>emb|AJ003141.1|HVAJ3141 Hordeum vulgare mRNA for stress-related peroxidase
          Length = 1245

 Score =  369 bits (186), Expect = 2e-99
 Identities = 198/201 (98%), Gaps = 2/201 (0%)
 Strand = Plus / Minus

                                                                        
Query: 5    tgacctctcatcttattggctagacatcacacttccacgattcaaagtttaaaacacata 64
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1245 tgacctctcatcttattggctagacatcacacttccacgattcaaagtttaaaacacata 1186

                                                                        
Query: 65   gactacttaacggccactcacacagtcacacagtactactacgttacaccgattggttat 124
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 gactacttaacggccactcacacagtcacacagtactactacgttacaccgattggttat 1126

                                                                        
Query: 125  atatctctcacatgtcagcggcgatcccctcgtcgccg--gacggcagtctcgatgtcct 182
            ||||||||||||||||||||||||||||||||||||||  |||||| |||||||||||||
Sbjct: 1125 atatctctcacatgtcagcggcgatcccctcgtcgccggcgacggcggtctcgatgtcct 1066

                                 
Query: 183  ggacacgcctgttggggacgg 203
            |||||||||||||||||||||
Sbjct: 1065 ggacacgcctgttggggacgg 1045

>emb|X62438.1|HVPERO H.vulgare mRNA for peroxidase
          Length = 740

 Score =  345 bits (174), Expect = 3e-92
 Identities = 200/205 (97%), Gaps = 4/205 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   gttttgacctctcatcttattggctagacatcacacttccacgattcaaagtttaaaaca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 651 gttttgacctctcatcttattggctagacatcacacttccacgattcaaagtttaaaaca 592

                                                                       
Query: 61  catagactacttaacggccactcacacagtcacacagtactactacgttacaccgattgg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 591 catagactacttaacggccactcacacagtcacacagtactactacgttacaccgattgg 532

                                                                       
Query: 121 ttatatatctctcacatgtcagcggcgatcccctcgtcgccg--gacggcagtctcgatg 178
           ||||||||||||||||||||||||||||||||||||| ||||  |||||| |||||||||
Sbjct: 531 ttatatatctctcacatgtcagcggcgatcccctcgt-gccggcgacggcggtctcgatg 473

                                    
Query: 179 tcctggacacgcctgttggggacgg 203
           |||| ||||||||||||||||||||
Sbjct: 472 tcct-gacacgcctgttggggacgg 449

>emb|AJ878510.1| Triticum aestivum mRNA for peroxidase precursor (prx gene), cultivar
            Cheyenne
          Length = 1226

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 65/72 (90%), Gaps = 2/72 (2%)
 Strand = Plus / Minus

                                                                        
Query: 130  tctcacatgtcagcggcgatcccctcgtcgccg--gacggcagtctcgatgtcctggaca 187
            ||||||||||| |||||||||||||||||||||  |  ||| |||||||| |||||||||
Sbjct: 1107 tctcacatgtcggcggcgatcccctcgtcgccggtggtggcggtctcgatatcctggaca 1048

                        
Query: 188  cgcctgttgggg 199
            ||||||||||||
Sbjct: 1047 cgcctgttgggg 1036

>gb|AY857763.1| Triticum monococcum peroxidase 9 (POX9) mRNA, partial cds
          Length = 760

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 170 gtctcgatgtcctggacacgcctgttggggacgg 203
           ||||||||| ||| |||||| |||||||||||||
Sbjct: 583 gtctcgatgcccttgacacggctgttggggacgg 550

>gb|AC100751.6| Mus musculus chromosome 18, clone RP23-249P18, complete sequence
          Length = 253910

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 79    cactcacacagtcacacagtactact 104
             |||||| |||||||||||||||||||
Sbjct: 35412 cactcatacagtcacacagtactact 35437

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 165     cggcagtctcgatgtcctggacacg 189
               ||||| |||||||||||||||||||
Sbjct: 4098557 cggcaatctcgatgtcctggacacg 4098533

>emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome; segment 12/13
          Length = 349606

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 165    cggcagtctcgatgtcctggacacg 189
              ||||| |||||||||||||||||||
Sbjct: 289123 cggcaatctcgatgtcctggacacg 289099

>emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 13/14
          Length = 316050

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 165    cggcagtctcgatgtcctggacacg 189
              ||||| |||||||||||||||||||
Sbjct: 292646 cggcaatctcgatgtcctggacacg 292622

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 143     cggcgatcccctcgtcgccggacggcag 170
               |||||||||||||| || ||||||||||
Sbjct: 1792422 cggcgatcccctcggcggcggacggcag 1792449

>gb|AC161263.2| Mus musculus BAC clone RP23-296K6 from chromosome 8, complete sequence
          Length = 199032

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 120    gttatatatctctcacatgtcagc 143
              ||||||||||| ||||||||||||
Sbjct: 173426 gttatatatctatcacatgtcagc 173449

>gb|AC144858.3| Mus musculus BAC clone RP24-144F3 from 8, complete sequence
          Length = 185158

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 120   gttatatatctctcacatgtcagc 143
             ||||||||||| ||||||||||||
Sbjct: 41286 gttatatatctatcacatgtcagc 41309


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,338,077
Number of Sequences: 3902068
Number of extensions: 1338077
Number of successful extensions: 98786
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 98695
Number of HSP's gapped (non-prelim): 87
length of query: 206
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 184
effective length of database: 17,147,199,772
effective search space: 3155084758048
effective search space used: 3155084758048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)