ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet99d08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr... 313 2e-82
2gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic prote... 301 7e-79
3gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic prote... 281 7e-73
4gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic prote... 274 2e-70
5dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 188 8e-45
6dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D... 188 8e-45
7dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 188 8e-45
8dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 8e-45
9dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 8e-45
10dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 8e-45
11dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 8e-45
12dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 8e-45
13dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 8e-45
14dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 180 2e-42
15dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 180 2e-42
16gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral prot... 90 5e-15
17gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral prot... 88 2e-14
18gb|AY105015.1| Zea mays PCO137646 mRNA sequence 88 2e-14
19ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA 84 3e-13
20emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein 84 3e-13
21dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
22dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
23dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
24dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mR... 84 3e-13
25dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
26emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro... 84 3e-13
27emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquapo... 68 2e-08
28gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putat... 68 2e-08
29ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predic... 64 3e-07
30emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,... 64 3e-07
31dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 64 3e-07
32gb|AY106931.1| Zea mays PCO140073 mRNA sequence 64 3e-07
33gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRN... 64 3e-07
34ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predic... 56 7e-05
35gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 56 7e-05
36emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein 56 7e-05
37gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon... 56 7e-05
38gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds 56 7e-05
39gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, c... 56 7e-05
40dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 56 7e-05
41gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral prot... 56 7e-05
42dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, com... 56 7e-05
43dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 7e-05
44dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 7e-05
45dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 7e-05
46dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 7e-05
47gb|AY104464.1| Zea mays PCO114899 mRNA sequence 56 7e-05
48gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intr... 56 7e-05
49gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds 56 7e-05
50gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2... 50 0.005
51gb|BT016300.1| Zea mays clone Contig133 mRNA sequence 48 0.018
52emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonopla... 48 0.018
53gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral prot... 48 0.018
54gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral prot... 48 0.018
55gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmT... 48 0.018
56ref|XM_470886.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.071
57gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome... 46 0.071
58emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4,... 46 0.071
59gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 46 0.071
60dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsi... 46 0.071
61dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.071
62dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.071
63gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence 42 1.1
64ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), ... 42 1.1
65ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA 42 1.1
66ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquapori... 42 1.1
67ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquapori... 42 1.1
68emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like pr... 42 1.1
69gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsi... 42 1.1
70dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 42 1.1
71gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, comple... 42 1.1
72ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA 42 1.1
73ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel A... 40 4.4
74gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complet... 40 4.4
75ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquapori... 40 4.4
76gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete se... 40 4.4
77emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic p... 40 4.4
78gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g3683... 40 4.4
79gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic... 40 4.4
80emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene 40 4.4
81emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to... 40 4.4
82gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 4.4
83gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map ... 40 4.4
84gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone ... 40 4.4
85gb|CP000264.1| Jannaschia sp. CCS1, complete genome 40 4.4
86gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral prot... 40 4.4
87emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Co... 40 4.4
88emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Co... 40 4.4
89emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Co... 40 4.4
90emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Co... 40 4.4
91emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Co... 40 4.4
92emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Co... 40 4.4
93emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Co... 40 4.4
94emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Co... 40 4.4
95emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Co... 40 4.4
96gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete s... 40 4.4
97gb|AF497482.1| Micromonospora echinospora calicheamicin biosynth... 40 4.4
98gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote... 40 4.4
99gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water chann... 40 4.4
100emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquapor... 40 4.4
101dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intri... 40 4.4
102gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 40 4.4
103tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy ... 40 4.4
104gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRN... 40 4.4
105gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic pro... 40 4.4 
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1067

 Score =  313 bits (158), Expect = 2e-82
 Identities = 273/312 (87%), Gaps = 17/312 (5%)
 Strand = Plus / Minus

                                                                       
Query: 26  gcttcgatctgaaccaaacaacatgacgttcttcacatcatcgagacattc-------tg 78
           ||||||||||||||||||||||| || ||||||||||||||||| ||||||       ||
Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaaacattcgtgagactg 873

                                                                       
Query: 79  accaccacgcacgcacttttttatgttgccgaaggcatcatggaaaccaaacaccgaacg 138
            |||||||| ||||||||||| |||||||||||||||| |||||         |||||||
Sbjct: 872 cccaccacgtacgcacttttt-atgttgccgaaggcattatgga---------ccgaacg 823

