e-40 Identities = 208/248 (83%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct: 2270 gcgaagaaaggcgcaaacacaagggactcgacggccatgagcttgatgaggatgttgagc 2211 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||||||| Sbjct: 2210 gacgggcctgatgtgtccttgagggggtctccaatggtgtcaccgatcacggcggccttg 2151 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || || || ||||||||||| |||| | || ||||| ||||| ||||| ||| Sbjct: 2150 tggcagtctgatcccttgggaccaagggtccgagcatgctcactggcaccagcctcaatg 2091 Query: 373 tacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggccacctgcacg 432 |||||||| ||||| ||||| || || || ||||||| ||||| ||||| | ||| || Sbjct: 2090 tacttctttgcgttatcccatgcgccaccagtgttggaggccgagatggcgatctgaact 2031 Query: 433 ccggaaac 440 |||||||| Sbjct: 2030 ccggaaac 2023
>dbj|AK066933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091F19, full insert sequence Length = 2738 Score = 174 bits (88), Expect = 2e-40 Identities = 208/248 (83%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct: 2379 gcgaagaaaggcgcaaacacaagggactcgacggccatgagcttgatgaggatgttgagc 2320 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||||||| Sbjct: 2319 gacgggcctgatgtgtccttgagggggtctccaatggtgtcaccgatcacggcggccttg 2260 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || || || ||||||||||| |||| | || ||||| ||||| ||||| ||| Sbjct: 2259 tggcagtctgatcccttgggaccaagggtccgagcatgctcactggcaccagcctcaatg 2200 Query: 373 tacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggccacctgcacg 432 |||||||| ||||| ||||| || || || ||||||| ||||| ||||| | ||| || Sbjct: 2199 tacttctttgcgttatcccatgcgccaccagtgttggaggccgagatggcgatctgaact 2140 Query: 433 ccggaaac 440 |||||||| Sbjct: 2139 ccggaaac 2132
>dbj|D45384.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase, complete cds Length = 2710 Score = 174 bits (88), Expect = 2e-40 Identities = 208/248 (83%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct: 2364 gcgaagaaaggcgcaaacacaagggactcgacggccatgagcttgatgaggatgttgagc 2305 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||||||| Sbjct: 2304 gacgggcctgatgtgtccttgagggggtctccaatggtgtcaccgatcacggcggccttg 2245 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || || || ||||||||||| |||| | || ||||| ||||| ||||| ||| Sbjct: 2244 tggcagtctgatcccttgggaccaagggtccgagcatgctcactggcaccagcctcaatg 2185 Query: 373 tacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggccacctgcacg 432 |||||||| ||||| ||||| || || || ||||||| ||||| ||||| | ||| || Sbjct: 2184 tacttctttgcgttatcccatgcgccaccagtgttggaggccgagatggcgatctgaact 2125 Query: 433 ccggaaac 440 |||||||| Sbjct: 2124 ccggaaac 2117
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 170 bits (86), Expect = 2e-39 Identities = 113/122 (92%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct: 3934758 gcgaagaaaggcgcaaacacaagggactcgacggccatgagcttgatgaggatgttgagc 3934699 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||||||| Sbjct: 3934698 gacgggcctgatgtgtccttgagggggtctccaatggtgtcaccgatcacggcggccttg 3934639 Query: 313 tg 314 || Sbjct: 3934638 tg 3934637 Score = 101 bits (51), Expect = 2e-18 Identities = 114/135 (84%) Strand = Plus / Minus Query: 180 gcctccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgat 239 ||||||||| | |||||||| || || || || || |||||||| ||||| |||||||| Sbjct: 25894198 gcctccatgggtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgat 25894139 Query: 240 gaggatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgat 299 ||||||||||||||| ||||| || || |||||||| || ||||| |||||||| ||||| Sbjct: 25894138 gaggatgttgagcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgat 25894079 Query: 300 cacggcggccttgtg 314 ||| || |||||||| Sbjct: 25894078 cacagcagccttgtg 25894064 Score = 46.1 bits (23), Expect = 0.096 Identities = 29/31 (93%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 |||| ||||||||||| |||||||||||||| Sbjct: 25893905 cctcaatgtacttctttgcgttgtcccaggc 25893875
>dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0035I03 Length = 153749 Score = 170 bits (86), Expect = 2e-39 Identities = 113/122 (92%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct: 40634 gcgaagaaaggcgcaaacacaagggactcgacggccatgagcttgatgaggatgttgagc 40575 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||||||| Sbjct: 40574 gacgggcctgatgtgtccttgagggggtctccaatggtgtcaccgatcacggcggccttg 40515 Query: 313 tg 314 || Sbjct: 40514 tg 40513
>dbj|AB012766.1| Oryza sativa gene for ovp2, complete cds Length = 5985 Score = 170 bits (86), Expect = 2e-39 Identities = 113/122 (92%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct: 5638 gcgaagaaaggcgcaaacacaagggactcgacggccatgagcttgatgaggatgttgagc 5579 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||||||| Sbjct: 5578 gacgggcctgatgtgtccttgagggggtctccaatggtgtcaccgatcacggcggccttg 5519 Query: 313 tg 314 || Sbjct: 5518 tg 5517
>gb|AY296911.1| Triticum aestivum vacuolar proton-inorganic pyrophosphatase mRNA, complete cds Length = 2671 Score = 163 bits (82), Expect = 6e-37 Identities = 193/230 (83%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| |||||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 2285 gcgaagaagggcgcgaacacgagggactcgacggccatcagcttgatgaggatgttgagc 2226 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| || || |||||||| ||||| ||||||||||| ||||||||||| |||||| Sbjct: 2225 gacgggcctgaggtgtccttgagggggtctccgatggtgtcgccgatcacggccgccttg 2166 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || || || |||||||| || |||||| | |||||||| || ||||| ||| Sbjct: 2165 tggcagtctgaacccttggggccaagggacctcgcgtgctcgctgttgccggcctcaatg 2106 Query: 373 tacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggc 422 |||||||| ||||||||||| || || ||| |||||||||| || ||||| Sbjct: 2105 tacttctttgcgttgtcccatgcaccgccggtgttggaagcagagatggc 2056
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 161 bits (81), Expect = 2e-36 Identities = 141/161 (87%) Strand = Plus / Plus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 ||||||||||||||||| || || |||||||||||||||||||||||||||||||| ||| Sbjct: 34229268 gcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatgaggatgttcagc 34229327 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| ||||| |||||||||||||| || |||||||| |||||||| || |||||| Sbjct: 34229328 gacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatcaccgccgccttg 34229387 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctc 353 || ||||| |||||||| ||||| ||| | |||||||| Sbjct: 34229388 tggcagtccgatcccttgggccccagcgacctcgcgtgctc 34229428 Score = 115 bits (58), Expect = 1e-22 Identities = 106/122 (86%) Strand = Plus / Plus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || ||||| || ||||| ||||| |||||||||||||||||||||||||| Sbjct: 4694184 gcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttgaga 4694243 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || || || || |||||||| ||||| ||||||||||||||||| ||||| |||||| Sbjct: 4694244 gagggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccgccttg 4694303 Query: 313 tg 314 || Sbjct: 4694304 tg 4694305 Score = 40.1 bits (20), Expect = 5.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 365 cctcgatgtacttcttggcgttgtccca 392 |||||||||| ||||| ||||||||||| Sbjct: 34229533 cctcgatgtatttctttgcgttgtccca 34229560
>dbj|AP007227.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0032L17 Length = 165808 Score = 161 bits (81), Expect = 2e-36 Identities = 141/161 (87%) Strand = Plus / Plus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 ||||||||||||||||| || || |||||||||||||||||||||||||||||||| ||| Sbjct: 156782 gcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatgaggatgttcagc 156841 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| ||||| |||||||||||||| || |||||||| |||||||| || |||||| Sbjct: 156842 gacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatcaccgccgccttg 156901 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctc 353 || ||||| |||||||| ||||| ||| | |||||||| Sbjct: 156902 tggcagtccgatcccttgggccccagcgacctcgcgtgctc 156942 Score = 40.1 bits (20), Expect = 5.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 365 cctcgatgtacttcttggcgttgtccca 392 |||||||||| ||||| ||||||||||| Sbjct: 157047 cctcgatgtatttctttgcgttgtccca 157074
>dbj|AP005056.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0689B12 Length = 154745 Score = 161 bits (81), Expect = 2e-36 Identities = 141/161 (87%) Strand = Plus / Plus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 ||||||||||||||||| || || |||||||||||||||||||||||||||||||| ||| Sbjct: 64541 gcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatgaggatgttcagc 64600 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| ||||| |||||||||||||| || |||||||| |||||||| || |||||| Sbjct: 64601 gacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatcaccgccgccttg 64660 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctc 353 || ||||| |||||||| ||||| ||| | |||||||| Sbjct: 64661 tggcagtccgatcccttgggccccagcgacctcgcgtgctc 64701 Score = 40.1 bits (20), Expect = 5.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 365 cctcgatgtacttcttggcgttgtccca 392 |||||||||| ||||| ||||||||||| Sbjct: 64806 cctcgatgtatttctttgcgttgtccca 64833
>dbj|AB126350.1| Oryza sativa (japonica cultivar-group) OVP3 gene for vacuolar proton pyrophosphatase, complete cds Length = 5548 Score = 161 bits (81), Expect = 2e-36 Identities = 141/161 (87%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 ||||||||||||||||| || || |||||||||||||||||||||||||||||||| ||| Sbjct: 5223 gcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatgaggatgttcagc 5164 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 |||||||| ||||| |||||||||||||| || |||||||| |||||||| || |||||| Sbjct: 5163 gacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatcaccgccgccttg 5104 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctc 353 || ||||| |||||||| ||||| ||| | |||||||| Sbjct: 5103 tggcagtccgatcccttgggccccagcgacctcgcgtgctc 5063 Score = 40.1 bits (20), Expect = 5.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtccca 392 |||||||||| ||||| ||||||||||| Sbjct: 4958 cctcgatgtatttctttgcgttgtccca 4931
