| Clone Name | rbaet99g11 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AJ003141.1|HVAJ3141 Hordeum vulgare mRNA for stress-related peroxidase Length = 1245 Score = 369 bits (186), Expect = 2e-99 Identities = 198/201 (98%), Gaps = 2/201 (0%) Strand = Plus / Minus Query: 5 tgacctctcatcttattggctagacatcacacttccacgattcaaagtttaaaacacata 64 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1245 tgacctctcatcttattggctagacatcacacttccacgattcaaagtttaaaacacata 1186 Query: 65 gactacttaacggccactcacacagtcacacagtactactacgttacaccgattggttat 124 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1185 gactacttaacggccactcacacagtcacacagtactactacgttacaccgattggttat 1126 Query: 125 atatctctcacatgtcagcggcgatcccctcgtcgccg--gacggcagtctcgatgtcct 182 |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| Sbjct: 1125 atatctctcacatgtcagcggcgatcccctcgtcgccggcgacggcggtctcgatgtcct 1066 Query: 183 ggacacgcctgttggggacgg 203 ||||||||||||||||||||| Sbjct: 1065 ggacacgcctgttggggacgg 1045
>emb|X62438.1|HVPERO H.vulgare mRNA for peroxidase Length = 740 Score = 345 bits (174), Expect = 3e-92 Identities = 200/205 (97%), Gaps = 4/205 (1%) Strand = Plus / Minus Query: 1 gttttgacctctcatcttattggctagacatcacacttccacgattcaaagtttaaaaca 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 651 gttttgacctctcatcttattggctagacatcacacttccacgattcaaagtttaaaaca 592 Query: 61 catagactacttaacggccactcacacagtcacacagtactactacgttacaccgattgg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 591 catagactacttaacggccactcacacagtcacacagtactactacgttacaccgattgg 532 Query: 121 ttatatatctctcacatgtcagcggcgatcccctcgtcgccg--gacggcagtctcgatg 178 ||||||||||||||||||||||||||||||||||||| |||| |||||| ||||||||| Sbjct: 531 ttatatatctctcacatgtcagcggcgatcccctcgt-gccggcgacggcggtctcgatg 473 Query: 179 tcctggacacgcctgttggggacgg 203 |||| |||||||||||||||||||| Sbjct: 472 tcct-gacacgcctgttggggacgg 449
>emb|AJ878510.1| Triticum aestivum mRNA for peroxidase precursor (prx gene), cultivar Cheyenne Length = 1226 Score = 81.8 bits (41), Expect = 8e-13 Identities = 65/72 (90%), Gaps = 2/72 (2%) Strand = Plus / Minus Query: 130 tctcacatgtcagcggcgatcccctcgtcgccg--gacggcagtctcgatgtcctggaca 187 ||||||||||| ||||||||||||||||||||| | ||| |||||||| ||||||||| Sbjct: 1107 tctcacatgtcggcggcgatcccctcgtcgccggtggtggcggtctcgatatcctggaca 1048 Query: 188 cgcctgttgggg 199 |||||||||||| Sbjct: 1047 cgcctgttgggg 1036
>gb|AY857763.1| Triticum monococcum peroxidase 9 (POX9) mRNA, partial cds Length = 760 Score = 44.1 bits (22), Expect = 0.17 Identities = 31/34 (91%) Strand = Plus / Minus Query: 170 gtctcgatgtcctggacacgcctgttggggacgg 203 ||||||||| ||| |||||| ||||||||||||| Sbjct: 583 gtctcgatgcccttgacacggctgttggggacgg 550
>gb|AC100751.6| Mus musculus chromosome 18, clone RP23-249P18, complete sequence Length = 253910 Score = 44.1 bits (22), Expect = 0.17 Identities = 25/26 (96%) Strand = Plus / Plus Query: 79 cactcacacagtcacacagtactact 104 |||||| ||||||||||||||||||| Sbjct: 35412 cactcatacagtcacacagtactact 35437
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 42.1 bits (21), Expect = 0.66 Identities = 24/25 (96%) Strand = Plus / Minus Query: 165 cggcagtctcgatgtcctggacacg 189 ||||| ||||||||||||||||||| Sbjct: 4098557 cggcaatctcgatgtcctggacacg 4098533
>emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome; segment 12/13 Length = 349606 Score = 42.1 bits (21), Expect = 0.66 Identities = 24/25 (96%) Strand = Plus / Minus Query: 165 cggcagtctcgatgtcctggacacg 189 ||||| ||||||||||||||||||| Sbjct: 289123 cggcaatctcgatgtcctggacacg 289099
>emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 13/14 Length = 316050 Score = 42.1 bits (21), Expect = 0.66 Identities = 24/25 (96%) Strand = Plus / Minus Query: 165 cggcagtctcgatgtcctggacacg 189 ||||| ||||||||||||||||||| Sbjct: 292646 cggcaatctcgatgtcctggacacg 292622
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 40.1 bits (20), Expect = 2.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 143 cggcgatcccctcgtcgccggacggcag 170 |||||||||||||| || |||||||||| Sbjct: 1792422 cggcgatcccctcggcggcggacggcag 1792449
>gb|AC161263.2| Mus musculus BAC clone RP23-296K6 from chromosome 8, complete sequence Length = 199032 Score = 40.1 bits (20), Expect = 2.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 120 gttatatatctctcacatgtcagc 143 ||||||||||| |||||||||||| Sbjct: 173426 gttatatatctatcacatgtcagc 173449
>gb|AC144858.3| Mus musculus BAC clone RP24-144F3 from 8, complete sequence Length = 185158 Score = 40.1 bits (20), Expect = 2.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 120 gttatatatctctcacatgtcagc 143 ||||||||||| |||||||||||| Sbjct: 41286 gttatatatctatcacatgtcagc 41309 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,338,077 Number of Sequences: 3902068 Number of extensions: 1338077 Number of successful extensions: 98786 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 98695 Number of HSP's gapped (non-prelim): 87 length of query: 206 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 184 effective length of database: 17,147,199,772 effective search space: 3155084758048 effective search space used: 3155084758048 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)