                                                                       
Query: 139 acccttcacatggatggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacat 198
           || |||| ||||| |||||||||||||||||| |||||||||| |||||| ||| |||||
Sbjct: 822 actcttcccatggctggcttagtagtcgttgccggcgacggggctgtggtcgtcccacat 763

                                                                       
Query: 199 gtacaggtaccggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||| ||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 762 gtataggtatcggtaaacgacgccggcgaggccaccgccgatgagcgggccggcccagta 703

                                                                       
Query: 259 gatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggtt 318
            | ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 702 aacccaaatgttggtgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggtt 643

                       
Query: 319 catggaaccgcc 330
           |||||| |||||
Sbjct: 642 catggacccgcc 631
to top
>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA,
           complete cds
          Length = 829

 Score =  301 bits (152), Expect = 7e-79
 Identities = 170/176 (96%)
 Strand = Plus / Minus

                                                                       
Query: 155 gcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtag 214
           |||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 800 gcttagtagtcgttgccggcgacggcggtgtggtcgtcgcacatgtacaggtaccggtag 741

                                                                       
Query: 215 acgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 274
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 740 acgacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 681

                                                                   
Query: 275 aagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 680 aagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgcc 625
to top
>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA,
           complete cds
          Length = 853

 Score =  281 bits (142), Expect = 7e-73
 Identities = 166/174 (95%)
 Strand = Plus / Minus

                                                                       
Query: 157 ttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagac 216
           |||||||||||||| |||||||| | |||||| |||||||||||||| ||||||||||||
Sbjct: 801 ttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtacacgtaccggtagac 742

                                                                       
Query: 217 gatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 276
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 741 gacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 682

                                                                 
Query: 277 gtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           ||||||||||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 681 gtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgcc 628
to top
>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA,
           complete cds
          Length = 817

 Score =  274 bits (138), Expect = 2e-70
 Identities = 168/178 (94%)
 Strand = Plus / Minus

                                                                       
Query: 153 tggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggt 212
           |||||||||||||||||| |||||||| | |||||| |||||||||||| ||||| ||||
Sbjct: 806 tggcttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtataggtatcggt 747

                                                                       
Query: 213 agacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttgg 272
           |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 746 agacgacgccggcgaggccaccgccgatgagcgggccggcccagtagacccagatgttgg 687

                                                                     
Query: 273 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 686 tgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgcc 629
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  188 bits (95), Expect = 8e-45
 Identities = 146/163 (89%)
 Strand = Plus / Minus

                                                                            
Query: 168      tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 227
                ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 13251125 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 13251066

                                                                            
Query: 228      ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 287
                |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 13251065 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 13251006

                                                           
Query: 288      caacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
                | |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 13251005 cgacggcggggccgaaggagcgcgccgggttcatggagccgcc 13250963
to top
>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427E01
          Length = 146395

 Score =  188 bits (95), Expect = 8e-45
 Identities = 146/163 (89%)
 Strand = Plus / Minus

                                                                         
Query: 168   tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 227
             ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 12935 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 12876

                                                                         
Query: 228   ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 287
             |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 12875 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 12816

                                                        
Query: 288   caacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
             | |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 12815 cgacggcggggccgaaggagcgcgccgggttcatggagccgcc 12773
to top
>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0012F14
          Length = 168629

 Score =  188 bits (95), Expect = 8e-45
 Identities = 146/163 (89%)
 Strand = Plus / Minus

                                                                          
Query: 168    tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 227
              ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 168313 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 168254

                                                                          
Query: 228    ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 287
              |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 168253 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 168194

                                                         
Query: 288    caacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
              | |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 168193 cgacggcggggccgaaggagcgcgccgggttcatggagccgcc 168151
to top
>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full
           insert sequence
          Length = 1194

 Score =  188 bits (95), Expect = 8e-45
 Identities = 146/163 (89%)
 Strand = Plus / Minus

                                                                       
Query: 168 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 227
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 825 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 766

                                                                       
Query: 228 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 287
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 765 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 706

                                                      
Query: 288 caacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           | |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 705 cgacggcggggccgaaggagcgcgccgggttcatggagccgcc 663
to top
>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full
           insert sequence
          Length = 1214