>gb|AF367446.1| Prunus persica clone Vp1 vacuolar H+-pyrophosphatase (vp1) mRNA, complete cds Length = 2619 Score = 143 bits (72), Expect = 6e-31 Identities = 192/232 (82%) Strand = Plus / Minus Query: 211 acaagggactcgacggccatgagcttgatgaggatgttgagcgacgggccagacgtatcc 270 ||||||||||| || |||||||||||||||||||||||||| || ||||| || || ||| Sbjct: 2325 acaagggactccactgccatgagcttgatgaggatgttgagtgatgggcctgaggtgtcc 2266 Query: 271 ttgagcgggtccccgatggtgtcaccgatcacggcggccttgtgcgcctccgagcccttg 330 || || |||||||| ||||||||||| ||||| || |||||||| | || || ||||| Sbjct: 2265 ttcagtgggtccccaatggtgtcaccaatcactgctgccttgtgtgggtcagatcccttt 2206 Query: 331 ggacccagggacttggcgtgctccgacgcacccgcctcgatgtacttcttggcgttgtcc 390 || || |||| | | || ||||| || ||||| ||||| ||||||||||| || |||||| Sbjct: 2205 ggcccaagggtccttgcatgctctgaagcaccagcctcaatgtacttcttagcattgtcc 2146 Query: 391 caggctcccccgctgttggaagccgatatggccacctgcacgccggaaacga 442 || || || || |||||||||| ||||| || |||||||| |||||||||| Sbjct: 2145 catgcaccacctgtgttggaagcagatattgctacctgcacaccggaaacga 2094
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 141 bits (71), Expect = 2e-30 Identities = 134/155 (86%) Strand = Plus / Minus Query: 181 cctccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatg 240 |||||||| || || ||||||||||||||||| || || |||||||||||||||||||| Sbjct: 13228745 cctccatgggcggcaaagaatggcgcgaagacgagagattcgacggccatgagcttgatc 13228686 Query: 241 aggatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatc 300 | ||||||||||||||| || || || |||||||||||||| || ||||| || |||||| Sbjct: 13228685 aagatgttgagcgacggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatc 13228626 Query: 301 acggcggccttgtgcgcctccgagcccttgggacc 335 || || |||||||| || ||||| ||||||||||| Sbjct: 13228625 accgccgccttgtgagcgtccgaacccttgggacc 13228591 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggcca 424 ||||||| || |||||||| ||||||||||||||||| ||||||||||| |||||||| | Sbjct: 13228433 cctcgatatatttcttggcattgtcccaggctcccccactgttggaagcagatatggcaa 13228374 Query: 425 cct 427 ||| Sbjct: 13228373 cct 13228371
>dbj|AP003793.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0487E11 Length = 151303 Score = 141 bits (71), Expect = 2e-30 Identities = 134/155 (86%) Strand = Plus / Minus Query: 181 cctccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatg 240 |||||||| || || ||||||||||||||||| || || |||||||||||||||||||| Sbjct: 101046 cctccatgggcggcaaagaatggcgcgaagacgagagattcgacggccatgagcttgatc 100987 Query: 241 aggatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatc 300 | ||||||||||||||| || || || |||||||||||||| || ||||| || |||||| Sbjct: 100986 aagatgttgagcgacggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatc 100927 Query: 301 acggcggccttgtgcgcctccgagcccttgggacc 335 || || |||||||| || ||||| ||||||||||| Sbjct: 100926 accgccgccttgtgagcgtccgaacccttgggacc 100892 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggcca 424 ||||||| || |||||||| ||||||||||||||||| ||||||||||| |||||||| | Sbjct: 100734 cctcgatatatttcttggcattgtcccaggctcccccactgttggaagcagatatggcaa 100675 Query: 425 cct 427 ||| Sbjct: 100674 cct 100672
>gb|AY103622.1| Zea mays PCO084888 mRNA sequence Length = 2801 Score = 141 bits (71), Expect = 2e-30 Identities = 188/227 (82%) Strand = Plus / Minus Query: 214 agggactcgacggccatgagcttgatgaggatgttgagcgacgggccagacgtatccttg 273 |||||||| ||||||||||||||||||||||||||||| |||||||| || || ||||| Sbjct: 2324 agggactccacggccatgagcttgatgaggatgttgagggacgggccggaggtgtccttc 2265 Query: 274 agcgggtccccgatggtgtcaccgatcacggcggccttgtgcgcctccgagcccttggga 333 || ||||| || ||||||||||| ||||| ||||||||||| || || ||||||||| Sbjct: 2264 agggggtcaccaatggtgtcacctatcacagcggccttgtggcagtcggatcccttggga 2205 Query: 334 cccagggacttggcgtgctccgacgcacccgcctcgatgtacttcttggcgttgtcccag 393 || |||| | | |||||||| ||||| ||||| ||||||||||| || |||||||| Sbjct: 2204 ccgagggtcctcgcgtgctcgctggcaccagcctcaatgtacttcttagcattgtcccat 2145 Query: 394 gctcccccgctgttggaagccgatatggccacctgcacgccggaaac 440 || || ||| |||||||||| || ||||| | |||||| || ||||| Sbjct: 2144 gcaccgccggtgttggaagcagagatggcgatctgcactccagaaac 2098
>ref|XM_464356.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2313 Score = 127 bits (64), Expect = 3e-26 Identities = 166/200 (83%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || ||||| || ||||| ||||| |||||||||||||||||||||||||| Sbjct: 2279 gcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttgaga 2220 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || || || || |||||||| ||||| ||||||||||||||||| ||||| |||||| Sbjct: 2219 gagggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccgccttg 2160 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || | || || || |||||||| |||| | |||| ||||| || || || ||||| ||| Sbjct: 2159 tggggatcggaacctttgggaccaagggtcctggcatgctctgaagctccagcctcaatg 2100 Query: 373 tacttcttggcgttgtccca 392 || ||||| || |||||||| Sbjct: 2099 tatttctttgcattgtccca 2080
>emb|AJ715528.1| Zea mays mRNA for vacuolar H+-translocating inorganic pyrophosphatase (vpp1 gene) Length = 2631 Score = 127 bits (64), Expect = 3e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 184 ccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgagg 243 ||||| || |||||||| || |||||||||||||| || || ||||| |||||||||||| Sbjct: 2276 ccatgggcggcgaagaagggggcgaagacaagggattcaaccgccataagcttgatgagg 2217 Query: 244 atgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacg 303 |||||||| || ||||||||||| |||||||| || || || ||||||||||| || || Sbjct: 2216 atgttgagggaagggccagacgtgtccttgagaggatctccaatggtgtcaccaatgaca 2157 Query: 304 gcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcaccc 363 || |||||||| | || || || || || || |||| | |||| ||||| || | || Sbjct: 2156 gccgccttgtgagggtcagaaccttttgggccaagggtcctggcatgctctgaaactcca 2097 Query: 364 gcctcgatgtacttcttggcgttgtcccaggc 395 ||||| |||||||||||||||||||||||||| Sbjct: 2096 gcctcaatgtacttcttggcgttgtcccaggc 2065
>dbj|AK119631.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-E10, full insert sequence Length = 1674 Score = 127 bits (64), Expect = 3e-26 Identities = 178/216 (82%) Strand = Plus / Minus Query: 180 gcctccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgat 239 ||||||||| | |||||||| || || || || || |||||||| ||||| |||||||| Sbjct: 1310 gcctccatgggtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgat 1251 Query: 240 gaggatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgat 299 ||||||||||||||| ||||| || || |||||||| || ||||| |||||||| ||||| Sbjct: 1250 gaggatgttgagcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgat 1191 Query: 300 cacggcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgc 359 ||| || |||||||| || ||||| || || ||||||| | | || ||||| || || Sbjct: 1190 cacagcagccttgtggcagtctgagcctttcgggcccagggtccttgcatgctcagatgc 1131 Query: 360 acccgcctcgatgtacttcttggcgttgtcccaggc 395 ||| ||||| ||||||||||| |||||||||||||| Sbjct: 1130 accagcctcaatgtacttctttgcgttgtcccaggc 1095
>dbj|AK099807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H04, full insert sequence Length = 3197 Score = 127 bits (64), Expect = 3e-26 Identities = 178/216 (82%) Strand = Plus / Minus Query: 180 gcctccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgat 239 ||||||||| | |||||||| || || || || || |||||||| ||||| |||||||| Sbjct: 2383 gcctccatgggtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgat 2324 Query: 240 gaggatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgat 299 ||||||||||||||| ||||| || || |||||||| || ||||| |||||||| ||||| Sbjct: 2323 gaggatgttgagcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgat 2264 Query: 300 cacggcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgc 359 ||| || |||||||| || ||||| || || ||||||| | | || ||||| || || Sbjct: 2263 cacagcagccttgtggcagtctgagcctttcgggcccagggtccttgcatgctcagatgc 2204 Query: 360 acccgcctcgatgtacttcttggcgttgtcccaggc 395 ||| ||||| ||||||||||| |||||||||||||| Sbjct: 2203 accagcctcaatgtacttctttgcgttgtcccaggc 2168
>dbj|D45383.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase, complete cds Length = 2742 Score = 127 bits (64), Expect = 3e-26 Identities = 178/216 (82%) Strand = Plus / Minus Query: 180 gcctccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgat 239 ||||||||| | |||||||| || || || || || |||||||| ||||| |||||||| Sbjct: 2359 gcctccatgggtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgat 2300 Query: 240 gaggatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgat 299 ||||||||||||||| ||||| || || |||||||| || ||||| |||||||| ||||| Sbjct: 2299 gaggatgttgagcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgat 2240 Query: 300 cacggcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgc 359 ||| || |||||||| || ||||| || || ||||||| | | || ||||| || || Sbjct: 2239 cacagcagccttgtggcagtctgagcctttcgggcccagggtccttgcatgctcagatgc 2180 Query: 360 acccgcctcgatgtacttcttggcgttgtcccaggc 395 ||| ||||| ||||||||||| |||||||||||||| Sbjct: 2179 accagcctcaatgtacttctttgcgttgtcccaggc 2144
