ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet99e05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ000071.1|PCAJ71 Phytophthora cinnamomi elicitin genes 46 0.051
2emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g... 44 0.20
3gb|AC084016.12| Homo sapiens 3 BAC RP11-190F16 (Roswell Park Can... 44 0.20
4dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 44 0.20
5gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete... 44 0.20
6gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co... 44 0.20
7gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, compl... 44 0.20
8gb|AC093771.3| Homo sapiens BAC clone RP11-121I23 from 4, comple... 44 0.20
9dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com... 44 0.20
10dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic... 44 0.20
11emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA2... 44 0.20
12emb|AJ938182.1| Staphylococcus aureus RF122 complete genome 44 0.20
13emb|AJ849350.1| Staphylococcus aureus partial tpi71 gene for tri... 42 0.80
14emb|AJ849348.1| Staphylococcus aureus partial tpi67 gene for tri... 42 0.80
15gb|AC122290.4| Mus musculus BAC clone RP23-254P19 from chromosom... 42 0.80
16emb|CR457441.5| Zebrafish DNA sequence from clone CH211-181D7 in... 42 0.80
17emb|CR713387.2|CNS0GDEF Tetraodon nigroviridis full-length cDNA 42 0.80
18emb|AL353743.22| Human DNA sequence from clone RP11-213G2 on chr... 42 0.80
19emb|AL354733.15| Human DNA sequence from clone RP11-575L7 on chr... 42 0.80
20ref|NM_180181.3| Arabidopsis thaliana DNA binding AT3G04590 tran... 40 3.2
21gb|AC150309.1| Latimeria menadoensis clone VMRC4-39G19, complete... 40 3.2
22emb|CR382378.12| Zebrafish DNA sequence from clone DKEYP-40G12 i... 40 3.2
23emb|AL354771.14| Human DNA sequence from clone RP11-545P21 on ch... 40 3.2
24gb|AC107392.6| Homo sapiens BAC clone RP11-578K15 from 4, comple... 40 3.2
25dbj|AK139392.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 40 3.2
26gb|AC011631.6|AC011631 Homo sapiens, clone RP11-1I20, complete s... 40 3.2
27emb|AL954370.3| Mouse DNA sequence from clone RP23-180P4 on chro... 40 3.2
28gb|AC083816.21|AC083816 Mus musculus X BAC RP23-330G24 (Roswell ... 40 3.2
29emb|BX005219.12| Mouse DNA sequence from clone RP23-343B19 on ch... 40 3.2

>emb|AJ000071.1|PCAJ71 Phytophthora cinnamomi elicitin genes
          Length = 5703

 Score = 46.1 bits (23), Expect = 0.051
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 13   tcacatcacatttgcttggtaaa 35
            |||||||||||||||||||||||
Sbjct: 2302 tcacatcacatttgcttggtaaa 2324



to top

>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 204     acacgcacatcagatgccacac 225
               ||||||||||||||||||||||
Sbjct: 2322170 acacgcacatcagatgccacac 2322149



to top

>gb|AC084016.12| Homo sapiens 3 BAC RP11-190F16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 191524

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 15    acatcacatttgcttggtaaaa 36
             ||||||||||||||||||||||
Sbjct: 51234 acatcacatttgcttggtaaaa 51213



to top

>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 204     acacgcacatcagatgccacac 225
               ||||||||||||||||||||||
Sbjct: 2401383 acacgcacatcagatgccacac 2401362



to top

>gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete genome
          Length = 2809422

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 204     acacgcacatcagatgccacac 225
               ||||||||||||||||||||||
Sbjct: 2330622 acacgcacatcagatgccacac 2330601



to top

>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome
          Length = 2821361

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 204     acacgcacatcagatgccacac 225
               ||||||||||||||||||||||
Sbjct: 2341277 acacgcacatcagatgccacac 2341256



to top

>gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, complete genome
          Length = 2872769