 Score =  188 bits (95), Expect = 8e-45
 Identities = 146/163 (89%)
 Strand = Plus / Minus

                                                                       
Query: 168 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 227
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768

                                                                       
Query: 228 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 287
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708

                                                      
Query: 288 caacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           | |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 707 cgacggcggggccgaaggagcgcgccgggttcatggagccgcc 665
to top
>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full
           insert sequence
          Length = 1197

 Score =  188 bits (95), Expect = 8e-45
 Identities = 146/163 (89%)
 Strand = Plus / Minus

                                                                       
Query: 168 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 227
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769

                                                                       
Query: 228 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 287
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709

                                                      
Query: 288 caacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           | |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgcc 666
to top
>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full
           insert sequence
          Length = 1195

 Score =  188 bits (95), Expect = 8e-45
 Identities = 146/163 (89%)
 Strand = Plus / Minus

                                                                       
Query: 168 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 227
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767

                                                                       
Query: 228 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 287
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707

                                                      
Query: 288 caacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           | |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgcc 664
to top
>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full
           insert sequence
          Length = 1202

 Score =  188 bits (95), Expect = 8e-45
 Identities = 146/163 (89%)
 Strand = Plus / Minus

                                                                       
Query: 168 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 227
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769

                                                                       
Query: 228 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 287
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709

                                                      
Query: 288 caacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           | |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgcc 666
to top
>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full
           insert sequence
          Length = 1220

 Score =  188 bits (95), Expect = 8e-45
 Identities = 146/163 (89%)
 Strand = Plus / Minus

                                                                       
Query: 168 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 227
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767

                                                                       
Query: 228 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 287
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707

                                                      
Query: 288 caacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           | |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgcc 664
to top
>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full
           insert sequence
          Length = 1196

 Score =  180 bits (91), Expect = 2e-42
 Identities = 145/163 (88%)
 Strand = Plus / Minus

                                                                       
Query: 168 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 227
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768

                                                                       
Query: 228 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 287
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708

                                                      
Query: 288 caacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           | |||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 707 cgacggcgggaccgaaggagcgcgccgggttcatggagccgcc 665
to top
>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full
           insert sequence
          Length = 1074

 Score =  180 bits (91), Expect = 2e-42
 Identities = 145/163 (88%)
 Strand = Plus / Minus

                                                                       
Query: 168 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 227
           ||||||| ||||||| ||||| | |||||||||| | ||| |||||||||| ||||||||
Sbjct: 705 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaacggtagacgaggccggcga 646

                                                                       
Query: 228 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 287
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 645 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 586

                                                      
Query: 288 caacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           | |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 585 cgacggcggggccgaaggagcgcgccgggttcatggagccgcc 543
to top
>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA,
           complete cds
          Length = 1073

 Score = 89.7 bits (45), Expect = 5e-15
 Identities = 104/121 (85%), Gaps = 2/121 (1%)
 Strand = Plus / Minus

                                                                       
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 270
           |||||||| ||| ||||| || |||||||||||||||||| ||||||||| |||| ||  
Sbjct: 763 gtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagacccagttgcc 704

                                                                       
Query: 271 ggtgaagtc-gccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgc 329
           || |||||| ||||| ||| |||||||||||||| ||||| || ||||||||||| ||||
Sbjct: 703 ggcgaagtcggccgc-ggcgacggcggggccgaaggagcgggcggggttcatggagccgc 645

            
Query: 330 c 330
           |
Sbjct: 644 c 644
to top
>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA,
           complete cds
          Length = 1110

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 270
           |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| |   
Sbjct: 920 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 861

                                                                       
Query: 271 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           || |||||||||   ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 860 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 801
to top
>gb|AY105015.1| Zea mays PCO137646 mRNA sequence
          Length = 1238

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 270
           |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| |   
Sbjct: 919 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 860

                                                                       
Query: 271 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           || |||||||||   ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 859 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 800
to top
>ref|XM_467137.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 747

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 221 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 280
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 624

                                                             
Query: 281 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           |||  ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 623 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgcc 574
to top
>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein
          Length = 1007

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 209 cggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatg 268
           ||||||||||| ||||| ||||| || |||||||| |||||| ||||||| | |||| ||
Sbjct: 775 cggtagacgataccggcaaggccgcctccgatgagggggccgacccagtacacccagttg 716

