ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet99g08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY633768.1| Sus scrofa relaxin-3/INSL7 receptor 2 (GPCR142) m... 48 0.015
2gb|AY633767.1| Bos taurus relaxin-3/INSL7 receptor 2 (GPCR142) m... 48 0.015
3gb|AY633766.1| Macaca nemestrina relaxin-3/INSL7 receptor 2 (GPC... 48 0.015
4ref|NM_181885.1| Homo sapiens relaxin/insulin-like family peptid... 48 0.015
5gb|AY394502.1| Homo sapiens relaxin-3 receptor-2 mRNA, complete cds 48 0.015
6gb|AY288415.1| Homo sapiens G protein-coupled receptor 100 (GPR1... 48 0.015
7gb|AY170824.1| Homo sapiens G protein-coupled receptor (GPR100) ... 48 0.015
8gb|BC101507.1| Homo sapiens relaxin family peptide receptor 4, m... 48 0.015
9gb|BC101509.1| Homo sapiens relaxin family peptide receptor 4, m... 48 0.015
10emb|AL355388.30| Human DNA sequence from clone RP11-336K24 on ch... 48 0.015
11dbj|AB083593.1| Homo sapiens GPCR gene for putative G-protein co... 48 0.015
12ref|NM_001007076.1| Bos taurus G protein-coupled receptor 100 (G... 48 0.015
13ref|NM_001005844.1| Sus scrofa G protein-coupled receptor 100 (G... 48 0.015
14dbj|AB065617.1| Homo sapiens gene for seven transmembrane helix ... 48 0.015
15gb|AC122725.30| Medicago truncatula clone mth2-4c11, complete se... 42 0.94
16dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.94
17gb|AC092698.11| Homo sapiens chromosome 8, clone RP11-813M16, co... 42 0.94
18dbj|AP000391.2| Oryza sativa (japonica cultivar-group) genomic D... 42 0.94
19ref|XM_751953.1| Ustilago maydis 521 hypothetical protein (UM008... 40 3.7
20emb|CR974429.7| Mouse DNA sequence from clone RP23-177B9 on chro... 40 3.7
21ref|XM_382491.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 40 3.7
22gb|AC121918.3| Mus musculus BAC clone RP24-195D23 from chromosom... 40 3.7
23gb|AC122191.4| Mus musculus BAC clone RP23-42J4 from 6, complete... 40 3.7
24gb|BC094061.1| Mus musculus basic helix-loop-helix domain contai... 40 3.7
25gb|BC011486.1| Mus musculus basic helix-loop-helix domain contai... 40 3.7
26ref|NM_010800.3| Mus musculus basic helix-loop-helix domain cont... 40 3.7
27dbj|AK020643.1| Mus musculus adult male urinary bladder cDNA, RI... 40 3.7
28dbj|BS000215.2| Pan troglodytes chromosome 22 clone:RP43-183P07,... 40 3.7
29gb|AF091858.1|AF091858 Mus musculus myogenic repressor MIST1 (Mi... 40 3.7
30gb|AC155330.3| Mus musculus 6 BAC RP24-146L23 (Roswell Park Canc... 40 3.7
31dbj|AP001698.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 3.7
32gb|AE016830.1| Enterococcus faecalis V583, complete genome 40 3.7
33gb|AC121845.3| Mus musculus BAC clone RP24-82B23 from 5, complet... 40 3.7
34emb|AL732541.11| Mouse DNA sequence from clone RP23-306D20 on ch... 40 3.7
35dbj|AP001603.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 40 3.7

>gb|AY633768.1| Sus scrofa relaxin-3/INSL7 receptor 2 (GPCR142) mRNA, complete cds
          Length = 1122

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 659 ccaccagctacctgctgctgctgg 682



to top

>gb|AY633767.1| Bos taurus relaxin-3/INSL7 receptor 2 (GPCR142) mRNA, complete cds
          Length = 1122

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 659 ccaccagctacctgctgctgctgg 682



to top

>gb|AY633766.1| Macaca nemestrina relaxin-3/INSL7 receptor 2 (GPCR142) mRNA,
           complete cds
          Length = 1122

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 659 ccaccagctacctgctgctgctgg 682



to top

>ref|NM_181885.1| Homo sapiens relaxin/insulin-like family peptide receptor 4
           (RXFP4), mRNA
          Length = 1125

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 662 ccaccagctacctgctgctgctgg 685



to top

>gb|AY394502.1| Homo sapiens relaxin-3 receptor-2 mRNA, complete cds
          Length = 1125