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 204     acacgcacatcagatgccacac 225
               ||||||||||||||||||||||
Sbjct: 2394489 acacgcacatcagatgccacac 2394468



to top

>gb|AC093771.3| Homo sapiens BAC clone RP11-121I23 from 4, complete sequence
          Length = 165420

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 27   cttggtaaaaatcaaacacttt 48
            ||||||||||||||||||||||
Sbjct: 5224 cttggtaaaaatcaaacacttt 5245



to top

>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome, strain:MW2
          Length = 2820462

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 204     acacgcacatcagatgccacac 225
               ||||||||||||||||||||||
Sbjct: 2343065 acacgcacatcagatgccacac 2343044



to top

>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 204     acacgcacatcagatgccacac 225
               ||||||||||||||||||||||
Sbjct: 2331883 acacgcacatcagatgccacac 2331862



to top

>emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA252, complete genome
          Length = 2902619

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 204     acacgcacatcagatgccacac 225
               ||||||||||||||||||||||
Sbjct: 2430610 acacgcacatcagatgccacac 2430589



to top

>emb|AJ938182.1| Staphylococcus aureus RF122 complete genome
          Length = 2742531

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 204     acacgcacatcagatgccacac 225
               ||||||||||||||||||||||
Sbjct: 2281728 acacgcacatcagatgccacac 2281707



 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 118    cgaatgaaatgtgtacatttg 138
              |||||||||||||||||||||
Sbjct: 803612 cgaatgaaatgtgtacatttg 803632



to top

>emb|AJ849350.1| Staphylococcus aureus partial tpi71 gene for triosephosphate
           isomerase
          Length = 402

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 cgaatgaaatgtgtacatttg 138
           |||||||||||||||||||||
Sbjct: 242 cgaatgaaatgtgtacatttg 262



to top

>emb|AJ849348.1| Staphylococcus aureus partial tpi67 gene for triosephosphate
           isomerase
          Length = 402

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 cgaatgaaatgtgtacatttg 138
           |||||||||||||||||||||
Sbjct: 242 cgaatgaaatgtgtacatttg 262



to top

>gb|AC122290.4| Mus musculus BAC clone RP23-254P19 from chromosome 14, complete sequence
          Length = 163287

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 156    ttattgcactgaacaataaaa 176
              |||||||||||||||||||||
Sbjct: 107271 ttattgcactgaacaataaaa 107291



to top

>emb|CR457441.5| Zebrafish DNA sequence from clone CH211-181D7 in linkage group 15,
             complete sequence
          Length = 135398

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 116   cacgaatgaaatgtgtacatt 136
             |||||||||||||||||||||
Sbjct: 71227 cacgaatgaaatgtgtacatt 71247



to top

>emb|CR713387.2|CNS0GDEF Tetraodon nigroviridis full-length cDNA
          Length = 613

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 70  ttgaaatgactttttagactt 90
           |||||||||||||||||||||
Sbjct: 546 ttgaaatgactttttagactt 526



to top

>emb|AL353743.22| Human DNA sequence from clone RP11-213G2 on chromosome 9 Contains the
             3' end of a  pseudogene similar to part of a novel protein
             (DKFZp434D0917), a pseudogene similar to part of a novel
             protein (DKFZp434D0917), a novel gene, a prohibitin
             pseudogene (PHB), a novel pseudogene (DFKZP564M182), the
             5' end of a novel gene (FLJ21613) similar to rat corneal
             wound healing related protein (includes FLJ22634) and two
             CpG islands, complete sequence
          Length = 181864

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 32    taaaaatcaaacacttttccactgtttga 60
             ||||||||||||||| ||||| |||||||
Sbjct: 24525 taaaaatcaaacactattccagtgtttga 24497



to top

>emb|AL354733.15| Human DNA sequence from clone RP11-575L7 on chromosome 9 Contains the
             5' end of the gene for protein kinase anchoring protein
             GKAP42 (FKSG21), a novel gene (DKFZp43D0917), a novel gene
             (MGC10999), the HNRPK gene for heterogeneous nuclear
             ribonucleoprotein K (CSBP, TUNP, HNRNPK), three novel
             genes, the 5' UTR of a novel gene (FLJ12888) and six CpG
             islands, complete sequence
          Length = 189579

