ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet99f03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 92 1e-15
2ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 88 2e-14
3ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 88 2e-14
4ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 88 2e-14
5ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 88 2e-14
6gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 88 2e-14
7gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 88 2e-14
8gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 88 2e-14
9gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 88 2e-14
10gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 88 2e-14
11gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 88 2e-14
12gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 88 2e-14
13gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 88 2e-14
14gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 88 2e-14
15gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 88 2e-14
16gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 88 2e-14
17gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 88 2e-14
18gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 88 2e-14
19emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 88 2e-14
20emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co... 88 2e-14
21emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 88 2e-14
22emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 88 2e-14
23emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 88 2e-14
24emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 88 2e-14
25ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 84 3e-13
26emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 84 3e-13
27dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
28dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
29dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
30dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
31emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 84 3e-13
32emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 84 3e-13
33dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
34dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
35gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete se... 80 4e-12
36gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 80 4e-12
37ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 78 2e-11
38gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 78 2e-11
39gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 78 2e-11
40dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 78 2e-11
41dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 2e-11
42dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 2e-11
43dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 2e-11
44dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 2e-11
45gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 78 2e-11
46gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 78 2e-11
47gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 76 7e-11
48gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 76 7e-11
49emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 76 7e-11
50dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 76 7e-11
51dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 76 7e-11
52dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 76 7e-11
53dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 76 7e-11
54emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 76 7e-11
55dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 7e-11
56dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 7e-11
57dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 7e-11
58dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 7e-11
59dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 7e-11
60dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 7e-11
61dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 7e-11
62gb|AY109324.1| Zea mays CL187_1 mRNA sequence 76 7e-11
63gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 76 7e-11
64dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 76 7e-11
65gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 74 3e-10
66emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 74 3e-10
67emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 74 3e-10
68emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 72 1e-09
69emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 72 1e-09
70dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 72 1e-09
71emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 72 1e-09
72emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr... 72 1e-09
73gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 72 1e-09
74emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 70 4e-09
75emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 68 2e-08
76emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 68 2e-08
77gb|AY112240.1| Zea mays CL187_6 mRNA sequence 68 2e-08
78gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 68 2e-08
79gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-... 68 2e-08
80dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 66 7e-08
81emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 66 7e-08
82ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 64 3e-07
83gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 64 3e-07
84gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 64 3e-07
85gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 64 3e-07
86gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 64 3e-07
87gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 64 3e-07
88gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 64 3e-07
89emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Co... 64 3e-07
90emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 64 3e-07
91gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 64 3e-07
92gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 64 3e-07
93emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 64 3e-07
94gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 62 1e-06
95gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 60 4e-06
96emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 60 4e-06
97emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 60 4e-06
98gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 60 4e-06
99gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 60 4e-06
100gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-... 60 4e-06
101gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophy... 60 4e-06
102dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 60 4e-06
103ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 58 2e-05
104gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 58 2e-05
105gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 58 2e-05
106gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 58 2e-05
107gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 58 2e-05
108gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 58 2e-05
109emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
110gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 58 2e-05
111gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 58 2e-05
112emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 58 2e-05
113emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 58 2e-05
114gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 58 2e-05
115gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein... 58 2e-05
116ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 56 6e-05
117ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 56 6e-05
118gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 56 6e-05
119gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 56 6e-05
120gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 56 6e-05
121gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 56 6e-05
122gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 56 6e-05
123gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 56 6e-05
124gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 56 6e-05
125gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 56 6e-05
126gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 56 6e-05
127gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 56 6e-05
128gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 56 6e-05
129emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 56 6e-05
130emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 56 6e-05
131gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 56 6e-05
132gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 56 6e-05
133gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 56 6e-05
134emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 54 3e-04
135gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl... 52 0.001
136gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 52 0.001
137gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 50 0.004
138emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 50 0.004
139emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 50 0.004
140emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 50 0.004
141emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 50 0.004
142gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 50 0.004
143gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 50 0.004
144dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 50 0.004
145emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 48 0.016
146dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 48 0.016
147emb|X16535.1|GMCAB4 G.max DNA for Cab4 48 0.016
148gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 48 0.016
149gb|M15214.1|TOMCBPH Tomato chlorophyll a/b-binding protein gene ... 48 0.016
150gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 48 0.016
151dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 48 0.016
152gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b... 46 0.062
153dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 46 0.062
154gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 46 0.062
155gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protei... 44 0.24
156gb|AF082693.1|AF082693 Fundulus heteroclitus clone FHGA7 lactate... 44 0.24
157gb|AF082692.1|AF082692 Fundulus heteroclitus clone FHGA6 lactate... 44 0.24
158emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 44 0.24
159gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 44 0.24
160gb|U59854.1|FHU59854 Fundulus heteroclitus lactate dehydrogenase... 44 0.24
161gb|U59853.1|FHU59853 Fundulus heteroclitus lactate dehydrogenase... 44 0.24
162gb|U59843.1|FHU59843 Fundulus heteroclitus lactate dehydrogenase... 44 0.24
163gb|U59841.1|FHU59841 Fundulus heteroclitus lactate dehydrogenase... 44 0.24
164gb|U59837.1|FHU59837 Fundulus heteroclitus lactate dehydrogenase... 44 0.24
165gb|U59836.1|FHU59836 Fundulus heteroclitus lactate dehydrogenase... 44 0.24
166gb|U59835.1|FHU59835 Fundulus heteroclitus lactate dehydrogenase... 44 0.24
167gb|U59834.1|FHU59834 Fundulus heteroclitus lactate dehydrogenase... 44 0.24
168gb|U59833.1|FHU59833 Fundulus heteroclitus lactate dehydrogenase... 44 0.24
169gb|AC147462.2| Oryza sativa (japonica cultivar-group) chromosome... 42 0.96
170gb|U49830.2| Caenorhabditis elegans cosmid C33F10, complete sequ... 42 0.96
171dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.96
172emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 42 0.96
173emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 42 0.96
174gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding prot... 42 0.96
175dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 42 0.96
176emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll... 42 0.96
177gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene ... 42 0.96
178gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-... 42 0.96
179dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 42 0.96
180dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 42 0.96
181ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll bindi... 40 3.8
182ref|XM_468295.1| Oryza sativa (japonica cultivar-group), mRNA 40 3.8
183gb|AE014851.1| Plasmodium falciparum 3D7 chromosome 12, section ... 40 3.8
184gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence 40 3.8
185gb|AC135915.2| Oryza sativa (japonica cultivar-group) chromosome... 40 3.8
186gb|AC122805.4| Mus musculus BAC clone RP23-296O23 from 3, comple... 40 3.8
187gb|AY177248.1| Oryctolagus cuniculus whey acidic protein (WAP) g... 40 3.8
188gb|AC112800.6| Rattus norvegicus X BAC CH230-275F1 (Children's H... 40 3.8
189emb|CR937191.1| Single read from an extremity of a cDNA clone ma... 40 3.8
190emb|CR354438.9| Zebrafish DNA sequence from clone CH211-243G16 i... 40 3.8
191emb|BX276114.6| Zebrafish DNA sequence from clone CH211-176L11 i... 40 3.8
192gb|AC154642.2| Mus musculus BAC clone RP23-277C14 from chromosom... 40 3.8
193gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 40 3.8
194gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 40 3.8
195gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 40 3.8
196gb|AC069158.6| Genomic Sequence for Oryza sativa, Nipponbare str... 40 3.8
197emb|BX470077.5| Zebrafish DNA sequence from clone CH211-136P17 i... 40 3.8
198gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds 40 3.8
199emb|BX322622.10| Zebrafish DNA sequence from clone DKEYP-14D3 in... 40 3.8
200gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chl... 40 3.8
201dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.8
202gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete se... 40 3.8
203gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA... 40 3.8
204gb|AC079384.26| Homo sapiens 12 BAC RP11-148B3 (Roswell Park Can... 40 3.8
205dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete ge... 40 3.8
206dbj|AP004153.3| Oryza sativa (japonica cultivar-group) genomic D... 40 3.8
207dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 3.8
208dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 40 3.8
209emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 40 3.8
210dbj|AK107867.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 3.8
211dbj|AK106379.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 3.8
212emb|BX248242.5| Zebrafish DNA sequence from clone BUSM1-205D10 i... 40 3.8
213emb|AL691516.5| Zebrafish DNA sequence from clone BUSM1-116L04 i... 40 3.8
214gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding prote... 40 3.8
215gb|AC132143.3| Mus musculus BAC clone RP23-20J10 from 3, complet... 40 3.8
216dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 40 3.8
217dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 40 3.8
218dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 40 3.8