>gb|BT018996.1| Zea mays clone Contig484.F mRNA sequence Length = 1100 Score = 119 bits (60), Expect = 8e-24 Identities = 174/212 (82%) Strand = Plus / Minus Query: 184 ccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgagg 243 ||||| || |||||||| || |||||||||||||| || || ||||| ||||||||||| Sbjct: 588 ccatgggcggcgaagaagggggcgaagacaagggattcaaccgccataagcttgatgaga 529 Query: 244 atgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacg 303 |||||||| || ||||||||||| |||||||| || || || || |||||||| || || Sbjct: 528 atgttgagggaggggccagacgtgtccttgagaggatctccaatagtgtcaccaatgaca 469 Query: 304 gcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcaccc 363 || |||||||| | || || || || || || |||| | |||| ||||| || || || Sbjct: 468 gccgccttgtgagggtcagaaccttttgggccaagggtcctggcatgctctgaagctcca 409 Query: 364 gcctcgatgtacttcttggcgttgtcccaggc 395 ||||| |||||||||||||||||||||||||| Sbjct: 408 gcctcaatgtacttcttggcgttgtcccaggc 377
>gb|L32792.1|BEUPYROA Beta vulgaris clone P1 pyrophosphatase mRNA, complete cds Length = 2801 Score = 119 bits (60), Expect = 8e-24 Identities = 165/200 (82%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || ||||| || || |||||||| ||||| |||||||| || |||||||| Sbjct: 2321 gcgaagaagggggcgaacactagtgactcgacagccataagcttgattagaatgttgagt 2262 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || || || || ||||| || ||||| |||||||||||||||||||| || |||||| Sbjct: 2261 gatggtcctgatgtgtccttaagtgggtcaccgatggtgtcaccgatcacagctgccttg 2202 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || || || || ||||||||||| || | | | || ||||| || ||||| ||||| ||| Sbjct: 2201 tgtgcatctgatcccttgggaccaagtgtccttgcatgctctgaagcaccagcctcaatg 2142 Query: 373 tacttcttggcgttgtccca 392 ||||||||||| |||||||| Sbjct: 2141 tacttcttggcattgtccca 2122
>emb|AJ557256.2|VVI557256 Vitis vinifera mRNA for vacuolar pyrophosphatase (vpp2 gene) Length = 2664 Score = 117 bits (59), Expect = 3e-23 Identities = 176/215 (81%) Strand = Plus / Minus Query: 208 aagacaagggactcgacggccatgagcttgatgaggatgttgagcgacgggccagacgta 267 |||||||| || || || ||||| |||||||||||||||||||| ||||||||||| || Sbjct: 2243 aagacaagagattcaactgccattagcttgatgaggatgttgagagacgggccagaagtg 2184 Query: 268 tccttgagcgggtccccgatggtgtcaccgatcacggcggccttgtgcgcctccgagccc 327 |||||||| |||||||| || |||||||| ||||| || |||||||| | ||||| || Sbjct: 2183 tccttgagagggtccccaattgtgtcaccaatcacagctgccttgtgtgggtccgatcct 2124 Query: 328 ttgggacccagggacttggcgtgctccgacgcacccgcctcgatgtacttcttggcgttg 387 || ||||| |||| ||| || ||||| || || || ||||| || ||||||||||| || Sbjct: 2123 tttggaccgagggcctttgcatgctctgaagccccagcctcaatatacttcttggcatta 2064 Query: 388 tcccaggctcccccgctgttggaagccgatatggc 422 ||||| || || || |||||||||| || ||||| Sbjct: 2063 tcccaagcaccaccagtgttggaagcagagatggc 2029
>dbj|AP004066.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1572_F02 Length = 93626 Score = 115 bits (58), Expect = 1e-22 Identities = 106/122 (86%) Strand = Plus / Plus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || ||||| || ||||| ||||| |||||||||||||||||||||||||| Sbjct: 66256 gcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttgaga 66315 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || || || || |||||||| ||||| ||||||||||||||||| ||||| |||||| Sbjct: 66316 gagggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccgccttg 66375 Query: 313 tg 314 || Sbjct: 66376 tg 66377
>dbj|AB126351.1| Oryza sativa (japonica cultivar-group) OVP5 gene for vacuolar proton pyrophosphatase, complete cds Length = 5595 Score = 115 bits (58), Expect = 1e-22 Identities = 106/122 (86%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || ||||| || ||||| ||||| |||||||||||||||||||||||||| Sbjct: 5245 gcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttgaga 5186 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || || || || |||||||| ||||| ||||||||||||||||| ||||| |||||| Sbjct: 5185 gagggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccgccttg 5126 Query: 313 tg 314 || Sbjct: 5125 tg 5124
>gb|AF257777.1|AF257777 Vitis vinifera H+-pyrophosphatase mRNA, complete cds Length = 2745 Score = 113 bits (57), Expect = 5e-22 Identities = 117/137 (85%) Strand = Plus / Minus Query: 178 aggcctccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttg 237 ||||| ||||| || |||||||| || |||||||| | ||||||||| |||||||||||| Sbjct: 2510 aggccgccatgagctgcgaagaacggagcgaagaccaaggactcgaccgccatgagcttg 2451 Query: 238 atgaggatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccg 297 || ||||||||||| || |||||||| || |||||||| || || ||||| |||||||| Sbjct: 2450 atcaggatgttgagtgaagggccagaggtgtccttgaggggatcgccgattgtgtcacct 2391 Query: 298 atcacggcggccttgtg 314 ||||| || |||||||| Sbjct: 2390 atcacagctgccttgtg 2374
>emb|AJ304836.1|CRE304836 Chlamydomonas reinhardtii mRNA for proton-translocating inorganic pyrophosphatase (vppa gene) Length = 2381 Score = 111 bits (56), Expect = 2e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 195 gaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagcga 254 |||||| |||||||| || || ||||| ||||||||||||||||| |||||||||||||| Sbjct: 2277 gaagaagggcgcgaacaccagcgactccacggccatgagcttgatcaggatgttgagcga 2218 Query: 255 cgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttgtg 314 ||||| || |||||||||||||| || | |||||| |||||||||||||||||||| Sbjct: 2217 ggggccgttggtgtccttgagcgggtcgcccacggtgtcgccgatcacggcggccttgtg 2158 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 364 gcctcgatgtacttcttggcgttgtcccaggctcccccgctgttgga 410 |||||||||||||| || |||||||||||||| || ||| ||||||| Sbjct: 2108 gcctcgatgtacttttttgcgttgtcccaggcgccgccggtgttgga 2062
>emb|AJ715529.1| Zea mays vpp1 gene for vacuolar H+-translocating inorganic pyrophosphatase, exons 1-8 Length = 9177 Score = 109 bits (55), Expect = 8e-21 Identities = 112/131 (85%) Strand = Plus / Minus Query: 184 ccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgagg 243 ||||| || |||||||| || |||||||||||||| || || ||||| |||||||||||| Sbjct: 8750 ccatgggcggcgaagaagggggcgaagacaagggattcaaccgccataagcttgatgagg 8691 Query: 244 atgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacg 303 |||||||| || ||||||||||| |||||||| || || || ||||||||||| || || Sbjct: 8690 atgttgagggaagggccagacgtgtccttgagaggatctccaatggtgtcaccaatgaca 8631 Query: 304 gcggccttgtg 314 || |||||||| Sbjct: 8630 gccgccttgtg 8620 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 |||| |||||||||||||||||||||||||| Sbjct: 8443 cctcaatgtacttcttggcgttgtcccaggc 8413
>dbj|AB097115.1| Pyrus communis PVP3 mRNA for vacuolar proton-inorganic pyrophosphatase, complete cds Length = 2625 Score = 103 bits (52), Expect = 5e-19 Identities = 163/200 (81%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || || || || |||||||| |||||||||||||| || ||||||||||| Sbjct: 2334 gcgaagaagggagcaaacacgagggactccacggccatgagcttaataaggatgttgagt 2275 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || || || || |||||||||||||| || ||||||||||| ||||| || |||||| Sbjct: 2274 gatggccctgaggtgtccttgagcgggtctccaatggtgtcaccaatcactgctgccttg 2215 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || | || || ||||| || || |||| | | || ||||| || ||||| ||||| ||| Sbjct: 2214 tgtgggtctgaacccttcgggccgagggtccttgcatgctctgaagcaccggcctcaatg 2155 Query: 373 tacttcttggcgttgtccca 392 |||||||| || |||||||| Sbjct: 2154 tacttcttagcattgtccca 2135
>ref|NM_101437.2| Arabidopsis thaliana AVP1; ATPase AT1G15690 (AVP1) mRNA, complete cds Length = 3207 Score = 101 bits (51), Expect = 2e-18 Identities = 165/203 (81%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||| | Sbjct: 2404 gcgaagaagggagcaaagacaagagactcaacagccatgagcttgatgaggatgttcaat 2345 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || || || |||||||| | ||||| || || ||||| || ||||| || |||||| Sbjct: 2344 gaaggtcctgaagtatccttcaatgggtctccaattgtgtctccaatcacagctgccttg 2285 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || | ||| || ||||| || || ||| ||| |||||||| || |||| ||||||||| Sbjct: 2284 tgtggctctgaaccctttggtccaaggctctttgcgtgctctgatacaccagcctcgatg 2225 Query: 373 tacttcttggcgttgtcccaggc 395 || |||||||||||||||||||| Sbjct: 2224 tatttcttggcgttgtcccaggc 2202
>gb|AY078953.1| Arabidopsis thaliana At1g15690/F7H2_3 mRNA, complete cds Length = 2669 Score = 101 bits (51), Expect = 2e-18 Identities = 165/203 (81%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||| | Sbjct: 2397 gcgaagaagggagcaaagacaagagactcaacagccatgagcttgatgaggatgttcaat 2338 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || || || |||||||| | ||||| || || ||||| || ||||| || |||||| Sbjct: 2337 gaaggtcctgaagtatccttcaatgggtctccaattgtgtctccaatcacagctgccttg 2278 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || | ||| || ||||| || || ||| ||| |||||||| || |||| ||||||||| Sbjct: 2277 tgtggctctgaaccctttggtccaaggctctttgcgtgctctgatacaccagcctcgatg 2218 Query: 373 tacttcttggcgttgtcccaggc 395 || |||||||||||||||||||| Sbjct: 2217 tatttcttggcgttgtcccaggc 2195
>gb|AY065016.1| Arabidopsis thaliana At1g15690/F7H2_3 mRNA, complete cds Length = 2760 Score = 101 bits (51), Expect = 2e-18 Identities = 165/203 (81%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||| | Sbjct: 2397 gcgaagaagggagcaaagacaagagactcaacagccatgagcttgatgaggatgttcaat 2338 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || || || |||||||| | ||||| || || ||||| || ||||| || |||||| Sbjct: 2337 gaaggtcctgaagtatccttcaatgggtctccaattgtgtctccaatcacagctgccttg 2278 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || | ||| || ||||| || || ||| ||| |||||||| || |||| ||||||||| Sbjct: 2277 tgtggctctgaaccctttggtccaaggctctttgcgtgctctgatacaccagcctcgatg 2218 Query: 373 tacttcttggcgttgtcccaggc 395 || |||||||||||||||||||| Sbjct: 2217 tatttcttggcgttgtcccaggc 2195
>dbj|AK221989.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-60-N09 Length = 717 Score = 101 bits (51), Expect = 2e-18 Identities = 165/203 (81%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||| | Sbjct: 499 gcgaagaagggagcaaagacaagagactcaacagccatgagcttgatgaggatgttcaat 440 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || || || |||||||| | ||||| || || ||||| || ||||| || |||||| Sbjct: 439 gaaggtcctgaagtatccttcaatgggtctccaattgtgtctccaatcacagctgccttg 380 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || | ||| || ||||| || || ||| ||| |||||||| || |||| ||||||||| Sbjct: 379 tgtggctctgaaccctttggtccaaggctctttgcgtgctctgatacaccagcctcgatg 320 Query: 373 tacttcttggcgttgtcccaggc 395 || |||||||||||||||||||| Sbjct: 319 tatttcttggcgttgtcccaggc 297