                                                                       
Query: 269 ttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccg 328
           | ||||||||| |||||  |||| || ||| |||| ||||| || ||||||||||| |||
Sbjct: 715 tcggtgaagtctccgctcacaacagcagggtcgaaggagcgggcggggttcatggagccg 656

             
Query: 329 cc 330
           ||
Sbjct: 655 cc 654
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                            
Query: 221      ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 280
                ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 26627242

                                                                  
Query: 281      ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
                |||  ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 26627243 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgcc 26627292
to top
>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0519E06
          Length = 170634

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                          
Query: 221    ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 280
              ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 169623

                                                                
Query: 281    ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
              |||  ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 169624 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgcc 169673
to top
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1112_F09
          Length = 139371

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                         
Query: 221   ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 280
             ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 61403

                                                               
Query: 281   ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
             |||  ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 61404 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgcc 61453
to top
>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1013

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 221 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 280
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 697

                                                             
Query: 281 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           |||  ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 696 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgcc 647
to top
>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full
           insert sequence
          Length = 873

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 221 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 280
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 499

                                                             
Query: 281 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           |||  ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 498 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgcc 449
to top
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                          
Query: 221    ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 280
              ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 250592

                                                                
Query: 281    ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
              |||  ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 250591 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgcc 250542
to top
>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene)
          Length = 1017

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                       
Query: 252 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 311
           |||||||||||||| |||   |||||||||||||| | |||||||||||||| ||||| |
Sbjct: 655 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 596

                     
Query: 312 cagggttcat 321
           | ||||||||
Sbjct: 595 cggggttcat 586
to top
>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1)
           mRNA, complete cds
          Length = 1057

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                       
Query: 252 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 311
           |||||||||||||| |||   |||||||||||||| | |||||||||||||| ||||| |
Sbjct: 697 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 638

                     
Query: 312 cagggttcat 321
           | ||||||||
Sbjct: 637 cggggttcat 628
to top
>ref|XM_473424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2307

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 95/116 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 270
           ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 696 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 637

                                                                   
Query: 271 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaac 326
           || ||||| ||||   || ||||| |||||||| ||||| ||||||||||||||||
Sbjct: 636 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaac 581
to top
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
             complete sequence
          Length = 127259

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 95/116 (81%)
 Strand = Plus / Plus

                                                                         
Query: 211   gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 270
             ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 92483 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 92542

                                                                     
Query: 271   ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaac 326
             || ||||| ||||   || ||||| |||||||| ||||| ||||||||||||||||
Sbjct: 92543 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaac 92598
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 95/116 (81%)
 Strand = Plus / Plus

                                                                            
Query: 211      gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 270
                ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 27568507 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 27568566

                                                                        
Query: 271      ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaac 326
                || ||||| ||||   || ||||| |||||||| ||||| ||||||||||||||||
Sbjct: 27568567 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaac 27568622



 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 264      agatgttggtgaagtcgccgctg 286
                |||||||||||||||||||||||
Sbjct: 25620210 agatgttggtgaagtcgccgctg 25620232
to top
>gb|AY106931.1| Zea mays PCO140073 mRNA sequence
          Length = 1069

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 227 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 286
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || ||||| ||||   
Sbjct: 757 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 698

                                                       
Query: 287 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           || |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 697 gccacggcggggccgaaggagcgggccgggttcatggagccgcc 654
to top
>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds
          Length = 1060

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 227 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 286
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || ||||| ||||   
Sbjct: 739 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 680

                                                       
Query: 287 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           || |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 679 gccacggcggggccgaaggagcgggccgggttcatggagccgcc 636
to top
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 699 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 652
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 211     gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
               ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 2544783 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544830



 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 264      agatgttggtgaagtcgccgctg 286
                |||||||||||||||||||||||
Sbjct: 15990586 agatgttggtgaagtcgccgctg 15990564
to top
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 762 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 715
to top
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 211    gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
              ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 125311 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 125264
to top
>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds
          Length = 968

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 227 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 286
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || |||||  |||   
Sbjct: 680 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 621

                                                       
Query: 287 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           || |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 620 gccacggcggggccgaaggagcgggccgggttcatggagccgcc 577
to top
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds
          Length = 1039

