ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart06b01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC163444.3| Mus musculus chromosome 1, clone RP23-85E22, comp... 46 0.030
2gb|AC112975.14| Mus musculus chromosome 1, clone RP24-468G12, co... 46 0.030
3gb|AC114551.12| Mus musculus chromosome 3, clone RP23-301O12, co... 42 0.47
4emb|CR378664.1| Photobacterium profundum SS9; segment 2/12 40 1.9
5emb|AL596086.9| Mouse DNA sequence from clone RP23-168C20 on chr... 40 1.9
6emb|BX293546.8| Mouse DNA sequence from clone RP23-459M13 on chr... 40 1.9
7gb|AC167717.3| Oryctolagus cuniculus, clone Oryctolagus cuniculu... 40 1.9
8gb|AC138716.2| Mus musculus BAC clone RP23-241B5 from chromosome... 38 7.4
9gb|CP000318.1| Polaromonas sp. JS666 plasmid 2, complete sequence 38 7.4
10emb|AL450026.10| Human DNA sequence from clone RP11-439A18 on ch... 38 7.4
11gb|AE014181.1| Mus musculus piebald deletion region section 9 of... 38 7.4
12gb|AC115100.3| Homo sapiens chromosome 18, clone RP11-237L15, co... 38 7.4
13gb|AF436412.1| Petrothrincus circularis 18S small subunit riboso... 38 7.4
14gb|AC104442.2| Homo sapiens chromosome 3 clone RP11-905F6, compl... 38 7.4
15gb|AC091143.6| Homo sapiens chromosome 18, clone CTD-3056C12, co... 38 7.4
16gb|AC138058.2| Homo sapiens chromosome 3 clone RP11-298C2, compl... 38 7.4
17emb|AL773590.8| Mouse DNA sequence from clone RP23-181A13 on chr... 38 7.4

>gb|AC163444.3| Mus musculus chromosome 1, clone RP23-85E22, complete sequence
          Length = 225533

 Score = 46.1 bits (23), Expect = 0.030
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 100 tgaaaatggaaggcatgaggcca 122
           |||||||||||||||||||||||
Sbjct: 116 tgaaaatggaaggcatgaggcca 94



to top

>gb|AC112975.14| Mus musculus chromosome 1, clone RP24-468G12, complete sequence
          Length = 175974

 Score = 46.1 bits (23), Expect = 0.030
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 100   tgaaaatggaaggcatgaggcca 122
             |||||||||||||||||||||||
Sbjct: 62049 tgaaaatggaaggcatgaggcca 62071



to top

>gb|AC114551.12| Mus musculus chromosome 3, clone RP23-301O12, complete sequence
          Length = 189791

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 88    gggttaaaattgtgaaaatgg 108
             |||||||||||||||||||||
Sbjct: 70873 gggttaaaattgtgaaaatgg 70853



to top

>emb|CR378664.1| Photobacterium profundum SS9; segment 2/12
          Length = 347994

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 122   acaacccctttttgctagcc 141
             ||||||||||||||||||||
Sbjct: 54806 acaacccctttttgctagcc 54787



to top

>emb|AL596086.9| Mouse DNA sequence from clone RP23-168C20 on chromosome 11 Contains the
              3' end of the Tex14 gene for testis expressed gene 14,
              complete sequence
          Length = 200501

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 101    gaaaatggaaggcatgaggc 120
              ||||||||||||||||||||
Sbjct: 195048 gaaaatggaaggcatgaggc 195029



to top

>emb|BX293546.8| Mouse DNA sequence from clone RP23-459M13 on chromosome 2, complete
             sequence
          Length = 71049

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 91    ttaaaattgtgaaaatggaa 110
             ||||||||||||||||||||
Sbjct: 36418 ttaaaattgtgaaaatggaa 36437



to top

>gb|AC167717.3| Oryctolagus cuniculus, clone Oryctolagus cuniculus-16721157J10,
            complete sequence
          Length = 33881

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 83   tttccgggttaaaattgtgaaaat 106
            |||| |||||||||||||||||||
Sbjct: 2689 tttcagggttaaaattgtgaaaat 2666



to top

>gb|AC138716.2| Mus musculus BAC clone RP23-241B5 from chromosome 14, complete sequence
          Length = 167083

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 77    tctcagtttccgggttaaa 95
             |||||||||||||||||||
Sbjct: 49416 tctcagtttccgggttaaa 49398



to top

>gb|CP000318.1| Polaromonas sp. JS666 plasmid 2, complete sequence
          Length = 338007

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 22    accatggacgggtcgggcggcag 44
             ||||||||||| |||||||||||
Sbjct: 17192 accatggacggctcgggcggcag 17214



to top

>emb|AL450026.10| Human DNA sequence from clone RP11-439A18 on chromosome 9 Contains the
             5' UTR of a variant of a novel gene (MGC20553) and a CpG
             island, complete sequence
          Length = 84632

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 93    aaaattgtgaaaatggaag 111
             |||||||||||||||||||
Sbjct: 10104 aaaattgtgaaaatggaag 10122



to top

>gb|AE014181.1| Mus musculus piebald deletion region section 9 of 11 of the complete
             sequence
          Length = 400029

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 77    tctcagtttccgggttaaa 95
             |||||||||||||||||||
Sbjct: 54092 tctcagtttccgggttaaa 54110



to top

>gb|AC115100.3| Homo sapiens chromosome 18, clone RP11-237L15, complete sequence
          Length = 169152

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 92    taaaattgtgaaaatggaa 110
             |||||||||||||||||||
Sbjct: 32673 taaaattgtgaaaatggaa 32691



to top

>gb|AF436412.1| Petrothrincus circularis 18S small subunit ribosomal RNA gene,
           partial sequence
          Length = 474

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 86  ccgggttaaaattgtgaaa 104
           |||||||||||||||||||
Sbjct: 415 ccgggttaaaattgtgaaa 397



to top

>gb|AC104442.2| Homo sapiens chromosome 3 clone RP11-905F6, complete sequence
          Length = 219227

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 65    ttgttacttggttctcagtttcc 87
             |||| ||||||||||||||||||
Sbjct: 58630 ttgtcacttggttctcagtttcc 58608



to top

>gb|AC091143.6| Homo sapiens chromosome 18, clone CTD-3056C12, complete sequence
          Length = 104854

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 92    taaaattgtgaaaatggaa 110
             |||||||||||||||||||
Sbjct: 71255 taaaattgtgaaaatggaa 71273



to top

>gb|AC138058.2| Homo sapiens chromosome 3 clone RP11-298C2, complete sequence
          Length = 154123

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 65     ttgttacttggttctcagtttcc 87
              |||| ||||||||||||||||||
Sbjct: 133237 ttgtcacttggttctcagtttcc 133215



to top

>emb|AL773590.8| Mouse DNA sequence from clone RP23-181A13 on chromosome 2, complete
             sequence
          Length = 185348

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 88    gggttaaaattgtgaaaatggaa 110
             ||||||| |||||||||||||||
Sbjct: 26797 gggttaatattgtgaaaatggaa 26819


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,196,603
Number of Sequences: 3902068
Number of extensions: 1196603
Number of successful extensions: 86351
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86318
Number of HSP's gapped (non-prelim): 33
length of query: 154
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 132
effective length of database: 17,147,199,772
effective search space: 2263430369904
effective search space used: 2263430369904
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top