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||||||||||| ||||||||||| || |||||||||| ||||
Sbjct: 864 ccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcgaggtgg 805

                         
Query: 276 tcgaagaggttctc 289
           |||  |||||||||
Sbjct: 804 tcggcgaggttctc 791



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Plus

                                                                        
Query: 214  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
            |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 2490 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 2549

                            
Query: 274  ggtcgaagaggttctc 289
            |||||  |||||||||
Sbjct: 2550 ggtcggcgaggttctc 2565



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Plus

                                                                        
Query: 214  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
            |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 2490 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 2549

                            
Query: 274  ggtcgaagaggttctc 289
            |||||  |||||||||
Sbjct: 2550 ggtcggcgaggttctc 2565



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 848 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 789

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 788 ggtcggcgaggttctc 773



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 806 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 747

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 746 ggtcggcgaggttctc 731



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 734

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 733 ggtcggcgaggttctc 718



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 848 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 789

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 788 ggtcggcgaggttctc 773



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Plus

                                                                         
Query: 214   ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
             |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 93208 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 93267

                             
Query: 274   ggtcgaagaggttctc 289
             |||||  |||||||||
Sbjct: 93268 ggtcggcgaggttctc 93283



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                              
Query: 214   ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
             |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 96100 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 96052



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                         
Query: 214   ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
             |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 80994 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 80935

                             
Query: 274   ggtcgaagaggttctc 289
             |||||  |||||||||
Sbjct: 80934 ggtcggcgaggttctc 80919



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                              
Query: 214   ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
             |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 78102 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 78150



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 734

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 733 ggtcggcgaggttctc 718



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 734

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 733 ggtcggcgaggttctc 718



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 734

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 733 ggtcggcgaggttctc 718



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 784 ggtcggcgaggttctc 769



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 784 ggtcggcgaggttctc 769



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 784 ggtcggcgaggttctc 769



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 784 ggtcggcgaggttctc 769



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 784 ggtcggcgaggttctc 769



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 784 ggtcggcgaggttctc 769



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 825 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggcaaaat 766

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 765 ggtcggcgaggttctc 750



to top

>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 291

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 164 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 105

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 104 ggtcggcgaggttctc 89



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 825 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 766

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 765 ggtcggcgaggttctc 750



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 828 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 769

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 768 ggtcggcgaggttctc 753



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Plus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 91  ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 150

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 151 ggtcggcgaggttctc 166



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
            protein
          Length = 1405

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                        
Query: 214  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
            |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 1093 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 1034

                            
Query: 274  ggtcgaagaggttctc 289
            |||||  |||||||||
Sbjct: 1033 ggtcggcgaggttctc 1018



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 779 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 720

                         
Query: 276 tcgaagaggttctc 289
           |||  |||||||||
Sbjct: 719 tcggcgaggttctc 706



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                        
Query: 216  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
            |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 1240 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 1181

                          
Query: 276  tcgaagaggttctc 289
            |||  |||||||||
Sbjct: 1180 tcggcgaggttctc 1167



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                            
Query: 216      ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
                |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 23604322 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 23604263

                              
Query: 276      tcgaagaggttctc 289
                |||  |||||||||
Sbjct: 23604262 tcggcgaggttctc 23604249



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                            
Query: 216      ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
                |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 30025128 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 30025069