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 700 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 653
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 211     gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
               ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 2544893 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544940



 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 264      agatgttggtgaagtcgccgctg 286
                |||||||||||||||||||||||
Sbjct: 15985120 agatgttggtgaagtcgccgctg 15985098
to top
>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA,
           complete cds
          Length = 1042

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 227 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 286
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || |||||  |||   
Sbjct: 748 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 689

                                                       
Query: 287 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 330
           || |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 688 gccacggcggggccgaaggagcgggccgggttcatggagccgcc 645
to top
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds
          Length = 1080

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 777 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 730
to top
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full
           insert sequence
          Length = 1034

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 786 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 739
to top
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full
           insert sequence
          Length = 1082

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 788 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 741
to top
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full
           insert sequence
          Length = 551

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 312 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 265
to top
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full
           insert sequence
          Length = 1055

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 784 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 737
to top
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence
          Length = 1167

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 795 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 748
to top
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1133

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 793 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 746
to top
>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds
          Length = 1047

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           ||||| |||||||| |||||||||||||||||||||
Sbjct: 788 ccacctccgatgagagggccggcccagtagatccag 753
to top
>gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2) mRNA, complete cds
          Length = 1072

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 248 ccggcccagtagatccagatgttggtgaagtcgccgctggc 288
           ||||||||||| |||||| |||| ||||||||||| |||||
Sbjct: 719 ccggcccagtaaatccagttgttagtgaagtcgccactggc 679
to top
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence
          Length = 1112

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||||| || |||||||||||| ||||||||||| || ||| |||||||
Sbjct: 796 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 749
to top
>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene
           tip1-1)
          Length = 1104

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           ||||| ||||| || |||||||||||||||||||||
Sbjct: 755 ccaccaccgataagtgggccggcccagtagatccag 720
to top
>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA,
           complete cds
          Length = 1021

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 273 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 324
           |||||| ||||||| | ||||| |||||||| ||||| || |||||||||||
Sbjct: 719 tgaagtggccgctgacgacggccgggccgaacgagcgggccgggttcatgga 668
to top
>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA,
           complete cds
          Length = 1125

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 233 ccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctggcaacg 292
           |||||||  |||||||||  |||||||| ||||  ||| ||  |||| ||| |||| | |
Sbjct: 825 ccgccgagcagcgggccgatccagtagacccagtggtttgtccagtccccggtggccagg 766

                                           
Query: 293 gcggggccgaatgagcgtgcagggttcatgga 324
           || |||||||| |||||||| |||||||||||
Sbjct: 765 gccgggccgaaggagcgtgccgggttcatgga 734
to top
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds
          Length = 1097

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 211 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 258
           ||||| || |||||||||||| ||||||||||| || ||| |||||||
Sbjct: 792 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 745
to top
>ref|XM_470886.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1812

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 264 agatgttggtgaagtcgccgctg 286
           |||||||||||||||||||||||
Sbjct: 877 agatgttggtgaagtcgccgctg 855
to top
>gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0087G11, complete sequence
          Length = 169728

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 264   agatgttggtgaagtcgccgctg 286
             |||||||||||||||||||||||
Sbjct: 59831 agatgttggtgaagtcgccgctg 59853
to top
>emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0004N05,
              complete sequence
          Length = 158601

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 264    agatgttggtgaagtcgccgctg 286
              |||||||||||||||||||||||
Sbjct: 106408 agatgttggtgaagtcgccgctg 106430
to top
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 220    gccggcgaggccaccgccgatga 242
              |||||||||||||||||||||||
Sbjct: 505313 gccggcgaggccaccgccgatga 505291



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 220     gccggcgaggccaccgccga 239
               ||||||||||||||||||||
Sbjct: 1274146 gccggcgaggccaccgccga 1274165
to top
>dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsic protein 2;1,
           complete cds
          Length = 1001

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 311
           ||||||||||||||  |||||||||||| |||    |  |||| ||||||||||| || |
Sbjct: 707 cccagtagatccagtagttggtgaagtcaccggatacggcggctgggccgaatgaacggg 648

                              
Query: 312 cagggttcatggaaccgcc 330
           | |||||||| ||||||||
Sbjct: 647 ccgggttcattgaaccgcc 629
to top
>dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C11, full
           insert sequence
          Length = 1679