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 32    taaaaatcaaacacttttccactgtttga 60
             ||||||||||||||| ||||| |||||||
Sbjct: 33993 taaaaatcaaacactattccagtgtttga 34021



to top

>ref|NM_180181.3| Arabidopsis thaliana DNA binding AT3G04590 transcript variant
           AT3G04590.1 mRNA, complete cds
          Length = 1327

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 42  acacttttccactgtttgaa 61
           ||||||||||||||||||||
Sbjct: 956 acacttttccactgtttgaa 937



to top

>gb|AC150309.1| Latimeria menadoensis clone VMRC4-39G19, complete sequence
          Length = 196157

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    atgtgtacatttggttgaca 145
              ||||||||||||||||||||
Sbjct: 120476 atgtgtacatttggttgaca 120457



to top

>emb|CR382378.12| Zebrafish DNA sequence from clone DKEYP-40G12 in linkage group 7,
              complete sequence
          Length = 198471

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    gaatgaaatgtgtacatttg 138
              ||||||||||||||||||||
Sbjct: 191288 gaatgaaatgtgtacatttg 191269



to top

>emb|AL354771.14| Human DNA sequence from clone RP11-545P21 on chromosome 1q25.1-31.1
            Contains part of the gene for DBCCR1-like (DBCCR1L) and
            part of a novel gene, complete sequence
          Length = 150195

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 152  ccaattattgcactgaacaataaa 175
            ||||||||||||||||| ||||||
Sbjct: 5120 ccaattattgcactgaaaaataaa 5097



to top

>gb|AC107392.6| Homo sapiens BAC clone RP11-578K15 from 4, complete sequence
          Length = 93331

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 23   tttgcttggtaaaaatcaaacact 46
            |||||||||||||||||| |||||
Sbjct: 5628 tttgcttggtaaaaatcagacact 5651



to top

>dbj|AK139392.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched
            library, clone:A830040L08 product:unclassifiable, full
            insert sequence
          Length = 2968

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 66   aacattgaaatgacttttta 85
            ||||||||||||||||||||
Sbjct: 1561 aacattgaaatgacttttta 1542



to top

>gb|AC011631.6|AC011631 Homo sapiens, clone RP11-1I20, complete sequence
          Length = 158236

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 152    ccaattattgcactgaacaataaa 175
              ||||||||||||||||| ||||||
Sbjct: 138517 ccaattattgcactgaaaaataaa 138540



to top

>emb|AL954370.3| Mouse DNA sequence from clone RP23-180P4 on chromosome 2, complete
             sequence
          Length = 61741

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   agatgccacacccacacttg 234
             ||||||||||||||||||||
Sbjct: 16795 agatgccacacccacacttg 16776



to top

>gb|AC083816.21|AC083816 Mus musculus X BAC RP23-330G24 (Roswell Park Cancer Institute Mouse BAC
             Library) complete sequence
          Length = 187691

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 4     agccaagcttcacatcacat 23
             ||||||||||||||||||||
Sbjct: 44024 agccaagcttcacatcacat 44043



to top

>emb|BX005219.12| Mouse DNA sequence from clone RP23-343B19 on chromosome X, complete
             sequence
          Length = 83957

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 66    aacattgaaatgacttttta 85
             ||||||||||||||||||||
Sbjct: 35157 aacattgaaatgacttttta 35138


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,820,338
Number of Sequences: 3902068
Number of extensions: 2820338
Number of successful extensions: 60350
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 60160
Number of HSP's gapped (non-prelim): 190
length of query: 245
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 223
effective length of database: 17,147,199,772
effective search space: 3823825549156
effective search space used: 3823825549156
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top