                   
Query: 276      tcg 278
                |||
Sbjct: 30025068 tcg 30025066



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                         
Query: 216   ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
             |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 67021 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 66962

                           
Query: 276   tcgaagaggttctc 289
             |||  |||||||||
Sbjct: 66961 tcggcgaggttctc 66948



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 850 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 791

                         
Query: 276 tcgaagaggttctc 289
           |||  |||||||||
Sbjct: 790 tcggcgaggttctc 777



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 849 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 790

                         
Query: 276 tcgaagaggttctc 289
           |||  |||||||||
Sbjct: 789 tcggcgaggttctc 776



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                        
Query: 216  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
            |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 1279 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 1220

                          
Query: 276  tcgaagaggttctc 289
            |||  |||||||||
Sbjct: 1219 tcggcgaggttctc 1206



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                        
Query: 216  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
            |||||| |||||||||||||| ||||||| ||||||||||| |||||||| |||||||||
Sbjct: 1673 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtcagcgatgtgg 1614

              
Query: 276  tc 277
            ||
Sbjct: 1613 tc 1612



to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 379 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 320

                         
Query: 276 tcgaagaggttctc 289
           |||  |||||||||
Sbjct: 319 tcggcgaggttctc 306



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 857 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 798

                         
Query: 276 tcgaagaggttctc 289
           ||||  ||||||||
Sbjct: 797 tcgagcaggttctc 784



to top

>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence
          Length = 124732

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                        
Query: 214  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
            |||||||| | ||||| |||||||||||||| ||||||||||| |||||||| |||||||
Sbjct: 8576 ttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtcagcgatgt 8635

                
Query: 274  ggtc 277
            ||||
Sbjct: 8636 ggtc 8639



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 225  aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtc 277
            ||||| ||||| |||||||| |||||| |||| ||||| || |||||||||||
Sbjct: 2057 aagtttgtggcaaaggcccaagcgttgctgttgactggatcagcgatgtggtc 2005



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| | ||||| ||||| |||||||| ||||||||||| || ||||| | ||| |
Sbjct: 212 ttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtcagtgatat 153

                
Query: 274 ggtcg 278
           |||||
Sbjct: 152 ggtcg 148



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||| ||||||| ||||||||||| |||||||| || | ||
Sbjct: 845 ttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtcagcaaggt 786

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 785 ggtcggcgaggttctc 770



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 791 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 732

              
Query: 276 tcg 278
           |||
Sbjct: 731 tcg 729



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 223 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 282
           |||||||||||||||||||||| ||||||||||| || ||||||| || |||||||  ||
Sbjct: 850 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggagaggtggtcggcga 791

                  
Query: 283 ggttctc 289
           |||||||
Sbjct: 790 ggttctc 784



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Plus

                                                                         
Query: 216   ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
             |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 13883 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 13942

                
Query: 276   tcg 278
             |||
Sbjct: 13943 tcg 13945



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                         
Query: 216   ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
             |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 21118 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 21059

                
Query: 276   tcg 278
             |||
Sbjct: 21058 tcg 21056



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 872 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 813

              
Query: 276 tcg 278
           |||
Sbjct: 812 tcg 810



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 872 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 813

              
Query: 276 tcg 278
           |||
Sbjct: 812 tcg 810



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 874 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 815

              
Query: 276 tcg 278
           |||
Sbjct: 814 tcg 812



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 874 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 815

              
Query: 276 tcg 278
           |||
Sbjct: 814 tcg 812



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                   
Query: 216  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 270
            |||||| |||||||||||||||||||||| ||||||||||| || ||||||||||
Sbjct: 1188 ccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcga 1134



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                        
Query: 216  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
            |||||| |||||||||||||||||||||| |||||||||   || |||||||||||||||
Sbjct: 1527 ccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggcgatgtgg 1468

               
Query: 276  tcg 278
            |||
Sbjct: 1467 tcg 1465



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                         
Query: 216   ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
             |||||| |||||||||||||| | ||||| |||||||||   || |||||||||| ||||
Sbjct: 78979 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 79038

                           
Query: 276   tcgaagaggttctc 289
             ||||||||||||||
Sbjct: 79039 tcgaagaggttctc 79052



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                            
Query: 216      ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
                |||||| |||||||||||||| | ||||| |||||||||   || |||||||||| ||||
Sbjct: 21808837 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 21808778

                              
Query: 276      tcgaagaggttctc 289
                ||||||||||||||
Sbjct: 21808777 tcgaagaggttctc 21808764



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 216  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
            |||||| |||||||||||||| ||||||| ||||||||||| || |||||||| ||||||
Sbjct: 1803 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatgtgg 1744

              
Query: 276  tc 277
            ||
Sbjct: 1743 tc 1742



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                            
Query: 216      ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
                |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| ||||
Sbjct: 10793775 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 10793716

                              
Query: 276      tcgaagaggttctc 289
                |||  |||||||||
Sbjct: 10793715 tcggcgaggttctc 10793702



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                            
Query: 216      ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
                |||||| |||||||||||||| | ||||| |||||||||   || |||||||||| ||||
Sbjct: 21801866 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 21801807

                              
Query: 276      tcgaagaggttctc 289
                ||||||||||||||
Sbjct: 21801806 tcgaagaggttctc 21801793



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                         
Query: 216   ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
             |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| ||||
Sbjct: 17498 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 17439

                           
Query: 276   tcgaagaggttctc 289
             |||  |||||||||
Sbjct: 17438 tcggcgaggttctc 17425



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                          
Query: 216    ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
              |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| ||||
Sbjct: 130393 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 130334

                            
Query: 276    tcgaagaggttctc 289
              |||  |||||||||
Sbjct: 130333 tcggcgaggttctc 130320



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||||| ||||||
Sbjct: 855 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatgtgg 796

             
Query: 276 tc 277
           ||
Sbjct: 795 tc 794



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| ||||
Sbjct: 843 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 784

                         
Query: 276 tcgaagaggttctc 289
           |||  |||||||||
Sbjct: 783 tcggcgaggttctc 770