>gb|BT002481.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 2680 Score = 101 bits (51), Expect = 2e-18 Identities = 165/203 (81%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||| | Sbjct: 2404 gcgaagaagggagcaaagacaagagactcaacagccatgagcttgatgaggatgttcaat 2345 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || || || |||||||| | ||||| || || ||||| || ||||| || |||||| Sbjct: 2344 gaaggtcctgaagtatccttcaatgggtctccaattgtgtctccaatcacagctgccttg 2285 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || | ||| || ||||| || || ||| ||| |||||||| || |||| ||||||||| Sbjct: 2284 tgtggctctgaaccctttggtccaaggctctttgcgtgctctgatacaccagcctcgatg 2225 Query: 373 tacttcttggcgttgtcccaggc 395 || |||||||||||||||||||| Sbjct: 2224 tatttcttggcgttgtcccaggc 2202
>dbj|AP003568.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0017B12 Length = 157424 Score = 101 bits (51), Expect = 2e-18 Identities = 114/135 (84%) Strand = Plus / Minus Query: 180 gcctccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgat 239 ||||||||| | |||||||| || || || || || |||||||| ||||| |||||||| Sbjct: 49296 gcctccatgggtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgat 49237 Query: 240 gaggatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgat 299 ||||||||||||||| ||||| || || |||||||| || ||||| |||||||| ||||| Sbjct: 49236 gaggatgttgagcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgat 49177 Query: 300 cacggcggccttgtg 314 ||| || |||||||| Sbjct: 49176 cacagcagccttgtg 49162 Score = 46.1 bits (23), Expect = 0.096 Identities = 29/31 (93%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 |||| ||||||||||| |||||||||||||| Sbjct: 49003 cctcaatgtacttctttgcgttgtcccaggc 48973
>dbj|AB012765.1| Oryza sativa gene for ovp1, complete cds Length = 6410 Score = 101 bits (51), Expect = 2e-18 Identities = 114/135 (84%) Strand = Plus / Minus Query: 180 gcctccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgat 239 ||||||||| | |||||||| || || || || || |||||||| ||||| |||||||| Sbjct: 6026 gcctccatgggtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgat 5967 Query: 240 gaggatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgat 299 ||||||||||||||| ||||| || || |||||||| || ||||| |||||||| ||||| Sbjct: 5966 gaggatgttgagcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgat 5907 Query: 300 cacggcggccttgtg 314 ||| || |||||||| Sbjct: 5906 cacagcagccttgtg 5892 Score = 46.1 bits (23), Expect = 0.096 Identities = 29/31 (93%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 |||| ||||||||||| |||||||||||||| Sbjct: 5733 cctcaatgtacttctttgcgttgtcccaggc 5703
>gb|M81892.1|ATHAVP3 Arabidopsis thaliana vacuolar H+ - pyrophosphatase (AVP-3) mRNA, complete cds Length = 2813 Score = 101 bits (51), Expect = 2e-18 Identities = 165/203 (81%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||| | Sbjct: 2434 gcgaagaagggagcaaagacaagagactcaacagccatgagcttgatgaggatgttcaat 2375 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || || || |||||||| | ||||| || || ||||| || ||||| || |||||| Sbjct: 2374 gaaggtcctgaagtatccttcaatgggtctccaattgtgtctccaatcacagctgccttg 2315 Query: 313 tgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatg 372 || | ||| || ||||| || || ||| ||| |||||||| || |||| ||||||||| Sbjct: 2314 tgtggctctgaaccctttggtccaaggctctttgcgtgctctgatacaccagcctcgatg 2255 Query: 373 tacttcttggcgttgtcccaggc 395 || |||||||||||||||||||| Sbjct: 2254 tatttcttggcgttgtcccaggc 2232
>gb|BT018410.1| Zea mays clone EL01N0326G05.d mRNA sequence Length = 1446 Score = 99.6 bits (50), Expect = 7e-18 Identities = 173/213 (81%), Gaps = 1/213 (0%) Strand = Plus / Minus Query: 184 ccatgcgccgcgaagaatggcgcgaagaca-agggactcgacggccatgagcttgatgag 242 ||||| || |||||||| || ||||||||| ||||| || || ||||| ||||||||||| Sbjct: 944 ccatgggcggcgaagaagggggcgaagacagagggattcaaccgccataagcttgatgag 885 Query: 243 gatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcac 302 |||||||| || ||||||||||| |||||||| || || || || |||||||| || || Sbjct: 884 aatgttgagggaggggccagacgtgtccttgagaggatctccaatagtgtcaccaatgac 825 Query: 303 ggcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgcacc 362 || |||||||| | || || || || || || |||| | |||| ||||| || || || Sbjct: 824 agccgccttgtgagggtcagaaccttttgggccaagggtcctggcatgctctgaagctcc 765 Query: 363 cgcctcgatgtacttcttggcgttgtcccaggc 395 ||||| |||||||||||||||||||| ||||| Sbjct: 764 agcctcaatgtacttcttggcgttgtcncaggc 732
>gb|AF367447.1| Prunus persica clone Vp2 vacuolar H+-pyrophosphatase (vp2) mRNA, complete cds Length = 2646 Score = 97.6 bits (49), Expect = 3e-17 Identities = 208/261 (79%) Strand = Plus / Minus Query: 180 gcctccatgcgccgcgaagaatggcgcgaagacaagggactcgacggccatgagcttgat 239 ||||||||| || || |||||||| || || || | |||||| || |||||||||||||| Sbjct: 2376 gcctccatgagctgcaaagaatggagcaaacaccaaggactcaactgccatgagcttgat 2317 Query: 240 gaggatgttgagcgacgggccagacgtatccttgagcgggtccccgatggtgtcaccgat 299 || |||||||| || || ||||| || |||||||| ||||| ||||| ||||| || || Sbjct: 2316 aagaatgttgagtgaaggaccagaagtgtccttgagggggtctccgattgtgtcgcctat 2257 Query: 300 cacggcggccttgtgcgcctccgagcccttgggacccagggacttggcgtgctccgacgc 359 |||||| |||||||| | || || ||||| ||||| || || || || || || || || Sbjct: 2256 cacggccgccttgtgaggatcagaacccttaggacctagtgatttagcatgttcagaagc 2197 Query: 360 acccgcctcgatgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatat 419 ||| ||||| ||||| ||||| || || ||||| || || ||| |||| ||||| || || Sbjct: 2196 accagcctctatgtatttctttgcattatcccatgcaccaccggtgttcgaagctgaaat 2137 Query: 420 ggccacctgcacgccggaaac 440 ||| | ||||||||| ||||| Sbjct: 2136 ggcaatctgcacgccagaaac 2116
>gb|DQ443731.1| Chenopodium glaucum vacuolar H+-pyrophosphatase (CVP1) mRNA, complete cds Length = 2718 Score = 95.6 bits (48), Expect = 1e-16 Identities = 144/176 (81%) Strand = Plus / Minus Query: 217 gactcgacggccatgagcttgatgaggatgttgagcgacgggccagacgtatccttgagc 276 ||||| || ||||| |||||||| ||||||||||| || || ||||| |||||||| || Sbjct: 2234 gactcaacagccatcagcttgatcaggatgttgagtgatggtccagatgtatccttaaga 2175 Query: 277 gggtccccgatggtgtcaccgatcacggcggccttgtgcgcctccgagcccttgggaccc 336 ||||| || ||||||||||| ||||| || |||||||| || ||||| ||||| || || Sbjct: 2174 gggtcaccaatggtgtcaccaatcacagctgccttgtgtgcatccgatcccttagggcca 2115 Query: 337 agggacttggcgtgctccgacgcacccgcctcgatgtacttcttggcgttgtccca 392 || ||| ||||| || || ||||| ||||| ||||| |||||||| |||||||| Sbjct: 2114 agcgacactgcgtgatcagaagcaccagcctcaatgtatttcttggcattgtccca 2059
>gb|AF533336.1| Chenopodium rubrum vacuolar proton-pumping PPase (CVP1) mRNA, complete cds Length = 2695 Score = 95.6 bits (48), Expect = 1e-16 Identities = 144/176 (81%) Strand = Plus / Minus Query: 217 gactcgacggccatgagcttgatgaggatgttgagcgacgggccagacgtatccttgagc 276 |||||||| ||||| |||||||| || |||||||| ||||| ||||| || ||||| || Sbjct: 2316 gactcgacagccataagcttgatcagaatgttgagtgacggtccagatgtgtccttaaga 2257 Query: 277 gggtccccgatggtgtcaccgatcacggcggccttgtgcgcctccgagcccttgggaccc 336 ||||| || ||||||||||||||||| || |||||||| || || || ||||| || || Sbjct: 2256 gggtcaccaatggtgtcaccgatcacagcagccttgtgtgcatcagatcccttagggccg 2197 Query: 337 agggacttggcgtgctccgacgcacccgcctcgatgtacttcttggcgttgtccca 392 || | | |||||||| || ||||| ||||| ||||| |||||||| |||||||| Sbjct: 2196 agctgccttgcgtgctcagaagcaccagcctcaatgtatttcttggcattgtccca 2141
>dbj|AB018529.1| Chara corallina CPP1 mRNA for vacuolar H+-pyrophosphatase, complete cds Length = 2839 Score = 95.6 bits (48), Expect = 1e-16 Identities = 174/216 (80%) Strand = Plus / Minus Query: 195 gaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagcga 254 |||||| ||||| || |||||||| |||||||||||||||||||| || |||||||| || Sbjct: 2558 gaagaaaggcgcaaacacaagggattcgacggccatgagcttgataagaatgttgagtga 2499 Query: 255 cgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttgtg 314 ||| ||||| || |||||||| || || || | ||||| || || || ||||| ||||| Sbjct: 2498 cggtccagatgtgtccttgagaggatcacccacagtgtccccaatgacagcggctttgtg 2439 Query: 315 cgcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatgta 374 ||||| ||||||||||| || | | | ||||| || |||| ||||||||||| Sbjct: 2438 gcagtccgaccccttgggaccgagcgtcctcgcgtgatcgttgccaccggcctcgatgta 2379 Query: 375 cttcttggcgttgtcccaggctcccccgctgttgga 410 |||||| || |||||||||||||| ||| ||||||| Sbjct: 2378 cttctttgcattgtcccaggctccaccggtgttgga 2343
>dbj|AK110424.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-A10, full insert sequence Length = 2654 Score = 91.7 bits (46), Expect = 2e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 225 ggccatgagcttgatgaggatgttgagcgacgggccagacgtatccttgagcgggtcccc 284 ||||||||| |||||||| ||||||||||||||||||||||| ||||| |||||||| || Sbjct: 2229 ggccatgagtttgatgagaatgttgagcgacgggccagacgtgtccttcagcgggtcacc 2170 Query: 285 gatggtgtcaccga 298 || |||||||||| Sbjct: 2169 gaccgtgtcaccga 2156
>gb|AY436553.2| Thellungiella salsuginea pyrophosphate-energized vacuolar membrane proton pump (vp1) mRNA, complete cds Length = 2759 Score = 87.7 bits (44), Expect = 3e-14 Identities = 152/188 (80%) Strand = Plus / Minus Query: 208 aagacaagggactcgacggccatgagcttgatgaggatgttgagcgacgggccagacgta 267 |||||||| ||||| || |||||||||||||| |||||||| | ||| || || || ||| Sbjct: 2366 aagacaagagactcaacagccatgagcttgatcaggatgttcaacgaaggtcctgaagta 2307 Query: 268 tccttgagcgggtccccgatggtgtcaccgatcacggcggccttgtgcgcctccgagccc 327 ||||| | ||||| || |||||||| || || || || |||||||| | ||| || ||| Sbjct: 2306 tccttcaatgggtctccaatggtgtctccaataacagctgccttgtgtggctcggaaccc 2247 Query: 328 ttgggacccagggacttggcgtgctccgacgcacccgcctcgatgtacttcttggcgttg 387 || || || ||| ||| |||||||| || |||||||||| ||||| |||||||| ||| Sbjct: 2246 tttggcccaaggctctttgcgtgctctgatacacccgcctcaatgtatttcttggcattg 2187 Query: 388 tcccaggc 395 |||||||| Sbjct: 2186 tcccaggc 2179
