ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet99c06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_785201.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 0.79
2gb|AY846301.1| Armillariella tabescens clone EST2000177 unknown ... 40 3.1
3ref|NM_105060.1| Arabidopsis thaliana protein binding AT1G63850 ... 40 3.1
4gb|AC120859.12| Mus musculus chromosome 18, clone RP24-200D2, co... 40 3.1
5gb|AY435216.1| Sus scrofa T-box 21 (TBX21) mRNA, partial cds 40 3.1
6gb|AC166570.2| Mus musculus chromosome 18, clone RP24-74O22, com... 40 3.1
7gb|DQ132236.1| Arabidopsis thaliana ecotype Bs-1 At5g63850 gene,... 40 3.1
8gb|DQ132235.1| Arabidopsis thaliana ecotype Te-0 At5g63850 gene,... 40 3.1
9gb|DQ132231.1| Arabidopsis thaliana ecotype Tu-1 At5g63850 gene,... 40 3.1
10gb|DQ132230.1| Arabidopsis thaliana ecotype Cvi-0 At5g63850 gene... 40 3.1
11gb|DQ132229.1| Arabidopsis thaliana ecotype Nok-0 At5g63850 gene... 40 3.1
12gb|DQ132228.1| Arabidopsis thaliana ecotype Lisse-1 At5g63850 ge... 40 3.1
13gb|DQ132227.1| Arabidopsis thaliana ecotype Ler-0 At5g63850 gene... 40 3.1
14gb|DQ132226.1| Arabidopsis thaliana ecotype Ita-0 At5g63850 gene... 40 3.1
15gb|DQ132225.1| Arabidopsis thaliana ecotype Ma-2 At5g63850 gene,... 40 3.1
16gb|DQ132224.1| Arabidopsis thaliana ecotype Bla-10 At5g63850 gen... 40 3.1
17gb|DQ132223.1| Arabidopsis thaliana ecotype Me-0 At5g63850 gene,... 40 3.1
18gb|DQ132222.1| Arabidopsis thaliana ecotype Da (1)-12 At5g63850 ... 40 3.1
19gb|DQ132221.1| Arabidopsis thaliana ecotype Kas-1 At5g63850 gene... 40 3.1
20gb|DQ132220.1| Arabidopsis thaliana ecotype Ag-0 At5g63850 gene,... 40 3.1
21gb|AC130821.3| Mus musculus BAC clone RP23-205K12 from chromosom... 40 3.1
22emb|AL591214.8| Human DNA sequence from clone RP11-18I23 on chro... 40 3.1
23emb|AL353650.5| Human DNA sequence from clone RP11-344N19 on chr... 40 3.1
24gb|AC158633.7| Mus musculus 10 BAC RP23-407I4 (Roswell Park Canc... 40 3.1
25gb|AC159910.6| Mus musculus 10 BAC RP23-353C6 (Roswell Park Canc... 40 3.1
26gb|AE002160.2| Chlamydia muridarum Nigg, complete genome 40 3.1
27gb|AC010852.7|AC010852 Arabidopsis thaliana chromosome 1 BAC T12... 40 3.1
28dbj|AP003515.1| Clostridium perfringens str. 13 plasmid pCP13 DN... 40 3.1

>ref|XM_785201.1| PREDICTED: Strongylocentrotus purpuratus similar to guanine
           nucleotide binding protein-like 2 (nucleolar)
           (LOC585370), mRNA
          Length = 2328

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 95  tcctccatcatcgaacaccaa 115
           |||||||||||||||||||||
Sbjct: 711 tcctccatcatcgaacaccaa 691



to top

>gb|AY846301.1| Armillariella tabescens clone EST2000177 unknown mRNA
          Length = 3416

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  cctctagttattttttgttg 241
            ||||||||||||||||||||
Sbjct: 1398 cctctagttattttttgttg 1417



to top

>ref|NM_105060.1| Arabidopsis thaliana protein binding AT1G63850 mRNA, complete cds
          Length = 1647

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 59   caagtacaacgactcattgctaagatca 86
            ||||||||||||||| || |||||||||
Sbjct: 1044 caagtacaacgactctttcctaagatca 1017



to top

>gb|AC120859.12| Mus musculus chromosome 18, clone RP24-200D2, complete sequence
          Length = 184327

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 171  gggaggagaggagagtttac 190
            ||||||||||||||||||||
Sbjct: 2258 gggaggagaggagagtttac 2239



to top

>gb|AY435216.1| Sus scrofa T-box 21 (TBX21) mRNA, partial cds
          Length = 200