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| ||||
Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 789

                         
Query: 276 tcgaagaggttctc 289
           |||  |||||||||
Sbjct: 788 tcggcgaggttctc 775



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| ||||
Sbjct: 850 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 791

                         
Query: 276 tcgaagaggttctc 289
           |||  |||||||||
Sbjct: 790 tcggcgaggttctc 777



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| | ||||| |||||||||   || |||||||||| ||||
Sbjct: 836 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 777

                         
Query: 276 tcgaagaggttctc 289
           ||||||||||||||
Sbjct: 776 tcgaagaggttctc 763



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| ||||
Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 789

                         
Query: 276 tcgaagaggttctc 289
           |||  |||||||||
Sbjct: 788 tcggcgaggttctc 775



to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| | ||||| |||||||||   || |||||||||| ||||
Sbjct: 411 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 352

                         
Query: 276 tcgaagaggttctc 289
           ||||||||||||||
Sbjct: 351 tcgaagaggttctc 338



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| ||||
Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 789

                         
Query: 276 tcgaagaggttctc 289
           |||  |||||||||
Sbjct: 788 tcggcgaggttctc 775



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 216  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
            |||||| |||||||||||||| ||||||| ||||||||||| || |||||||| ||||||
Sbjct: 1803 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatgtgg 1744

              
Query: 276  tc 277
            ||
Sbjct: 1743 tc 1742



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| | ||||| |||||||||   || |||||||||| ||||
Sbjct: 825 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 766

                         
Query: 276 tcgaagaggttctc 289
           ||||||||||||||
Sbjct: 765 tcgaagaggttctc 752



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| ||||
Sbjct: 829 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 770

                         
Query: 276 tcgaagaggttctc 289
           |||  |||||||||
Sbjct: 769 tcggcgaggttctc 756



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
           |||||||| |||||||||||||||||||||| ||||||||||| |||||
Sbjct: 627 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactgg 579



to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                             
Query: 214  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
            |||||||| |||||||||||||||||||||| ||||||||||| |||||
Sbjct: 2371 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactgg 2323



to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                             
Query: 214  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
            |||||||| |||||||||||||||||||||| ||||||||||| |||||
Sbjct: 2372 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactgg 2324



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||||||||||||| ||||||| ||||||||||  ||||||||||| |  |
Sbjct: 835 ttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggccaaat 776

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 775 ggtcggcgaggttctc 760



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 67/76 (88%), Gaps = 1/76 (1%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| |||| ||||||||||||||||| ||||||||||| ||||||||||| |  |
Sbjct: 827 ttccggggacgaa-ttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 769

                           
Query: 274 ggtcgaagaggttctc 289
           |||||  |||||||||
Sbjct: 768 ggtcggcgaggttctc 753



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 223 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcg 278
           |||||||||||||||||||||| ||||||||||| || ||||| |||| |||||||
Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtggtcg 640



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| ||||||| ||||| || ||||| ||||||||||| || |||||||||||||||
Sbjct: 812 ccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcggcgatgtgg 753

                           
Query: 276 tcgaagaggttctcaa 291
           ||   |||||||||||
Sbjct: 752 tcagcgaggttctcaa 737



to top

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
           |||||||| |||||||||| ||||||||||| ||||||||||| ||||||||
Sbjct: 370 ttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtc 319



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| | |||||||||||||| ||||| || |||||||| || |||||||||||||||
Sbjct: 803 ccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgatgtgg 744

                           
Query: 276 tcgaagaggttctcaa 291
           ||   |||||||||||
Sbjct: 743 tcagcgaggttctcaa 728



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 270
           |||||| |||||||||||||||||||||| || |||||||| || ||||||||||
Sbjct: 968 ccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggcga 914



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                        
Query: 216  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
            |||||| |||||||||||||| | ||||| ||||||||||| || ||||||| || ||||
Sbjct: 2714 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggtgaggtgg 2655

                          
Query: 276  tcgaagaggttctc 289
            |||  |||||||||
Sbjct: 2654 tcggcgaggttctc 2641



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| ||||||| |||||| | ||||| |||||||||   || |||||||||| ||||
Sbjct: 821 ccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 762

                         
Query: 276 tcgaagaggttctc 289
           ||||||||||||||
Sbjct: 761 tcgaagaggttctc 748



to top

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| ||||||| |||||| | ||||| |||||||||   || |||||||||| ||||
Sbjct: 469 ccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 410

                         
Query: 276 tcgaagaggttctc 289
           ||||||||||||||
Sbjct: 409 tcgaagaggttctc 396



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| | |||||||||||| ||||||| ||||||||||| || |||||||||| ||||
Sbjct: 833 ccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 774

             
Query: 276 tc 277
           ||
Sbjct: 773 tc 772



to top

>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end
          Length = 351

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcg 278
           ||||| ||||| |||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 335 aagtttgtggcaaaggcccaggcgttgttgttaactgggtcggcaatgtggtcg 282



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||| |||||||||||||| ||||||| || ||||||||||| ||||||||
Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggc 840



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 284
           |||||||||||  ||||||| ||||||||||| || |||||||||| |||||||  ||||
Sbjct: 794 aagttggtggcataggcccatgcgttgttgttgacggggtcggcgaggtggtcggcgagg 735

                
Query: 285 ttctc 289
           |||||
Sbjct: 734 ttctc 730



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 616 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 573



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 788 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 745



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811



to top

>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS20ZE02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 307

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 158 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 115



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 823 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 780



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 734 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 691



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 225   aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
             |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 16127 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 16170



 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 225   aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
             |||||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 22526 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 22483



 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 225   aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
             ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 19880 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 19837



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 225  aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
            |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 1005 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 962



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 223 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
           |||||||||||||||||||||| || |||||||| ||||||||
Sbjct: 814 cgaagttggtggcgaaggcccaagcattgttgttgactgggtc 772



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||
Sbjct: 857 ccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtc 808



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||
Sbjct: 866 ccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtc 817