>gb|AF533337.1| Chenopodium rubrum vacuolar proton-pumping PPase (CVP1) precursor RNA, intron and complete cds Length = 2898 Score = 83.8 bits (42), Expect = 4e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 217 gactcgacggccatgagcttgatgaggatgttgagcgacgggccagacgtatccttgagc 276 |||||||| ||||| |||||||| || |||||||| ||||| ||||| || ||||| || Sbjct: 2519 gactcgacagccataagcttgatcagaatgttgagtgacggtccagatgtgtccttaaga 2460 Query: 277 gggtccccgatggtgtcaccgatcacggcggccttgtg 314 ||||| || ||||||||||||||||| || |||||||| Sbjct: 2459 gggtcaccaatggtgtcaccgatcacagcagccttgtg 2422
>emb|X83730.1|NTIPTVP9 N.tabacum mRNA for inorganic pyrophosphatase (TVP9 clone) Length = 2551 Score = 81.8 bits (41), Expect = 2e-12 Identities = 140/173 (80%) Strand = Plus / Minus Query: 220 tcgacggccatgagcttgatgaggatgttgagcgacgggccagacgtatccttgagcggg 279 ||||| ||||| |||||||| || |||||||| || ||||| || || ||||| || ||| Sbjct: 2255 tcgactgccatcagcttgatcagaatgttgagtgatgggcctgaagtgtccttcagaggg 2196 Query: 280 tccccgatggtgtcaccgatcacggcggccttgtgcgcctccgagcccttgggacccagg 339 || || ||||||||||| || || || |||||||| | || || ||||| ||||| ||| Sbjct: 2195 tcgccaatggtgtcaccaataacagctgccttgtgtgggtctgaaccctttggaccaagg 2136 Query: 340 gacttggcgtgctccgacgcacccgcctcgatgtacttcttggcgttgtccca 392 | | | || |||||||| ||||| ||||| || ||||||||||| |||||||| Sbjct: 2135 gtccttgcatgctccgaagcaccagcctcaatatacttcttggcattgtccca 2083
>dbj|D86306.1| Cucurbita moschata mRNA for proton-translocating inorganic pyrophosphatase, complete cds Length = 2704 Score = 75.8 bits (38), Expect = 1e-10 Identities = 182/230 (79%) Strand = Plus / Minus Query: 211 acaagggactcgacggccatgagcttgatgaggatgttgagcgacgggccagacgtatcc 270 |||||||||||||| ||||| | |||||| || ||||| | || || || || ||||| Sbjct: 2359 acaagggactcgacagccatcaacttgatcagaatgttcaaagatggtccggatgtatct 2300 Query: 271 ttgagcgggtccccgatggtgtcaccgatcacggcggccttgtgcgcctccgagcccttg 330 || |||||||| ||||| ||||||||||| || ||||| ||||||| || || || || Sbjct: 2299 ttcagcgggtctccgatcgtgtcaccgataacagcggctttgtgcgggtctgaacctttc 2240 Query: 331 ggacccagggacttggcgtgctccgacgcacccgcctcgatgtacttcttggcgttgtcc 390 || || |||| | ||||||| || ||||| ||||||||||||||||| ||||| ||| Sbjct: 2239 gggccaagggttcttgcgtgcttagaggcaccagcctcgatgtacttcttagcgttatcc 2180 Query: 391 caggctcccccgctgttggaagccgatatggccacctgcacgccggaaac 440 ||||| || ||| |||| || || || ||||| | |||||| || ||||| Sbjct: 2179 caggcacctccggtgttagatgcagaaatggcaatctgcacaccagaaac 2130
>emb|X83729.1|NTIPTVP31 N.tabacum mRNA for inorganic pyrophosphatase (TVP31 clone) Length = 2867 Score = 73.8 bits (37), Expect = 4e-10 Identities = 112/137 (81%) Strand = Plus / Minus Query: 196 aagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagcgac 255 ||||| || ||||| || ||||| ||||| ||||| ||||||||||| ||||| || || Sbjct: 2618 aagaagggagcgaacaccagggattcgacagccatcagcttgatgagaatgttcagtgat 2559 Query: 256 gggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttgtgc 315 || ||||| ||||||||||| ||||| || | |||||||| ||||| || |||||||| Sbjct: 2558 ggtccagatgtatccttgagagggtcaccaacagtgtcaccaatcacagcagccttgtgt 2499 Query: 316 gcctccgagcccttggg 332 || || || |||||||| Sbjct: 2498 gcgtcagatcccttggg 2482
>ref|XM_808367.1| Trypanosoma cruzi strain CL Brener vacuolar-type proton translocating pyrophosphatase 1 (Tc00.1047053510773.20) partial mRNA Length = 2445 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 370 atgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggccacctgc 429 ||||||||||| ||||||||||| || || ||| ||||||| || || |||||||||||| Sbjct: 2234 atgtacttcttcgcgttgtcccacgccccgccggtgttggaggcggagatggccacctgc 2175 Query: 430 acgccgga 437 |||||||| Sbjct: 2174 acgccgga 2167
>ref|XM_809775.1| Trypanosoma cruzi strain CL Brener vacuolar-type proton translocating pyrophosphatase 1 (Tc00.1047053511385.30) partial mRNA Length = 2445 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 370 atgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggccacctgc 429 ||||||||||| ||||||||||| || || ||| ||||||| || || |||||||||||| Sbjct: 2234 atgtacttcttcgcgttgtcccacgccccgccggtgttggaggcggagatggccacctgc 2175 Query: 430 acgccgga 437 |||||||| Sbjct: 2174 acgccgga 2167
>gb|AF159881.1|AF159881 Trypanosoma cruzi vacuolar-type proton translocating pyrophosphatase 1 (PPase1) gene, complete cds Length = 3669 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 370 atgtacttcttggcgttgtcccaggctcccccgctgttggaagccgatatggccacctgc 429 ||||||||||| ||||||||||| || || ||| ||||||| || || |||||||||||| Sbjct: 2805 atgtacttcttcgcgttgtcccacgccccgccggtgttggaggcggagatggccacctgc 2746 Query: 430 acgccgga 437 |||||||| Sbjct: 2745 acgccgga 2738
>gb|U31467.1|VRU31467 Vigna radiata pyrophosphatase mRNA, complete cds Length = 2522 Score = 71.9 bits (36), Expect = 2e-09 Identities = 87/104 (83%) Strand = Plus / Minus Query: 211 acaagggactcgacggccatgagcttgatgaggatgttgagcgacgggccagacgtatcc 270 ||||| ||||| || ||||| |||||||| |||||||| || || || ||||| |||||| Sbjct: 2269 acaagagactcaactgccatcagcttgataaggatgttaagtgagggaccagatgtatcc 2210 Query: 271 ttgagcgggtccccgatggtgtcaccgatcacggcggccttgtg 314 ||||| ||||| || ||||||||||| || || || |||||||| Sbjct: 2209 ttgagagggtctccaatggtgtcaccaataactgctgccttgtg 2166
>dbj|AP006375.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT32M04, TM0219, complete sequence Length = 72880 Score = 71.9 bits (36), Expect = 2e-09 Identities = 87/104 (83%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || ||||| || || ||||| || ||||| ||||||||||||||||| || Sbjct: 42907 gcgaagaagggtgcgaacacgagagactcaacagccattagcttgatgaggatgttaagt 42848 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcacc 296 || || ||||| |||||||| || ||||| || ||||||||||| Sbjct: 42847 gagggaccagatgtatccttaagagggtctccaatggtgtcacc 42804
>emb|AJ243978.1|TCR243978 Trypanosoma cruzi partial ppa gene for putative proton-translocating inorganic pyrophosphatase Length = 552 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Minus Query: 382 gcgttgtcccaggctcccccgctgttggaagccgatatggccacctgcacgccgga 437 |||||||||||||| || ||| ||||||| ||||| |||||||||||||||||||| Sbjct: 551 gcgttgtcccaggcgccgccgttgttggaggccgagatggccacctgcacgccgga 496
>dbj|AB009077.1| Vigna radiata mRNA for proton pyrophosphatase, complete cds Length = 2531 Score = 71.9 bits (36), Expect = 2e-09 Identities = 87/104 (83%) Strand = Plus / Minus Query: 211 acaagggactcgacggccatgagcttgatgaggatgttgagcgacgggccagacgtatcc 270 ||||| ||||| || ||||| |||||||| |||||||| || || || ||||| |||||| Sbjct: 2262 acaagagactcaactgccatcagcttgataaggatgttaagtgagggaccagatgtatcc 2203 Query: 271 ttgagcgggtccccgatggtgtcaccgatcacggcggccttgtg 314 ||||| ||||| || ||||||||||| || || || |||||||| Sbjct: 2202 ttgagagggtctccaatggtgtcaccaataactgctgccttgtg 2159
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome Length = 3551823 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 227 ccatgagcttgatgaggatgttgagcgacgggccagacgtatccttgagcgggtccccga 286 |||| ||||||||||||| ||||||||| || || | ||| ||||| |||||||| || | Sbjct: 1035895 ccatcagcttgatgaggacgttgagcgagggccctgccgtgtccttcagcgggtcgccca 1035836 Query: 287 tggtgtcaccgatcacggcggccttgtgcgcctc 320 |||||| || | ||||| ||||||||||||||| Sbjct: 1035835 cggtgtcgcccaccacggaggccttgtgcgcctc 1035802 Score = 65.9 bits (33), Expect = 1e-07 Identities = 36/37 (97%) Strand = Plus / Minus Query: 366 ctcgatgtacttcttggcgttgtcccaggctcccccg 402 |||||||||||||||||||||||||||||| |||||| Sbjct: 1035774 ctcgatgtacttcttggcgttgtcccaggcgcccccg 1035738
>gb|AY514019.1| Hevea brasiliensis PPase mRNA, complete cds Length = 2807 Score = 65.9 bits (33), Expect = 1e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 226 gccatgagcttgatgaggatgttgagcgacgggccagacgtatccttgagcgggtccccg 285 ||||| ||||||||||| |||||||| || ||||| || || ||||| || ||||| ||| Sbjct: 2350 gccataagcttgatgagaatgttgagtgatgggcctgaagtgtccttaagtgggtcaccg 2291 Query: 286 atggtgtcaccgatcac 302 ||||||||||| ||||| Sbjct: 2290 atggtgtcaccaatcac 2274
>gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome Length = 3544738 Score = 63.9 bits (32), Expect = 4e-07 Identities = 35/36 (97%) Strand = Plus / Minus Query: 367 tcgatgtacttcttggcgttgtcccaggctcccccg 402 |||||||||||||||| ||||||||||||||||||| Sbjct: 2663470 tcgatgtacttcttggtgttgtcccaggctcccccg 2663435
>gb|AC034256.3|F7H2 Sequence of BAC F7H2 from Arabidopsis thaliana chromosome 1, complete sequence Length = 77521 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgtt 248 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||| Sbjct: 14724 gcgaagaagggagcaaagacaagagactcaacagccatgagcttgatgaggatgtt 14669 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 |||||||||| |||||||||||||||||||| Sbjct: 14471 cctcgatgtatttcttggcgttgtcccaggc 14441
>dbj|AB015138.1| Arabidopsis thaliana AVP3 gene for Vacuolar proton pyrophosphatase, complete cds Length = 4648 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgtt 248 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||| Sbjct: 4451 gcgaagaagggagcaaagacaagagactcaacagccatgagcttgatgaggatgtt 4396 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggctcc 398 |||||||||| ||||||||||||||||||||||| Sbjct: 4198 cctcgatgtatttcttggcgttgtcccaggctcc 4165
>gb|M61742.1|ATHPATPC A.thaliana chloroplast ATP synthase gamma subunit (atpC2) gene, complete cds Length = 4418 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgtt 248 |||||||| || || |||||||| ||||| || ||||||||||||||||||||||| Sbjct: 3680 gcgaagaagggagcaaagacaagagactcaacagccatgagcttgatgaggatgtt 3735 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 365 cctcgatgtacttcttggcgttgtcccaggctcc 398 |||||||||| ||||||||||||||||||||||| Sbjct: 3933 cctcgatgtatttcttggcgttgtcccaggctcc 3966