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 264 agatgttggtgaagtcgccgctg 286
           |||||||||||||||||||||||
Sbjct: 794 agatgttggtgaagtcgccgctg 816
to top
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full
           insert sequence
          Length = 870

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 211 gtagacgatgccggcgaggccaccgccgatg 241
           ||||| || ||||||||||||||||||||||
Sbjct: 622 gtagatgacgccggcgaggccaccgccgatg 592
to top
>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence
          Length = 980

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 221 ccggcgaggccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||  |||||||||| ||| || ||||||||||||| ||||
Sbjct: 705 ccggcgattccaccgccgacgagaggtccggcccagtagacccag 661
to top
>ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 890

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 290 acggcggggccgaatgagcgtgcagggttcatggaac 326
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577
to top
>ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 890

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 290 acggcggggccgaatgagcgtgcagggttcatggaac 326
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577
to top
>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 2 (LOC607978), mRNA
          Length = 1082

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 292 ggcggggccgaatgagcgtgcagggttcatgga 324
           |||||||||||| ||||| || |||||||||||
Sbjct: 588 ggcggggccgaaggagcgggccgggttcatgga 556
to top
>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 1 (LOC607978), mRNA
          Length = 1067

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 292 ggcggggccgaatgagcgtgcagggttcatgga 324
           |||||||||||| ||||| || |||||||||||
Sbjct: 573 ggcggggccgaaggagcgggccgggttcatgga 541
to top
>emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like protein
          Length = 991

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 245 gggccggcccagtagatccag 265
           |||||||||||||||||||||
Sbjct: 655 gggccggcccagtagatccag 635
to top
>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete
           cds
          Length = 997

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 60/73 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 311
           ||||||||||||| |||  | |||||||||| || || || || || ||||| ||||| |
Sbjct: 692 cccagtagatccatatgccgttgaagtcgccactagccactgctggtccgaaggagcgag 633

                        
Query: 312 cagggttcatgga 324
           | |||||||||||
Sbjct: 632 ctgggttcatgga 620
to top
>dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:C230090D02 product:aquaporin 6,
           full insert sequence
          Length = 2066

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 290 acggcggggccgaatgagcgtgcagggttcatggaac 326
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578
to top
>gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, complete sequence
          Length = 182415

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 290   acggcggggccgaatgagcgtgcagggttcatggaac 326
             ||||| |||||||| ||||| || |||||||||||||
Sbjct: 98545 acggcagggccgaaggagcgggctgggttcatggaac 98581
to top
>ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 2066

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 290 acggcggggccgaatgagcgtgcagggttcatggaac 326
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578
to top
>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP)
           mRNA, complete cds
          Length = 1058

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712
to top
>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence
          Length = 121598

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 112    ggcatcatggaaaccaaaca 131
              ||||||||||||||||||||
Sbjct: 113843 ggcatcatggaaaccaaaca 113824
to top
>ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquaporin 5 (LOC486551),
           mRNA
          Length = 1556

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 293 gcggggccgaatgagcgtgcagggttcatgga 324
           ||||||||||| ||||| || |||||||||||
Sbjct: 794 gcggggccgaaagagcgggccgggttcatgga 763
to top
>gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete sequence
          Length = 138303

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 296   gggccgaatgagcgtgcagggttcatggaacc 327
             |||||||||||||| || |||||||| |||||
Sbjct: 90944 gggccgaatgagcgagccgggttcattgaacc 90913
to top
>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara)
          Length = 1398

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 230  ccaccgccgatgagcgggccggcccagtagatccag 265
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097
to top
>gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g36830) mRNA, complete
           cds
          Length = 787

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 683 ccaccgccgacgagaggtccggcccagtagacccag 648
to top
>gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic protein gamma,
           aquaporin (At2g36830) mRNA, complete cds
          Length = 1030

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 741 ccaccgccgacgagaggtccggcccagtagacccag 706
to top
>emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene
          Length = 993

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 725 ccaccgccgacgagaggtccggcccagtagacccag 690
to top
>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 210 ggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||||||||||| | |  | ||||  || |||||| ||||||||||||||
Sbjct: 779 ggtagacgatgccggcgatggctgcaccgactagtgggccgacccagtagatccag 724
to top
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 220     gccggcgaggccaccgccga 239
               ||||||||||||||||||||
Sbjct: 4535021 gccggcgaggccaccgccga 4535040
to top
>gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete
            sequence
          Length = 134151