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||| ||||||||| ||||||| || ||||||||||| |||||||| | ||| 
Sbjct: 885 ccggggacgaaattggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 826

                         
Query: 276 tcgaagaggttctc 289
           |||  |||||||||
Sbjct: 825 tcggcgaggttctc 812



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| | ||||| |||||||||   || ||||| ||||  |||
Sbjct: 571 ccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcagcgacatgg 512

                         
Query: 276 tcgaagaggttctc 289
           ||||||||||||||
Sbjct: 511 tcgaagaggttctc 498



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
           |||||| |||||||||||||| ||||||| || |||||||| ||||||||
Sbjct: 816 ccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtc 767



to top

>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end
          Length = 351

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcg 278
           ||||| ||||| |||||||| ||||||||||| |||||||| || |||||||||
Sbjct: 335 aagtttgtggcaaaggcccaggcgttgttgttaactgggtcagcaatgtggtcg 282



to top

>gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophyll A/B binding  protein
           mRNA, partial cds
          Length = 191

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| ||||||| |||||| | ||||| |||||||||   || |||||||  | ||||
Sbjct: 103 ccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggssacgtgg 44

                         
Query: 276 tcgaagaggttctc 289
           ||||||||||||||
Sbjct: 43  tcgaagaggttctc 30



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 275
           |||||| |||||||||||||| | | ||| |||||||||   || ||||||| || ||||
Sbjct: 817 ccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcggtgacgtgg 758

                         
Query: 276 tcgaagaggttctc 289
           ||||||||||||||
Sbjct: 757 tcgaagaggttctc 744



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 810



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 796 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 748



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 810



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 810



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
           |||||||| ||||||||||||| |||||||| || |||||||| |||||
Sbjct: 838 ttccggggacgaagttggtggcaaaggcccatgcattgttgttgactgg 790



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 864 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 816



to top

>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 516 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 468



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 810



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 284
           |||||||||||| ||||||| ||||||||||| || |||||||| | ||| |||  ||||
Sbjct: 835 aagttggtggcgtaggcccaggcgttgttgttgacagggtcggcaaggtgatcggcgagg 776

                
Query: 285 ttctc 289
           |||||
Sbjct: 775 ttctc 771



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
            binding protein
          Length = 1301

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 214  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
            |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 1096 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 1048



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 284
           |||||||||||| ||||||| ||||||||||| || ||||| |||| ||| |||  ||||
Sbjct: 822 aagttggtggcgtaggcccaggcgttgttgttgacagggtcagcgaggtgatcggcgagg 763

                
Query: 285 ttctc 289
           |||||
Sbjct: 762 ttctc 758



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 796 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 748



to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||| |||||||||||||| | ||||| ||||||||||| || ||||||||
Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggc 337



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 841 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 855 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 812



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 746 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 703



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 841 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 798



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 841 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 798



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 788 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 745



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 788 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 841 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 840 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 797



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 788 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 834 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 791



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 840 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 797



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 855 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 812



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 994 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 951



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 933 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 890



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||||||  ||||||| ||||||||||| |||||||||||
Sbjct: 836 aagttggtggcataggcccatgcgttgttgttgactgggtcggc 793



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||| |||||||||||||| || |||||||| |||||||||||
Sbjct: 800 aagtttgtggcgaaggcccaagcattgttgttaactgggtcggc 757



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 223 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcg 278
           ||||||||||||| | |  ||||||||||||||| || |||||||| |||||||||
Sbjct: 987 cgaagttggtggcaatgagccacgcgttgttgttgacagggtcggcaatgtggtcg 932



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 214  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgtt 256
            |||||||| |||||||||||||  ||||||| |||||||||||
Sbjct: 1037 ttccggggacgaagttggtggcataggcccaggcgttgttgtt 995



to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 223 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||||||||||  ||||||| ||||||||||| || ||||||||
Sbjct: 275 cgaagttggtggcataggcccaggcgttgttgttaacggggtcggc 230



to top

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcg 278
           ||||| ||||| |||||||| ||||||||||| |||||||| || | |||||||
Sbjct: 823 aagtttgtggcaaaggcccaagcgttgttgttaactgggtcagcaaggtggtcg 770



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
           ||||||||||| || ||||| ||||||||||| ||||||||
Sbjct: 837 aagttggtggcaaaagcccaggcgttgttgttgactgggtc 797



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           |||||| |||||||||||||  ||||||| ||||||||| | || ||||||||
Sbjct: 881 ccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggc 829



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 223 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 282
           ||||||||||||| |||||||| || |||||   ||||||||| || | ||||||  |||
Sbjct: 859 cgaagttggtggcaaaggcccaggcattgttagccactgggtcagcaaggtggtctgaga 800

                    
Query: 283 ggttctcaa 291
           |||||||||
Sbjct: 799 ggttctcaa 791



to top

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 273
           |||||||| | |||||||||||| ||| ||| || |||||||| |||||||| || | ||
Sbjct: 866 ttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtcagcaaggt 807

                
Query: 274 ggtcg 278
           |||||
Sbjct: 806 ggtcg 802



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 216  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
            |||||| |||||||||||||  ||||||| ||||||||| | || ||||||||
Sbjct: 1959 ccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggc 1907



to top

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
           |||||||| | |||||||||||  ||||||| || ||||||||||||||
Sbjct: 819 ttccggggacaaagttggtggcataggcccatgcattgttgttcactgg 771



to top

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 214  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 270
            |||||||| | ||||| |||||||||||||| || ||||| || |||||||| ||||
Sbjct: 1001 ttccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtcagcga 945



to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 254
           |||||||  |||||||||||||| ||||||| |||||||||
Sbjct: 841 ttccgggaacgaagttggtggcgtaggcccaggcgttgttg 801



to top

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 40/44 (90%), Gaps = 1/44 (2%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 825 aagttggtggc-aaggcccaagcgttgttgttgactggatcggc 783



to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 223  cgaagttggtggcgaaggcccacgcgttgttg 254
            |||||||||||||| ||||||| |||||||||
Sbjct: 3010 cgaagttggtggcgtaggcccatgcgttgttg 2979



to top

>emb|X16535.1|GMCAB4 G.max DNA for Cab4
          Length = 1470

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 214  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
            |||||||| | ||||| |||||  ||||||| || |||||||||||||||||
Sbjct: 1120 ttccggggacaaagtttgtggcataggcccaagcattgttgttcactgggtc 1069



to top

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
           |||||||| | ||||| |||||||| ||||| ||||||||||| || |||||
Sbjct: 793 ttccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtc 742



to top

>gb|M15214.1|TOMCBPH Tomato chlorophyll a/b-binding protein gene Cab-3T, complete cds
          Length = 339