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 61.9 bits (31), Expect = 2e-06 Identities = 31/31 (100%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 ||||||||||||||||||||||||||||||| Sbjct: 2992669 cctcgatgtacttcttggcgttgtcccaggc 2992639
>emb|BX572601.1| Rhodopseudomonas palustris CGA009 complete genome; segment 9/16 Length = 348580 Score = 61.9 bits (31), Expect = 2e-06 Identities = 31/31 (100%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 ||||||||||||||||||||||||||||||| Sbjct: 310640 cctcgatgtacttcttggcgttgtcccaggc 310610 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 283 ccgatggtgtcaccgatcacggcggccttgtgcgcctccgagcccttg 330 |||| |||||| ||| |||| ||||||||||| || || ||||||||| Sbjct: 310704 ccgacggtgtcgccggtcaccgcggccttgtgggcgtcggagcccttg 310657
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 61.9 bits (31), Expect = 2e-06 Identities = 31/31 (100%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 ||||||||||||||||||||||||||||||| Sbjct: 3022798 cctcgatgtacttcttggcgttgtcccaggc 3022768 Score = 44.1 bits (22), Expect = 0.38 Identities = 46/54 (85%) Strand = Plus / Minus Query: 277 gggtccccgatggtgtcaccgatcacggcggccttgtgcgcctccgagcccttg 330 ||||| |||| |||||| ||| |||| ||||||||||| || || ||||||||| Sbjct: 3022868 gggtcgccgacggtgtcgccggtcaccgcggccttgtgggcgtcggagcccttg 3022815
>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome Length = 2909809 Score = 61.9 bits (31), Expect = 2e-06 Identities = 31/31 (100%) Strand = Plus / Plus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 ||||||||||||||||||||||||||||||| Sbjct: 1589969 cctcgatgtacttcttggcgttgtcccaggc 1589999
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 61.9 bits (31), Expect = 2e-06 Identities = 31/31 (100%) Strand = Plus / Plus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 ||||||||||||||||||||||||||||||| Sbjct: 5571967 cctcgatgtacttcttggcgttgtcccaggc 5571997
>emb|AJ278019.1|LES278019 Lycopersicon esculentum partial mRNA for vacuolar-type H+-pyrophosphatase (vp1.1 gene) Length = 1335 Score = 60.0 bits (30), Expect = 6e-06 Identities = 144/182 (79%) Strand = Plus / Minus Query: 214 agggactcgacggccatgagcttgatgaggatgttgagcgacgggccagacgtatccttg 273 ||||||||||| ||||| |||||||| || ||||| | || || ||||| || |||||| Sbjct: 1016 agggactcgacagccatcagcttgataagaatgttcaatgatggtccagatgtgtccttg 957 Query: 274 agcgggtccccgatggtgtcaccgatcacggcggccttgtgcgcctccgagcccttggga 333 || ||||| || | |||||||| || || || || ||||| || || || |||||||| Sbjct: 956 agagggtcaccaacagtgtcaccaattacagcagctttgtgtgcatcagatcccttgggg 897 Query: 334 cccagggacttggcgtgctccgacgcacccgcctcgatgtacttcttggcgttgtcccag 393 || || | | | || || || || || || ||||||||||||||||| |||||||||||| Sbjct: 896 ccaagagtcctagcatgttctgaggctccagcctcgatgtacttcttagcgttgtcccag 837 Query: 394 gc 395 || Sbjct: 836 gc 835
>emb|AJ872270.1| Thermotoga sp. RQ7 16S rRNA gene, 23S rRNA gene, 5S rRNA gene, folC gene, deoB gene, leuS gene, ORF4, ORF5, ORF6, ahcY gene, topG gene, hppa gene, acp gene, ORF11, ORF12, priA gene, ORF13, ORF14, ORF15, ORF16, ORF17, mrsA gene, ORF19, rrp2 gene, fsr gene, ORF22, fbpA gene, fepD gene, ORF26, ORF27, ORF28 (partial), tRNA-Ala gene, tRNA-Arg gene, tRNA-His gene, tRNA-Arg gene, tRNA-Gly gene, group I intron, IGS, ITS1 and ITS2, strain RQ7 Length = 36963 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 361 cccgcctcgatgtacttcttggcgttgtcccaggctcc 398 |||||||||| | ||||||||||||||||||||||||| Sbjct: 12859 cccgcctcgaggaacttcttggcgttgtcccaggctcc 12822
>emb|AJ872267.1| Thermotoga neapolitana 16S rRNA gene, 23S rRNA gene, 5S rRNA gene, ORF1, ORF2, ORF3, ruva gene, folC gene, deoB gene, leuS gene, ORF8, ORF9, ORF10, ahcY gene, topG gene, hppa gene, acp gene, ORF15, ORF16, priA gene, ORF18, ORF10, ORF20, ORF21 (partial), tRNA-Ile gene, tRNA-Ala gene, group I intron, IGS, ITS1 and ITS2, strain LA10 Length = 30468 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 361 cccgcctcgatgtacttcttggcgttgtcccaggctcc 398 |||||||||| | ||||||||||||||||||||||||| Sbjct: 17326 cccgcctcgaggaacttcttggcgttgtcccaggctcc 17289
>emb|AJ872266.1| Thermotoga neapolitana 16S rRNA gene, 23S rRNA gene, 5S rRNA gene, ORF1 (partial), ORF2, ahcY gene, topG gene, hppa gene, acp gene, ORF7, ORF8, priA gene, ORF9, ORF10, ORF11, ORF12 (partial), tRNA-Ile gene, tRNA-Ala gene, group I intron, IGS, ITS1 and ITS2, strain LA4 Length = 19759 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 361 cccgcctcgatgtacttcttggcgttgtcccaggctcc 398 |||||||||| | ||||||||||||||||||||||||| Sbjct: 7086 cccgcctcgaggaacttcttggcgttgtcccaggctcc 7049
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 58.0 bits (29), Expect = 3e-05 Identities = 29/29 (100%) Strand = Plus / Minus Query: 367 tcgatgtacttcttggcgttgtcccaggc 395 ||||||||||||||||||||||||||||| Sbjct: 2901773 tcgatgtacttcttggcgttgtcccaggc 2901745 Score = 58.0 bits (29), Expect = 3e-05 Identities = 29/29 (100%) Strand = Plus / Minus Query: 367 tcgatgtacttcttggcgttgtcccaggc 395 ||||||||||||||||||||||||||||| Sbjct: 2896307 tcgatgtacttcttggcgttgtcccaggc 2896279
>gb|AE012448.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 356 of 460 of the complete genome Length = 13170 Score = 58.0 bits (29), Expect = 3e-05 Identities = 29/29 (100%) Strand = Plus / Minus Query: 367 tcgatgtacttcttggcgttgtcccaggc 395 ||||||||||||||||||||||||||||| Sbjct: 5589 tcgatgtacttcttggcgttgtcccaggc 5561
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 58.0 bits (29), Expect = 3e-05 Identities = 29/29 (100%) Strand = Plus / Plus Query: 367 tcgatgtacttcttggcgttgtcccaggc 395 ||||||||||||||||||||||||||||| Sbjct: 2117089 tcgatgtacttcttggcgttgtcccaggc 2117117
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 58.0 bits (29), Expect = 3e-05 Identities = 29/29 (100%) Strand = Plus / Plus Query: 367 tcgatgtacttcttggcgttgtcccaggc 395 ||||||||||||||||||||||||||||| Sbjct: 1032264 tcgatgtacttcttggcgttgtcccaggc 1032292
>gb|L32791.1|BEUPYRO Beta vulgaris clone P2 pyrophosphatase mRNA, complete cds Length = 2868 Score = 58.0 bits (29), Expect = 3e-05 Identities = 155/197 (78%) Strand = Plus / Minus Query: 196 aagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagcgac 255 |||||||| ||||| || || ||||| |||||||| || ||||| | ||||| | || Sbjct: 2449 aagaatggagcgaaaacgagagactcaacggccataagtttgatcaaaatgttcaatgaa 2390 Query: 256 gggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttgtgc 315 ||||| || || |||||||| ||||| || ||||| ||||| || || || |||||||| Sbjct: 2389 gggcctgaggtgtccttgagtgggtcaccaatggtatcaccaatgactgctgccttgtgt 2330 Query: 316 gcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatgtac 375 | ||| || ||||| || || || | | || ||||| || ||||| |||||||||||| Sbjct: 2329 ggctcagacccctttggtccaagactccttgcatgctctgaagcaccagcctcgatgtac 2270 Query: 376 ttcttggcgttgtccca 392 |||||||| |||||||| Sbjct: 2269 ttcttggcattgtccca 2253
>gb|AF044912.1|AF044912 Rhodospirillum rubrum H+ translocating pyrophosphate synthase (RrPP) mRNA, complete cds Length = 2381 Score = 58.0 bits (29), Expect = 3e-05 Identities = 29/29 (100%) Strand = Plus / Minus Query: 367 tcgatgtacttcttggcgttgtcccaggc 395 ||||||||||||||||||||||||||||| Sbjct: 2084 tcgatgtacttcttggcgttgtcccaggc 2056
>dbj|AK110444.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-D10, full insert sequence Length = 2786 Score = 58.0 bits (29), Expect = 3e-05 Identities = 53/61 (86%) Strand = Plus / Minus Query: 226 gccatgagcttgatgaggatgttgagcgacgggccagacgtatccttgagcgggtccccg 285 ||||| |||||||| |||||||| |||| ||||| ||||| |||||||||||||| ||| Sbjct: 2504 gccatcagcttgatcaggatgttcagcgcggggccggacgtgtccttgagcgggtcgccg 2445 Query: 286 a 286 | Sbjct: 2444 a 2444 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Minus Query: 366 ctcgatgtacttcttggcgttgtccca 392 ||||||||||||||| ||||||||||| Sbjct: 2373 ctcgatgtacttcttcgcgttgtccca 2347
>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome Length = 4406967 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 365 cctcgatgtacttcttggcgttgtccca 392 |||||||||||||||||||||||||||| Sbjct: 2429050 cctcgatgtacttcttggcgttgtccca 2429077 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Plus Query: 277 gggtccccgatggtgtcaccgatcacggcggccttgtgcgcctccgagcccttg 330 ||||| |||| |||||||||| |||| || ||||||||||| || ||||||||| Sbjct: 2428980 gggtcgccgacggtgtcaccggtcaccgccgccttgtgcgcgtcggagcccttg 2429033
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome Length = 3052398 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 283 ccgatggtgtcaccgatcacggcggccttgtgcgcctccgagcccttg 330 |||| |||||||||| ||||||| ||||||||||| ||||| |||||| Sbjct: 556031 ccgacggtgtcaccggtcacggcagccttgtgcgcttccgaacccttg 556078
>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome Length = 3997420 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 |||||||||||||||||||||| |||||||| Sbjct: 3644663 cctcgatgtacttcttggcgttatcccaggc 3644693
>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome Length = 3814139 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 ||||||||||||| ||||||||||||||||| Sbjct: 3609508 cctcgatgtactttttggcgttgtcccaggc 3609538
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 288 ggtgtcaccgatcacggcggccttgtgcgcctccgagcc 326 |||||| ||| ||||||||||||||||||| |||||||| Sbjct: 2393280 ggtgtcgccggtcacggcggccttgtgcgcttccgagcc 2393318 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 370 atgtacttcttggcgttgtcccaggc 395 ||||| |||||||||||||||||||| Sbjct: 2393344 atgtatttcttggcgttgtcccaggc 2393369