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 230  ccaccgccgatgagcgggccggcccagtagatccag 265
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 7442 ccaccgccgacgagaggtccggcccagtagacccag 7407
to top
>gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-147E23, complete
              sequence
          Length = 222430

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     tctgaaccaaacaacatgac 52
              ||||||||||||||||||||
Sbjct: 111593 tctgaaccaaacaacatgac 111574
to top
>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 222     cggcgaggccaccgccgatg 241
               ||||||||||||||||||||
Sbjct: 1656225 cggcgaggccaccgccgatg 1656206
to top
>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA,
           complete cds
          Length = 955

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 293 gcggggccgaatgagcgtgcagggttcatgga 324
           ||||||||||| ||||| || |||||||||||
Sbjct: 708 gcggggccgaaggagcgcgcggggttcatgga 677
to top
>emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB66ZE04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 996

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 722 ccaccgccgacgagaggtccggcccagtagacccag 687
to top
>emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB42ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1009

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 712 ccaccgccgacgagaggtccggcccagtagacccag 677
to top
>emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZD11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 950

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692
to top
>emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZA10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693
to top
>emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZD10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 975

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693
to top
>emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB5ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 904

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691
to top
>emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB18ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 995

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692
to top
>emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZC03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 973

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691
to top
>emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS84ZH08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 961

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 718 ccaccgccgacgagaggtccggcccagtagacccag 683
to top
>gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete sequence
          Length = 1042

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712
to top
>gb|AF497482.1| Micromonospora echinospora calicheamicin biosynthetic locus, complete
            sequence
          Length = 90348

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 233  ccgccgatgagcgggccggc 252
            ||||||||||||||||||||
Sbjct: 7090 ccgccgatgagcgggccggc 7109
to top
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                 
Query: 273   tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 324
             |||||||||||||| |||| || || ||||| || || || |||||||||||
Sbjct: 46205 tgaagtcgccgctgacaaccgccggcccgaacgaccgcgcggggttcatgga 46154
to top
>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK)
           mRNA, complete cds
          Length = 1076

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 293 gcggggccgaatgagcgtgcagggttcatgga 324
           ||||| ||||||||||| || |||||||||||
Sbjct: 696 gcgggcccgaatgagcgggctgggttcatgga 665
to top
>emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquaporin 5 (aqp5 gene)
          Length = 535

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 293 gcggggccgaatgagcgtgcagggttcatgga 324
           ||||||||||| ||||| || |||||||||||
Sbjct: 534 gcggggccgaaagagcgggctgggttcatgga 503
to top
>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein,
           complete cds
          Length = 1143

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 230 ccaccgccgatgagcgggccggcccagtagatccag 265
           ||||||||||| |  || ||||||||||||||||||
Sbjct: 783 ccaccgccgatcaaaggcccggcccagtagatccag 748
to top
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 231    caccgccgatgagcgggccg 250
              ||||||||||||||||||||
Sbjct: 557849 caccgccgatgagcgggccg 557868
to top
>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region
               locus, strain C57BL/6
          Length = 2500000

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 33      tctgaaccaaacaacatgac 52
               ||||||||||||||||||||
Sbjct: 1893522 tctgaaccaaacaacatgac 1893503
to top
>gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRNA sequence
          Length = 2291

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 293  gcggggccgaatgagcgtgcagggttcatgga 324
            ||||||||||| ||||| || |||||||||||
Sbjct: 2227 gcggggccgaaagagcgggctgggttcatgga 2258
to top
>gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic protein (gamma-TIP) gene,
            complete cds
          Length = 1398

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 230  ccaccgccgatgagcgggccggcccagtagatccag 265
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,244,938
Number of Sequences: 3902068
Number of extensions: 2244938
Number of successful extensions: 37955
Number of sequences better than 10.0: 105
Number of HSP's better than 10.0 without gapping: 106
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 37490
Number of HSP's gapped (non-prelim): 454
length of query: 330
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 308
effective length of database: 17,147,199,772
effective search space: 5281337529776
effective search space used: 5281337529776
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top