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||| ||||| ||||||||  |||||||||| |||||||||||
Sbjct: 323 aagtttgtggcaaaggcccagacgttgttgttaactgggtcggc 280



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
           |||||||| | |||||||||||  ||||||| || |||||||| ||||||||
Sbjct: 987 ttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtc 936



to top

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 238  aggcccacgcgttgttgttcactgggtcggcgatgtggtc 277
            ||||||| ||||||||||| ||||||||||| | ||||||
Sbjct: 2225 aggcccaagcgttgttgttaactgggtcggcaaggtggtc 2186



to top

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score = 46.1 bits (23), Expect = 0.062
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 270
           |||||| | ||||||||||| || ||||| || |||||||| || ||||||||||
Sbjct: 465 ccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggcga 411



to top

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
            protein, complete cds
          Length = 1500

 Score = 46.1 bits (23), Expect = 0.062
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 216  ccgggggcgaagttggtggcgaaggcccacgcgttgttg 254
            ||||||| ||||||||||||| | ||||| |||||||||
Sbjct: 1387 ccgggggtgaagttggtggcgtaagcccaggcgttgttg 1349



to top

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score = 46.1 bits (23), Expect = 0.062
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 246 gcgttgttgttcactgggtcggc 268
           |||||||||||||||||||||||
Sbjct: 651 gcgttgttgttcactgggtcggc 629



to top

>gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protein (Cab) clone pCab4, 3'
           end
          Length = 387

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcg 278
           ||||| |||||| ||| ||| || |||||||| ||||||||||| | |||||||
Sbjct: 380 aagtttgtggcgtaggaccaagcattgttgttaactgggtcggcaaggtggtcg 327



to top

>gb|AF082693.1|AF082693 Fundulus heteroclitus clone FHGA7 lactate dehydrogenase B gene,
           promoter
          Length = 309

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 92  tcgatgatgatgatacaaataa 113
           ||||||||||||||||||||||
Sbjct: 54  tcgatgatgatgatacaaataa 33



to top

>gb|AF082692.1|AF082692 Fundulus heteroclitus clone FHGA6 lactate dehydrogenase B gene,
           promoter
          Length = 315

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 92  tcgatgatgatgatacaaataa 113
           ||||||||||||||||||||||
Sbjct: 54  tcgatgatgatgatacaaataa 33



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 245 cgcgttgttgttcactgggtcggcgatgtggtcg 278
           |||||||||||| || |||||||| |||||||||
Sbjct: 760 cgcgttgttgttgacagggtcggcaatgtggtcg 727



to top

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 216 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
           ||||| || ||||| || ||||||||||| || |||||||| ||||||||
Sbjct: 853 ccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtc 804



to top

>gb|U59854.1|FHU59854 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1039

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 92  tcgatgatgatgatacaaataa 113
           ||||||||||||||||||||||
Sbjct: 804 tcgatgatgatgatacaaataa 783



to top

>gb|U59853.1|FHU59853 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1041

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 92  tcgatgatgatgatacaaataa 113
           ||||||||||||||||||||||
Sbjct: 806 tcgatgatgatgatacaaataa 785



to top

>gb|U59843.1|FHU59843 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1040

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 92  tcgatgatgatgatacaaataa 113
           ||||||||||||||||||||||
Sbjct: 806 tcgatgatgatgatacaaataa 785



to top

>gb|U59841.1|FHU59841 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1084

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 92  tcgatgatgatgatacaaataa 113
           ||||||||||||||||||||||
Sbjct: 844 tcgatgatgatgatacaaataa 823



to top

>gb|U59837.1|FHU59837 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1042

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 92  tcgatgatgatgatacaaataa 113
           ||||||||||||||||||||||
Sbjct: 808 tcgatgatgatgatacaaataa 787



to top

>gb|U59836.1|FHU59836 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1039

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 92  tcgatgatgatgatacaaataa 113
           ||||||||||||||||||||||
Sbjct: 805 tcgatgatgatgatacaaataa 784



to top

>gb|U59835.1|FHU59835 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1038

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 92  tcgatgatgatgatacaaataa 113
           ||||||||||||||||||||||
Sbjct: 804 tcgatgatgatgatacaaataa 783



to top

>gb|U59834.1|FHU59834 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1037

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 92  tcgatgatgatgatacaaataa 113
           ||||||||||||||||||||||
Sbjct: 802 tcgatgatgatgatacaaataa 781



to top

>gb|U59833.1|FHU59833 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1037

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 92  tcgatgatgatgatacaaataa 113
           ||||||||||||||||||||||
Sbjct: 802 tcgatgatgatgatacaaataa 781



to top

>gb|AC147462.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1110B01,
             complete sequence
          Length = 160142

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 92    tcgatgatgatgatacaaata 112
             |||||||||||||||||||||
Sbjct: 28388 tcgatgatgatgatacaaata 28408



to top

>gb|U49830.2| Caenorhabditis elegans cosmid C33F10, complete sequence
          Length = 46463

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 93    cgatgatgatgatacaaataa 113
             |||||||||||||||||||||
Sbjct: 44151 cgatgatgatgatacaaataa 44171



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 92       tcgatgatgatgatacaaata 112
                |||||||||||||||||||||
Sbjct: 21435305 tcgatgatgatgatacaaata 21435325