>gb|AE011990.1| Xanthomonas axonopodis pv. citri str. 306, section 368 of 469 of the complete genome Length = 12292 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 |||||||||| |||||||||||||||||||| Sbjct: 5091 cctcgatgtatttcttggcgttgtcccaggc 5061
>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome Length = 2628784 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 366 ctcgatgtacttcttggcgttgtcccaggctcccccgctgttg 408 |||||| ||||||||||||||||||||||| || |||| |||| Sbjct: 419608 ctcgatatacttcttggcgttgtcccaggcaccgccgccgttg 419650
>emb|AJ872271.1| Thermotoga sp. SG1 16S rRNA gene, 23S rRNA gene, 5S rRNA gene, ORF1 (partial), ORF2, ORF3, ahcY gene, topG gene, hppa gene, acp gene, ORF8, ORF9, priA gene, ORF10, ORF11, ORF12, ORF13, ORF14, mrsA gene, ORF16, rrp2 gene, fsr gene, ORF19, fbpA gene, fepD gene, sfuC gene, ORF23, ORF24, ORF25, gppA gene, tRNA-Ile gene, tRNA-Ala gene, tRNA-Ala gene,tRNA-Arg gene, tRNA-His gene, tRNA-Arg gene, tRNA-Gly gene, tRNA-Ser gene, tRNA-Arg gene, group I intron, IGS, ITS1 and ITS2, strain SG1 Length = 32997 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 360 acccgcctcgatgtacttcttggcgttgtcccaggctcc 398 |||||| |||| | ||||||||||||||||||||||||| Sbjct: 7789 acccgcttcgaggaacttcttggcgttgtcccaggctcc 7751
>emb|X83728.1|NTIPTVP17 N.tabacum mRNA for inorganic pyrophosphatase (TVP17 clone) Length = 1838 Score = 52.0 bits (26), Expect = 0.002 Identities = 98/122 (80%) Strand = Plus / Minus Query: 193 gcgaagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagc 252 |||||||| || ||||| || ||||| ||||| ||||| ||||||||||| ||||| | Sbjct: 1593 gcgaagaagggagcgaacacgagggattcgacagccatcagcttgatgagaatgttcaat 1534 Query: 253 gacgggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttg 312 || || ||||| || |||||||| ||||| || | |||||||| || || || |||||| Sbjct: 1533 gatggtccagatgtgtccttgagagggtcaccaacagtgtcaccaataacagcagccttg 1474 Query: 313 tg 314 || Sbjct: 1473 tg 1472
>gb|U36439.1|RHU36439 Rubus hispidus H+-pyrophosphatase mRNA, partial cds Length = 479 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 349 tgctccgacgcacccgcctcgatgtacttcttggcgttgtcc 390 |||||||| ||||| ||||| |||||||||||||| |||||| Sbjct: 408 tgctccgaagcaccagcctcaatgtacttcttggcattgtcc 367
>gb|BT014617.1| Lycopersicon esculentum clone 134104R, mRNA sequence Length = 2633 Score = 50.1 bits (25), Expect = 0.006 Identities = 154/197 (78%) Strand = Plus / Minus Query: 196 aagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagcgac 255 |||||||| || || ||||| ||||| || ||||| || ||||| | |||||||| || Sbjct: 2362 aagaatggagcaaatacaagtgactcaactgccatcagtttgatcaaaatgttgagggat 2303 Query: 256 gggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttgtgc 315 ||||| || || ||||| || ||||| || |||||||| || || || || |||||||| Sbjct: 2302 gggcccgaagtgtccttcagggggtcaccaatggtgtcgccaataacagcagccttgtga 2243 Query: 316 gcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatgtac 375 | || || ||||| || || || | | | || ||||| || ||||| ||||| || ||| Sbjct: 2242 ggttcagaaccctttgggccgagagtccttgcatgctctgaagcaccagcctcaatatac 2183 Query: 376 ttcttggcgttgtccca 392 ||||||||||||||||| Sbjct: 2182 ttcttggcgttgtccca 2166
>gb|AY373945.1| Hyaloperonospora parasitica clone 72L-2H3 putative H+ translocating inorganic pyrophosphatase mRNA, partial cds Length = 611 Score = 50.1 bits (25), Expect = 0.006 Identities = 73/89 (82%) Strand = Plus / Minus Query: 226 gccatgagcttgatgaggatgttgagcgacgggccagacgtatccttgagcgggtccccg 285 ||||||||||| || | ||||||||| | ||| ||||| |||||||| |||||||| || Sbjct: 266 gccatgagcttcatcaagatgttgagggccggaccagaggtatccttcagcgggtcaccc 207 Query: 286 atggtgtcaccgatcacggcggccttgtg 314 | ||||| ||||| || || |||||||| Sbjct: 206 acagtgtcgccgatgaccgcagccttgtg 178
>gb|U36437.1|ZMU36437 Zea mays H+-pyrophosphatase mRNA, partial cds Length = 1529 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 364 gcctcgatgtacttcttggcgttgtccca 392 ||||| ||||||||||||||||||||||| Sbjct: 1438 gcctcaatgtacttcttggcgttgtccca 1410
>emb|AJ249299.1|HMU249299 Herpetomonas muscarum partial ppa gene for proton-translocating inorganic pyrophosphatase Length = 552 Score = 50.1 bits (25), Expect = 0.006 Identities = 46/53 (86%) Strand = Plus / Minus Query: 382 gcgttgtcccaggctcccccgctgttggaagccgatatggccacctgcacgcc 434 |||||||||||||| || ||| |||| || ||||| ||||||| ||||||||| Sbjct: 551 gcgttgtcccaggcgccgccggtgttcgaggccgagatggccatctgcacgcc 499
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome Length = 3402093 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 365 cctcgatgtacttcttggcgttgtccca 392 |||||||||||||||||||||| ||||| Sbjct: 1915070 cctcgatgtacttcttggcgttatccca 1915097
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtccca 392 |||||||||| ||||||||||||||||| Sbjct: 4088678 cctcgatgtatttcttggcgttgtccca 4088651
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 365 cctcgatgtacttcttggcgttgtccca 392 |||||||||||||||||||||| ||||| Sbjct: 3454275 cctcgatgtacttcttggcgttatccca 3454302
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 365 cctcgatgtacttcttggcgttgtccca 392 ||||||||||||||||||| |||||||| Sbjct: 1110428 cctcgatgtacttcttggcattgtccca 1110455 Score = 40.1 bits (20), Expect = 5.9 Identities = 29/32 (90%) Strand = Plus / Plus Query: 299 tcacggcggccttgtgcgcctccgagcccttg 330 ||||||| ||||||||||| ||||| |||||| Sbjct: 1110380 tcacggccgccttgtgcgcgtccgaacccttg 1110411
>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome Length = 3179300 Score = 48.1 bits (24), Expect = 0.024 Identities = 48/56 (85%) Strand = Plus / Minus Query: 265 gtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttgtgcgcctc 320 |||||||||| ||||| |||| |||||||||||| ||| | || ||||||||||| Sbjct: 1966576 gtatccttgaaggggtcgccgacggtgtcaccgataacgcctgctttgtgcgcctc 1966521
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 46.1 bits (23), Expect = 0.096 Identities = 50/59 (84%) Strand = Plus / Minus Query: 268 tccttgagcgggtccccgatggtgtcaccgatcacggcggccttgtgcgcctccgagcc 326 ||||||| ||||| ||||||||||| ||||| |||| ||||| |||||| || ||||| Sbjct: 158975 tccttgaaggggtcgccgatggtgtcgccgatgacggtggcctcgtgcgcttcagagcc 158917
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome Length = 3304561 Score = 46.1 bits (23), Expect = 0.096 Identities = 29/31 (93%) Strand = Plus / Minus Query: 365 cctcgatgtacttcttggcgttgtcccaggc 395 ||||||||| ||||||||| ||||||||||| Sbjct: 1334218 cctcgatgtgcttcttggcattgtcccaggc 1334188 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 307 gccttgtgcgcctccgagcccttg 330 ||||||||||||||||| |||||| Sbjct: 1334258 gccttgtgcgcctccgatcccttg 1334235
>gb|AF377340.1| Myxococcus xanthus AraC (araC) and serine/threonine kinase associate protein KapC (kapC) genes, complete cds; and unknown genes Length = 7622 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Plus Query: 366 ctcgatgtacttcttggcgttgtccca 392 ||||||| ||||||||||||||||||| Sbjct: 6964 ctcgatgaacttcttggcgttgtccca 6990
>gb|AF320282.1| Toxoplasma gondii H+-translocating inorganic pyrophosphatase TVP1 (TVP1) gene, complete cds Length = 6965 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 370 atgtacttcttggcgttgtccca 392 ||||||||||||||||||||||| Sbjct: 5477 atgtacttcttggcgttgtccca 5455
>gb|AF320281.1| Toxoplasma gondii H+-translocating inorganic pyrophosphatase TVP1 (TVP1) mRNA, complete cds Length = 2451 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 370 atgtacttcttggcgttgtccca 392 ||||||||||||||||||||||| Sbjct: 2231 atgtacttcttggcgttgtccca 2209
>emb|AJ872269.1| Thermotoga petrophila 16S rRNA gene, 23S rRNA gene, 5S rRNA gene, ORF1 (partial), ORF2, ORF3, ruvA gene, folC gene, deoB gene, leuS gene, ORF9, ORF10, ORF11, ahcY gene, topG gene, hppa gene, acp gene, ORF16, ORF17, priA gene, ORF18, ORF19, ORF20, ORF21, ORF22, mrsA gene, ORF24, rrp2 gene, fsr gene, ORF27, ORF28, ORF29, ORF31, ORF32 (partial), tRNA-Ile gene, tRNA-Ala gene, tRNA-Ala gene, tRNA-Arg gene, tRNA-His gene, tRNA-Arg gene, tRNA-Gly gene, group I intron, IGS, ITS1 and ITS2, strain RKU10 Length = 40702 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 gtacttcttggcgttgtcccaggctcc 398 ||||||||| ||||||||||||||||| Sbjct: 17141 gtacttcttcgcgttgtcccaggctcc 17115
>emb|AJ872268.1| Thermotoga naphthophila 16S rRNA gene, 23S rRNA gene, trpE gene, rrp gene, ORF1, gcp gene, clpx gene, ORF2, glmS gene, plsX gene, rpmF gene, ORF3, ORF4, ORF5, ORF6, pheA gene, phoB gene, actI gene, lgt gene, ham1 gene, ORF7, ispA gene, ORF8, ORF9, ORF10, ruvA gene, folC gene, deoB gene, leuS gene, ORF15, ORF11, ORF12, ahcY gene, topG gene, hppa gene, acp gene, ORF13, ORF14, priA gene, tRNA-Pro gene, tRNA-Ile gene, tRNA-Ala gene, group I intron, IGS and ITS1, strain RKU10 Length = 45429 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 gtacttcttggcgttgtcccaggctcc 398 ||||||||| ||||||||||||||||| Sbjct: 35404 gtacttcttcgcgttgtcccaggctcc 35378
>gb|AE000512.1| Thermotoga maritima MSB8, complete genome Length = 1860725 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 gtacttcttggcgttgtcccaggctcc 398 ||||||||| ||||||||||||||||| Sbjct: 184275 gtacttcttcgcgttgtcccaggctcc 184249
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome Length = 2364842 Score = 44.1 bits (22), Expect = 0.38 Identities = 43/50 (86%) Strand = Plus / Minus Query: 265 gtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttgtg 314 ||||||||||||||||| || | ||||| |||| |||||||||||||| Sbjct: 1362727 gtatccttgagcgggtcgcccaccgtgtcgccgacaacggcggccttgtg 1362678