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 167 gttggggaggagaggagagt 186
           ||||||||||||||||||||
Sbjct: 58  gttggggaggagaggagagt 39



to top

>gb|AC166570.2| Mus musculus chromosome 18, clone RP24-74O22, complete sequence
          Length = 163755

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 171   gggaggagaggagagtttac 190
             ||||||||||||||||||||
Sbjct: 62225 gggaggagaggagagtttac 62244



to top

>gb|DQ132236.1| Arabidopsis thaliana ecotype Bs-1 At5g63850 gene, partial cds
          Length = 807

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 783 caagtacaacgactctttcctaagatca 756



to top

>gb|DQ132235.1| Arabidopsis thaliana ecotype Te-0 At5g63850 gene, partial cds
          Length = 807

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 783 caagtacaacgactctttcctaagatca 756



to top

>gb|DQ132231.1| Arabidopsis thaliana ecotype Tu-1 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132230.1| Arabidopsis thaliana ecotype Cvi-0 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132229.1| Arabidopsis thaliana ecotype Nok-0 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132228.1| Arabidopsis thaliana ecotype Lisse-1 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132227.1| Arabidopsis thaliana ecotype Ler-0 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132226.1| Arabidopsis thaliana ecotype Ita-0 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132225.1| Arabidopsis thaliana ecotype Ma-2 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132224.1| Arabidopsis thaliana ecotype Bla-10 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132223.1| Arabidopsis thaliana ecotype Me-0 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132222.1| Arabidopsis thaliana ecotype Da (1)-12 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132221.1| Arabidopsis thaliana ecotype Kas-1 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132220.1| Arabidopsis thaliana ecotype Ag-0 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 59  caagtacaacgactcattgctaagatca 86
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|AC130821.3| Mus musculus BAC clone RP23-205K12 from chromosome 13, complete sequence
          Length = 227411

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 171    gggaggagaggagagtttac 190
              ||||||||||||||||||||
Sbjct: 114433 gggaggagaggagagtttac 114452



to top

>emb|AL591214.8| Human DNA sequence from clone RP11-18I23 on chromosome 9 Contains part
             of one variant of the ROR2 gene for receptor tyrosine
             kinase-like orphan receptor 2, complete sequence
          Length = 66959

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    cacggaacaatcctccatca 104
             ||||||||||||||||||||
Sbjct: 17703 cacggaacaatcctccatca 17684



to top

>emb|AL353650.5| Human DNA sequence from clone RP11-344N19 on chromosome 10 Contains
            the 5' end of a novel gene (DKFZp761L0424) (KIAA1217) and
            a CpG island, complete sequence
          Length = 84778

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 24   gtatgatcttccaatccaac 43
            ||||||||||||||||||||
Sbjct: 8120 gtatgatcttccaatccaac 8139



to top

>gb|AC158633.7| Mus musculus 10 BAC RP23-407I4 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 206282

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 162    aaagagttggggaggagagg 181
              ||||||||||||||||||||
Sbjct: 182578 aaagagttggggaggagagg 182559



to top

>gb|AC159910.6| Mus musculus 10 BAC RP23-353C6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 219861

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 162    aaagagttggggaggagagg 181
              ||||||||||||||||||||
Sbjct: 197420 aaagagttggggaggagagg 197439



to top

>gb|AE002160.2| Chlamydia muridarum Nigg, complete genome
          Length = 1072950

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 4      acagaagacggaggaaccac 23
              ||||||||||||||||||||
Sbjct: 209878 acagaagacggaggaaccac 209859



to top

>gb|AC010852.7|AC010852 Arabidopsis thaliana chromosome 1 BAC T12P18 genomic sequence, complete
             sequence
          Length = 79469

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 59    caagtacaacgactcattgctaagatca 86
             ||||||||||||||| || |||||||||
Sbjct: 42607 caagtacaacgactctttcctaagatca 42634



to top

>dbj|AP003515.1| Clostridium perfringens str. 13 plasmid pCP13 DNA, complete sequence
          Length = 54310

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 41    aactgacaataatatgtacaagta 64
             ||||||||||||||| ||||||||
Sbjct: 44575 aactgacaataatatttacaagta 44552


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,650,998
Number of Sequences: 3902068
Number of extensions: 2650998
Number of successful extensions: 55713
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55673
Number of HSP's gapped (non-prelim): 40
length of query: 242
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 220
effective length of database: 17,147,199,772
effective search space: 3772383949840
effective search space used: 3772383949840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top