 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 177      ccgatggacagacggatggc 196
                ||||||||||||||||||||
Sbjct: 13146461 ccgatggacagacggatggc 13146442



 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 177      ccgatggacagacggatggc 196
                ||||||||||||||||||||
Sbjct: 13143677 ccgatggacagacggatggc 13143658



to top

>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 907

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 40/45 (88%), Gaps = 1/45 (2%)
 Strand = Plus / Plus

                                                        
Query: 225 aagttggtggcgaaggccc-acgcgttgttgttcactgggtcggc 268
           |||||||| |||||||||| | ||||||||||| ||||| |||||
Sbjct: 67  aagttggttgcgaaggccctatgcgttgttgttgactggatcggc 111



to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 225  aagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
            ||||| ||||| ||||||||||| |||||||| || |||||
Sbjct: 1015 aagtttgtggcaaaggcccacgcattgttgttaacggggtc 975



to top

>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102,
           3' end and flank
          Length = 302

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
           ||||| ||||| ||||||||||| |||||||| || |||||
Sbjct: 173 aagtttgtggcaaaggcccacgcattgttgttaacggggtc 133



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 225   aagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
             |||||||||||  ||||||| || |||||||| ||||||||
Sbjct: 65575 aagttggtggcataggcccaggcattgttgttaactgggtc 65615



to top

>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein
          Length = 686

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 262
           |||||||| | |||||||||||  ||||||| || |||||||| |||||
Sbjct: 577 ttccggggacaaagttggtggcataggcccatgcattgttgtttactgg 529



to top

>gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene Cab-1D, complete cds
          Length = 351

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
           ||||| |||||| ||| ||| ||||||||||| ||||||||
Sbjct: 335 aagttagtggcgtaggaccaggcgttgttgtttactgggtc 295



to top

>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end
          Length = 351

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
           ||||| ||||| || ||||| ||||||||||| ||||||||
Sbjct: 335 aagtttgtggcaaaagcccaggcgttgttgtttactgggtc 295



to top

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 225  aagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
            ||||| |||||  ||||||| ||||||||||| ||||||||
Sbjct: 1886 aagtttgtggcataggcccaagcgttgttgttaactgggtc 1926



to top

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 225  aagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
            ||||| |||||| ||| ||| ||||||||||| ||||||||
Sbjct: 2663 aagtttgtggcgtaggaccaggcgttgttgttaactgggtc 2623



to top

>ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll binding AT3G27690
           (LHCB2:4) mRNA, complete cds
          Length = 946

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 253
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 851 ttccggggacgaagttggtggcgtaagcccaagcattgtt 812



to top

>ref|XM_468295.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1412

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 262 ggtcggcgatgtggtcgaagaggt 285
           ||||| ||||||||||||||||||
Sbjct: 101 ggtcgtcgatgtggtcgaagaggt 78



to top

>gb|AE014851.1| Plasmodium falciparum 3D7 chromosome 12, section 8 of 9 of the complete
             sequence
          Length = 251762

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 95    atgatgatgatacaaataaa 114
             ||||||||||||||||||||
Sbjct: 91207 atgatgatgatacaaataaa 91226



to top

>gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence
          Length = 510

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 253
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 404 ttccggggacgaagttggtggcgtaagcccaagcattgtt 365



to top

>gb|AC135915.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
              OSJNBa0082F22, complete sequence
          Length = 176038

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 177    ccgatggacagacggatggc 196
              ||||||||||||||||||||
Sbjct: 109238 ccgatggacagacggatggc 109219



 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 177    ccgatggacagacggatggc 196
              ||||||||||||||||||||
Sbjct: 106454 ccgatggacagacggatggc 106435



to top

>gb|AC122805.4| Mus musculus BAC clone RP23-296O23 from 3, complete sequence
          Length = 202733

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 152   gtacaagtacacatgcatat 171
             ||||||||||||||||||||
Sbjct: 22438 gtacaagtacacatgcatat 22419



to top

>gb|AY177248.1| Oryctolagus cuniculus whey acidic protein (WAP) gene, upstream
           regulatory region
          Length = 2560

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 75  gagggcatctcgctcgctcg 94
           ||||||||||||||||||||
Sbjct: 755 gagggcatctcgctcgctcg 774



to top

>gb|AC112800.6| Rattus norvegicus X BAC CH230-275F1 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 147560

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 94    gatgatgatgatacaaataa 113
             ||||||||||||||||||||
Sbjct: 26076 gatgatgatgatacaaataa 26057



to top

>emb|CR937191.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB2YK24AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 908

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 92  tcgatgatgatgatacaaat 111
           ||||||||||||||||||||
Sbjct: 318 tcgatgatgatgatacaaat 337



to top

>emb|CR354438.9| Zebrafish DNA sequence from clone CH211-243G16 in linkage group 8,
             complete sequence
          Length = 136324

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 98    atgatgatacaaataaacacacaa 121
             ||||||| ||||||||||||||||
Sbjct: 58180 atgatgaaacaaataaacacacaa 58203



to top

>emb|BX276114.6| Zebrafish DNA sequence from clone CH211-176L11 in linkage group 20
              Contains the kit gene for kit receptor, the 3' end of the
              pdgfra gene for platelet derived growth factor receptor
              alpha and a CpG island, complete sequence
          Length = 134212

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 101    atgatacaaataaacacaca 120
              ||||||||||||||||||||
Sbjct: 114632 atgatacaaataaacacaca 114613



to top

>gb|AC154642.2| Mus musculus BAC clone RP23-277C14 from chromosome 14, complete
             sequence
          Length = 211315

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 54    tacattgcgcacagctagggagag 77
             |||||||| |||||||||||||||
Sbjct: 81357 tacattgctcacagctagggagag 81380



to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 218 gggggcgaagttggtggcgaaggcccacgcgttgtt 253
           ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 782 gggggtgaacttggtggcgaaggcgaacgcgttgtt 747