>gb|AC151744.23| Medicago truncatula clone mth2-32k10, complete sequence Length = 110897 Score = 44.1 bits (22), Expect = 0.38 Identities = 79/98 (80%) Strand = Plus / Minus Query: 217 gactcgacggccatgagcttgatgaggatgttgagcgacgggccagacgtatccttgagc 276 ||||| || ||||| |||||||| || ||||| || || || ||||| || ||||| | Sbjct: 43477 gactccactgccatcagcttgataagaatgttaagggatggaccagatgtgtccttcaat 43418 Query: 277 gggtccccgatggtgtcaccgatcacggcggccttgtg 314 |||||||| ||||||||||| || || || |||||||| Sbjct: 43417 gggtccccaatggtgtcaccaataactgctgccttgtg 43380
>gb|AF424645.1| Phytophthora infestans clone MY-04-F-06 pyrophosphatase mRNA, complete cds Length = 879 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 374 acttcttggcgttgtcccaggc 395 |||||||||||||||||||||| Sbjct: 356 acttcttggcgttgtcccaggc 335 Score = 42.1 bits (21), Expect = 1.5 Identities = 72/89 (80%) Strand = Plus / Minus Query: 226 gccatgagcttgatgaggatgttgagcgacgggccagacgtatccttgagcgggtccccg 285 ||||| ||||| || |||||||| || | ||| ||||| || ||||| | |||||| || Sbjct: 519 gccataagcttcatcaggatgttaagggccggaccagaagtgtccttcaacgggtcaccc 460 Query: 286 atggtgtcaccgatcacggcggccttgtg 314 | ||||||||| || || ||||||||||| Sbjct: 459 acggtgtcaccaatgacagcggccttgtg 431
>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome Length = 5727534 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 373 tacttcttggcgttgtcccaggctcc 398 ||||||||||| |||||||||||||| Sbjct: 5494712 tacttcttggcattgtcccaggctcc 5494737
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 367 tcgatgtacttcttggcgttgtccca 392 |||||||||||||| ||||||||||| Sbjct: 957765 tcgatgtacttctttgcgttgtccca 957790
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 367 tcgatgtacttcttggcgttgtccca 392 |||||||||||||||||||| ||||| Sbjct: 2554989 tcgatgtacttcttggcgttatccca 2554964
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 367 tcgatgtacttcttggcgttgtccca 392 |||||||||||||| ||||||||||| Sbjct: 989026 tcgatgtacttctttgcgttgtccca 989051
>emb|AJ872273.1| Thermotoga sp. RQ2 16S rRNA gene, 23S rRNA gene, 5S rRNA gene, clpX gene (partial), ORF2, glmS gene, plsX gene, rpmF gene, ORF6, ORF7, ORF8, ORF9, pheA gene, phoB gene, actI gene, lgt gene, ORF14, ORF15, ispA gene, ORF17, ORF18, ORF19, ruvA gene, folC gene, deoB gene, leuS gene, ORF24, ORF25, ORF26, ahcY gene, topG gene, hppa gene, acp gene, ORF31, ORF32, priA gene, ORF34, ORF35, ORF36, ORF37, tRNA-Ile gene, tRNA-Ala gene, IGS, ITS1 and ITS2, strain RQ2 Length = 43944 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 373 tacttcttggcgttgtcccaggctcc 398 |||||||| ||||||||||||||||| Sbjct: 31486 tacttcttcgcgttgtcccaggctcc 31461
>emb|AJ251218.1|LCT251218 Leptomonas ctenocephali partial vppa gene for putative proton-translocating inorganic pyrophosphatase Length = 552 Score = 44.1 bits (22), Expect = 0.38 Identities = 43/50 (86%) Strand = Plus / Minus Query: 382 gcgttgtcccaggctcccccgctgttggaagccgatatggccacctgcac 431 |||||||||||||| || || |||||||||| || ||||||| |||||| Sbjct: 551 gcgttgtcccaggcgccgcctgtgttggaagcggaaatggccatctgcac 502
>gb|AE009080.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 106 of 256 of the complete sequence Length = 10277 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 375 cttcttggcgttgtcccaggc 395 ||||||||||||||||||||| Sbjct: 9313 cttcttggcgttgtcccaggc 9293
>gb|AE005811.1| Caulobacter crescentus CB15 section 137 of 359 of the complete genome Length = 10363 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 375 cttcttggcgttgtcccaggc 395 ||||||||||||||||||||| Sbjct: 8683 cttcttggcgttgtcccaggc 8663
>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome Length = 2841581 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 375 cttcttggcgttgtcccaggc 395 ||||||||||||||||||||| Sbjct: 1169010 cttcttggcgttgtcccaggc 1168990
>gb|AF417519.1|AF417518S2 Mycoplana dimorpha inorganic pyrophosphatase gene, partial cds Length = 676 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 375 cttcttggcgttgtcccaggc 395 ||||||||||||||||||||| Sbjct: 531 cttcttggcgttgtcccaggc 511
>gb|AF417521.1|AF417520S2 Agrobacterium tumefaciens strain C58 inorganic pyrophosphatase gene, partial cds Length = 667 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 375 cttcttggcgttgtcccaggc 395 ||||||||||||||||||||| Sbjct: 521 cttcttggcgttgtcccaggc 501
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 116 tgatattctcaaaccagacat 136 ||||||||||||||||||||| Sbjct: 950474 tgatattctcaaaccagacat 950454
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 375 cttcttggcgttgtcccaggc 395 ||||||||||||||||||||| Sbjct: 4952474 cttcttggcgttgtcccaggc 4952494
>gb|AY914802.1| Thialkalivibrio thiocyanodenitrificans strain ARhD1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (cbbL) gene, partial cds Length = 753 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 acccagggacttggcgtgctc 353 ||||||||||||||||||||| Sbjct: 162 acccagggacttggcgtgctc 142
>emb|X77915.1|NTSAMIPP N.tabacum mRNA for inorganic pyrophosphatase (TVP5clone) Length = 2713 Score = 42.1 bits (21), Expect = 1.5 Identities = 153/197 (77%) Strand = Plus / Minus Query: 196 aagaatggcgcgaagacaagggactcgacggccatgagcttgatgaggatgttgagcgac 255 |||||||| || || || || ||||| || ||||| |||||||| | |||||||| || Sbjct: 2346 aagaatggagcaaatacgagcgactcaactgccataagcttgatcaaaatgttgagtgat 2287 Query: 256 gggccagacgtatccttgagcgggtccccgatggtgtcaccgatcacggcggccttgtgc 315 ||||| || || ||||| || ||||| || || |||||||| || || || |||||||| Sbjct: 2286 gggcctgaagtgtcctttagggggtcaccaattgtgtcaccaataacagcagccttgtga 2227 Query: 316 gcctccgagcccttgggacccagggacttggcgtgctccgacgcacccgcctcgatgtac 375 | || || ||||| || || || | | | || ||||| || ||||| ||||| || ||| Sbjct: 2226 ggttcggaaccctttgggccaagagtccttgcatgctctgaagcaccagcctcaatatac 2167 Query: 376 ttcttggcgttgtccca 392 |||||||| |||||||| Sbjct: 2166 ttcttggcattgtccca 2150
>dbj|AP000999.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-667I23, complete sequence Length = 189892 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 133 acattcatgtatatctccctg 153 ||||||||||||||||||||| Sbjct: 137859 acattcatgtatatctccctg 137839
>dbj|AP002853.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-46K15, complete sequence Length = 177463 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 133 acattcatgtatatctccctg 153 ||||||||||||||||||||| Sbjct: 55428 acattcatgtatatctccctg 55408
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 116 tgatattctcaaaccagacat 136 ||||||||||||||||||||| Sbjct: 950474 tgatattctcaaaccagacat 950454
>emb|BX000505.1|CNS08CDV Oryza sativa chromosome 12, . BAC OJ1126_F08 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 134217 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 116 tgatattctcaaaccagacat 136 ||||||||||||||||||||| Sbjct: 88059 tgatattctcaaaccagacat 88039
>gb|U74631.1|RCU74631 Ricinus communis calreticulin gene, complete cds Length = 4975 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 217 gactcgacggccatgagcttgatgaggat 245 |||||||| |||||||||||||| ||||| Sbjct: 135 gactcgactgccatgagcttgatcaggat 107
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 364 gcctcgatgtacttcttggcgttgtccca 392 ||||||||||||||||| ||||| ||||| Sbjct: 2750155 gcctcgatgtacttcttcgcgttatccca 2750183
>dbj|AP006080.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT48M22, TM0118c, complete sequence Length = 91116 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 148 tccctgcaatatttgtatcag 168 ||||||||||||||||||||| Sbjct: 5076 tccctgcaatatttgtatcag 5096
>emb|AJ245400.1|LMA245400 Leishmania major partial ppa gene for proton-translocating inorganic pyrophosphatase Length = 551 Score = 42.1 bits (21), Expect = 1.5 Identities = 45/53 (84%) Strand = Plus / Minus Query: 382 gcgttgtcccaggctcccccgctgttggaagccgatatggccacctgcacgcc 434 ||||||||||| || || ||| ||||||| ||||| || |||| ||||||||| Sbjct: 551 gcgttgtcccatgcgccgccggtgttggaggccgagatagccatctgcacgcc 499
>emb|AJ249333.1|ESC249333 Endotrypanum schaudinni partial ppa gene for putative proton-translocating inorganic pyrophosphatase Length = 552 Score = 42.1 bits (21), Expect = 1.5 Identities = 45/53 (84%) Strand = Plus / Minus Query: 382 gcgttgtcccaggctcccccgctgttggaagccgatatggccacctgcacgcc 434 |||||||||||||| || || ||||||| || || ||||||| ||||||||| Sbjct: 551 gcgttgtcccaggcgccgccagtgttggaggcagaaatggccatctgcacgcc 499
>emb|AJ965256.1| Dehalococcoides sp. CBDB1 complete genome Length = 1395502 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 ttcttggcgttgtcccaggc 395 |||||||||||||||||||| Sbjct: 622009 ttcttggcgttgtcccaggc 621990
>gb|AC004158.1|HUAC004158 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-10F4, complete sequence Length = 180551 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 taagcctctactattccaca 101 |||||||||||||||||||| Sbjct: 57062 taagcctctactattccaca 57043
>emb|BX957221.1| Methanococcus maripaludis S2 complete genome; segment 3/5 Length = 348230 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 ctgcaatatttgtatcagtt 170 |||||||||||||||||||| Sbjct: 303015 ctgcaatatttgtatcagtt 302996
>gb|AC010651.7|AC010651 Homo sapiens chromosome 16 clone RP11-413O10, complete sequence Length = 165868 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 taagcctctactattccaca 101 |||||||||||||||||||| Sbjct: 83261 taagcctctactattccaca 83242 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,723,694 Number of Sequences: 3902068 Number of extensions: 2723694 Number of successful extensions: 48274 Number of sequences better than 10.0: 148 Number of HSP's better than 10.0 without gapping: 150 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 47137 Number of HSP's gapped (non-prelim): 1116 length of query: 442 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 420 effective length of database: 17,147,199,772 effective search space: 7201823904240 effective search space used: 7201823904240 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