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 662 ccaccagctacctgctgctgctgg 685



to top

>gb|AY288415.1| Homo sapiens G protein-coupled receptor 100 (GPR100) mRNA, complete
           cds
          Length = 1125

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 662 ccaccagctacctgctgctgctgg 685



to top

>gb|AY170824.1| Homo sapiens G protein-coupled receptor (GPR100) mRNA, complete cds
          Length = 1125

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 662 ccaccagctacctgctgctgctgg 685



to top

>gb|BC101507.1| Homo sapiens relaxin family peptide receptor 4, mRNA (cDNA clone
           MGC:126556 IMAGE:8069013), complete cds
          Length = 1236

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 682 ccaccagctacctgctgctgctgg 705



to top

>gb|BC101509.1| Homo sapiens relaxin family peptide receptor 4, mRNA (cDNA clone
           MGC:126558 IMAGE:8069015), complete cds
          Length = 1236

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 682 ccaccagctacctgctgctgctgg 705



to top

>emb|AL355388.30| Human DNA sequence from clone RP11-336K24 on chromosome 1 Contains the
             5' end of the RIT1 gene for Ras-like without CAAX 1, the
             gene for a novel protein (KIAA0907), the ARHGEF2 gene for
             rho/rac guanine nucleotide exchange factor (GEF) 2, four
             novel genes, the SSR2 gene for signal sequence receptor
             beta (translocon-associated protein beta), the C1orf6 gene
             for chromosome 1 open reading frame 6, the gene for
             mitogen-activated protein-binding protein-interacting
             protein (MAPBPIP), the RAB25 gene for RAB25 (member RAS
             oncogene family), the 5' end of the LMNA gene for lamin
             A/C and three CpG islands, complete sequence
          Length = 205463

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 175   ccaccagctacctgctgctgctgg 198
             ||||||||||||||||||||||||
Sbjct: 36051 ccaccagctacctgctgctgctgg 36074



to top

>dbj|AB083593.1| Homo sapiens GPCR gene for putative G-protein coupled receptor,
           complete CDS, clone:hGPCR11
          Length = 1125

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 662 ccaccagctacctgctgctgctgg 685



to top

>ref|NM_001007076.1| Bos taurus G protein-coupled receptor 100 (GPR100), mRNA
          Length = 1122

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 659 ccaccagctacctgctgctgctgg 682



to top

>ref|NM_001005844.1| Sus scrofa G protein-coupled receptor 100 (GPR100), mRNA
          Length = 1122

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 659 ccaccagctacctgctgctgctgg 682



to top

>dbj|AB065617.1| Homo sapiens gene for seven transmembrane helix receptor, complete
           cds, isolate:CBRC7TM_180
          Length = 42863

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 175 ccaccagctacctgctgctgctgg 198
           ||||||||||||||||||||||||
Sbjct: 862 ccaccagctacctgctgctgctgg 885



to top

>gb|AC122725.30| Medicago truncatula clone mth2-4c11, complete sequence
          Length = 134892

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 116   acaacacgaaaaaacacctaa 136
             |||||||||||||||||||||
Sbjct: 70409 acaacacgaaaaaacacctaa 70429



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 77      atgaactagtatgatccatga 97
               |||||||||||||||||||||
Sbjct: 1550611 atgaactagtatgatccatga 1550631



to top

>gb|AC092698.11| Homo sapiens chromosome 8, clone RP11-813M16, complete sequence
          Length = 110085

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatttttgtactagatgttgt 37
             |||||||||||||||||||||
Sbjct: 90662 aatttttgtactagatgttgt 90682



to top

>dbj|AP000391.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0538C01
          Length = 155643

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 77    atgaactagtatgatccatga 97
             |||||||||||||||||||||
Sbjct: 79335 atgaactagtatgatccatga 79355



to top

>ref|XM_751953.1| Ustilago maydis 521 hypothetical protein (UM00899.1) partial mRNA
          Length = 4335

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  ctacctgctgctgctggaac 201
            ||||||||||||||||||||
Sbjct: 1663 ctacctgctgctgctggaac 1644



to top

>emb|CR974429.7| Mouse DNA sequence from clone RP23-177B9 on chromosome 12, complete
              sequence
          Length = 212593

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 59     acagaatcaagagaacaaat 78
              ||||||||||||||||||||
Sbjct: 180735 acagaatcaagagaacaaat 180716



to top

>ref|XM_382491.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG02315.1)
           partial mRNA
          Length = 22800

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 178 ccagctacctgctgctgctg 197
           ||||||||||||||||||||
Sbjct: 7   ccagctacctgctgctgctg 26



to top

>gb|AC121918.3| Mus musculus BAC clone RP24-195D23 from chromosome 2, complete sequence
          Length = 179270