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 218 gggggcgaagttggtggcgaaggcccacgcgttgtt 253
           ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 783 gggggtgaacttggtggcgaaggcgaacgcgttgtt 748



to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 218 gggggcgaagttggtggcgaaggcccacgcgttgtt 253
           ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 777 gggggtgaacttggtggcgaaggcgaacgcgttgtt 742



to top

>gb|AC069158.6| Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0049O12, from chromosome 2, complete sequence
          Length = 155154

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 262   ggtcggcgatgtggtcgaagaggt 285
             ||||| ||||||||||||||||||
Sbjct: 76049 ggtcgtcgatgtggtcgaagaggt 76072



to top

>emb|BX470077.5| Zebrafish DNA sequence from clone CH211-136P17 in linkage group 5,
              complete sequence
          Length = 165851

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 195    gctgctaaacacatttaact 214
              ||||||||||||||||||||
Sbjct: 103691 gctgctaaacacatttaact 103672



to top

>gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds
          Length = 801

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 253
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 796 ttccggggacgaagttggtggcgtaagcccaagcattgtt 757



to top

>emb|BX322622.10| Zebrafish DNA sequence from clone DKEYP-14D3 in linkage group 8, complete
              sequence
          Length = 162365

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 98     atgatgatacaaataaacacacaa 121
              ||||||| ||||||||||||||||
Sbjct: 158836 atgatgaaacaaataaacacacaa 158859



to top

>gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chlorophyll a/b-binding
           protein (MGF10.9) mRNA, complete cds
          Length = 917

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 253
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 845 ttccggggacgaagttggtggcgtaagcccaagcattgtt 806



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 262      ggtcggcgatgtggtcgaagaggt 285
                ||||| ||||||||||||||||||
Sbjct: 34429150 ggtcgtcgatgtggtcgaagaggt 34429127



to top

>gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete sequence
          Length = 917

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 253
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 845 ttccggggacgaagttggtggcgtaagcccaagcattgtt 806



to top

>gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA, complete cds
          Length = 897

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 214 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 253
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 801 ttccggggacgaagttggtggcgtaagcccaagcattgtt 762



to top

>gb|AC079384.26| Homo sapiens 12 BAC RP11-148B3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 180555

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 94    gatgatgatgatacaaataa 113
             ||||||||||||||||||||
Sbjct: 61129 gatgatgatgatacaaataa 61110



to top

>dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete genome
          Length = 3544776

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 8      aatccttccatccattcgct 27
              ||||||||||||||||||||
Sbjct: 519053 aatccttccatccattcgct 519034



to top

>dbj|AP004153.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1111_C07
          Length = 115190

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 262   ggtcggcgatgtggtcgaagaggt 285
             ||||| ||||||||||||||||||
Sbjct: 45392 ggtcgtcgatgtggtcgaagaggt 45369



to top

>dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGF10
          Length = 84702

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                     
Query: 214   ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 253
             |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 31777 ttccggggacgaagttggtggcgtaagcccaagcattgtt 31738



to top

>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 223  cgaagttggtggcgaaggcccacgcgttgttg 254
            |||||||||||||| | ||||| |||||||||
Sbjct: 1838 cgaagttggtggcgtatgcccatgcgttgttg 1807



to top

>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 214  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
            |||||||| | ||||| |||||  ||||||| ||||||||||| || |||||
Sbjct: 1300 ttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtc 1249



to top

>dbj|AK107867.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-134-C03, full
           insert sequence
          Length = 872

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 262 ggtcggcgatgtggtcgaagaggt 285
           ||||| ||||||||||||||||||
Sbjct: 96  ggtcgtcgatgtggtcgaagaggt 73



to top

>dbj|AK106379.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-D09, full
           insert sequence
          Length = 1412

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 262 ggtcggcgatgtggtcgaagaggt 285
           ||||| ||||||||||||||||||
Sbjct: 101 ggtcgtcgatgtggtcgaagaggt 78



to top

>emb|BX248242.5| Zebrafish DNA sequence from clone BUSM1-205D10 in linkage group 20,
             complete sequence
          Length = 104779

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 101   atgatacaaataaacacaca 120
             ||||||||||||||||||||
Sbjct: 10904 atgatacaaataaacacaca 10885



to top

>emb|AL691516.5| Zebrafish DNA sequence from clone BUSM1-116L04 in linkage group 20,
             complete sequence
          Length = 80250

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 101   atgatacaaataaacacaca 120
             ||||||||||||||||||||
Sbjct: 63793 atgatacaaataaacacaca 63774



to top

>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10,
           3' end and flank
          Length = 367

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 225 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 268
           ||||| |||||| ||| ||| ||||||||||| ||||| |||||
Sbjct: 215 aagtttgtggcgtaggaccaagcgttgttgttaactggatcggc 172



to top

>gb|AC132143.3| Mus musculus BAC clone RP23-20J10 from 3, complete sequence
          Length = 205880

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 152    gtacaagtacacatgcatat 171
              ||||||||||||||||||||
Sbjct: 125910 gtacaagtacacatgcatat 125891



to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 218 gggggcgaagttggtggcgaaggcccacgcgttgtt 253
           ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 811 gggggtgaacttggtggcgaaggcgaacgcgttgtt 776



to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-1.3, complete cds
          Length = 1835

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 218  gggggcgaagttggtggcgaaggcccacgcgttgtt 253
            ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 1653 gggggtgaacttggtggcgaaggcgaacgcgttgtt 1618



to top

>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 214  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 265
            |||||||| | ||||| |||||  ||||||| ||||||||||| || |||||
Sbjct: 2703 ttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtc 2652


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,717,815
Number of Sequences: 3902068
Number of extensions: 2717815
Number of successful extensions: 52690
Number of sequences better than 10.0: 218
Number of HSP's better than 10.0 without gapping: 219
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 52259
Number of HSP's gapped (non-prelim): 432
length of query: 291
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 269
effective length of database: 17,147,199,772
effective search space: 4612596738668
effective search space used: 4612596738668
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top