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 168    ttactccccaccagctacctgctgctgctgga 199
              |||||||||||||  |||||||| ||||||||
Sbjct: 135084 ttactccccaccatgtacctgctcctgctgga 135053



to top

>gb|AC122191.4| Mus musculus BAC clone RP23-42J4 from 6, complete sequence
          Length = 250147

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 60     cagaatcaagagaacaaatg 79
              ||||||||||||||||||||
Sbjct: 156684 cagaatcaagagaacaaatg 156703



to top

>gb|BC094061.1| Mus musculus basic helix-loop-helix domain containing, class B, 8,
           mRNA (cDNA clone MGC:102506 IMAGE:4165423), complete cds
          Length = 3487

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 178 ccagctacctgctgctgctg 197
           ||||||||||||||||||||
Sbjct: 606 ccagctacctgctgctgctg 587



to top

>gb|BC011486.1| Mus musculus basic helix-loop-helix domain containing, class B, 8,
           mRNA (cDNA clone MGC:19046 IMAGE:4189225), complete cds
          Length = 3472

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 178 ccagctacctgctgctgctg 197
           ||||||||||||||||||||
Sbjct: 580 ccagctacctgctgctgctg 561



to top

>ref|NM_010800.3| Mus musculus basic helix-loop-helix domain containing, class B, 8
           (Bhlhb8), mRNA
          Length = 3520

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 178 ccagctacctgctgctgctg 197
           ||||||||||||||||||||
Sbjct: 630 ccagctacctgctgctgctg 611



to top

>dbj|AK020643.1| Mus musculus adult male urinary bladder cDNA, RIKEN full-length
           enriched library, clone:9530075I17 product:muscle,
           intestine and stomach expression 1, full insert sequence
          Length = 1026

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 178 ccagctacctgctgctgctg 197
           ||||||||||||||||||||
Sbjct: 589 ccagctacctgctgctgctg 570



to top

>dbj|BS000215.2| Pan troglodytes chromosome 22 clone:RP43-183P07, map 22, complete
             sequences
          Length = 151501

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    cttctgaatttttgtactag 30
             ||||||||||||||||||||
Sbjct: 52643 cttctgaatttttgtactag 52662



to top

>gb|AF091858.1|AF091858 Mus musculus myogenic repressor MIST1 (Mist1) gene, complete cds
          Length = 2128

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 178  ccagctacctgctgctgctg 197
            ||||||||||||||||||||
Sbjct: 1858 ccagctacctgctgctgctg 1839



to top

>gb|AC155330.3| Mus musculus 6 BAC RP24-146L23 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 215602

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 77    atgaactagtatgatccatg 96
             ||||||||||||||||||||
Sbjct: 99425 atgaactagtatgatccatg 99406



to top

>dbj|AP001698.1| Homo sapiens genomic DNA, chromosome 21q, section 42/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 11     cttctgaatttttgtactag 30
              ||||||||||||||||||||
Sbjct: 289026 cttctgaatttttgtactag 289045



to top

>gb|AE016830.1| Enterococcus faecalis V583, complete genome
          Length = 3218031

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 5       ataagacttctgaatttttg 24
               ||||||||||||||||||||
Sbjct: 1799866 ataagacttctgaatttttg 1799885



to top

>gb|AC121845.3| Mus musculus BAC clone RP24-82B23 from 5, complete sequence
          Length = 217530

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   ccagctacctgctgctgctg 197
             ||||||||||||||||||||
Sbjct: 68462 ccagctacctgctgctgctg 68481



to top

>emb|AL732541.11| Mouse DNA sequence from clone RP23-306D20 on chromosome 2, complete
              sequence
          Length = 213918

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 168    ttactccccaccagctacctgctgctgctgga 199
              |||||||||||||  |||||||| ||||||||
Sbjct: 180262 ttactccccaccatgtacctgctcctgctgga 180293



to top

>dbj|AP001603.1| Homo sapiens genomic DNA, chromosome 21, clone:KB1411F11, APP-D21S292
              region, complete sequence
          Length = 155767

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 11     cttctgaatttttgtactag 30
              ||||||||||||||||||||
Sbjct: 119147 cttctgaatttttgtactag 119166


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,229,136
Number of Sequences: 3902068
Number of extensions: 3229136
Number of successful extensions: 61367
Number of sequences better than 10.0: 35
Number of HSP's better than 10.0 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61292
Number of HSP's gapped (non-prelim): 75
length of query: 285
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 263
effective length of database: 17,147,199,772
effective search space: 4509713540036
effective search space used: 4509713540036
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top