ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet99a05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5... 42 0.44
2gb|AC118017.15| Mus musculus chromosome 7, clone RP23-457C1, com... 42 0.44
3dbj|AK165048.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 42 0.44
4gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta... 42 0.44
5gb|L47235.1|MUSXPDG1 Mus musculus ERCC2 gene, genomic sequence 42 0.44
6gb|AC118193.9| Mus musculus chromosome 8, clone RP23-241A10, com... 40 1.7
7gb|AC150694.2| Bos taurus BAC CH240-144A17 (Children's Hospital... 40 1.7
8emb|AL136304.10| Human DNA sequence from clone RP1-20C7 on chrom... 40 1.7
9gb|AC021010.8| Homo sapiens, clone RP11-69D2, complete sequence 40 1.7
10gb|AC079900.15| Homo sapiens 3 BAC RP11-456E14 (Roswell Park Can... 40 1.7
11gb|AC127366.4| Mus musculus BAC clone RP23-10E9 from 8, complete... 40 1.7
12gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple... 38 6.8
13gb|AC146507.2| Homo sapiens chromosome 5 clone CTD-2301A4, compl... 38 6.8
14gb|AC093856.3| Homo sapiens BAC clone RP11-518I12 from 7, comple... 38 6.8
15gb|DP000038.2| Colobus guereza target 106 genomic scaffold 38 6.8
16gb|AE014837.1| Plasmodium falciparum 3D7 chromosome 11 section 2... 38 6.8
17emb|AL357873.17| Human DNA sequence from clone RP11-344F13 on ch... 38 6.8
18gb|AC074327.6| Homo sapiens chromosome 10 clone RP11-556E13, com... 38 6.8
19emb|AL021578.4|HS453C12 Human DNA sequence from clone RP3-453C12... 38 6.8
20emb|AL929352.1|PFA929352 Plasmodium falciparum strain 3D7, chrom... 38 6.8
21emb|AL662875.14| Mouse DNA sequence from clone RP23-67E18 on chr... 38 6.8
22gb|AC158755.6| Mus musculus chromosome 1, clone RP23-461O16, com... 38 6.8
23emb|BX664715.25| Zebrafish DNA sequence from clone DKEY-83M2 in ... 38 6.8
24gb|AC112170.2| Homo sapiens chromosome 5 clone CTD-2018G4, compl... 38 6.8
25gb|AC110005.2| Homo sapiens chromosome 5 clone RP11-265K23, comp... 38 6.8
26gb|AC006248.4| Arabidopsis thaliana chromosome 2 clone F9O13 map... 38 6.8
27gb|AF230361.1| Anabaena PCC7120 serine/threonine kinase (hstK), ... 38 6.8
28gb|DP000036.1| Papio anubis target 106 genomic scaffold 38 6.8
29gb|DP000045.1| Pongo pygmaeus target 106 genomic scaffold 38 6.8
30gb|DP000046.1| Aotus nancymaae target 106 genomic scaffold 38 6.8
31gb|DP000048.1| Cercopithecus aethiops target 106 genomic scaffold 38 6.8
32gb|AC009709.7|AC009709 Homo sapiens chromosome 18, clone RP11-31... 38 6.8
33gb|AF314058.1|AF314058 Homo sapiens chromosome 20 clone GS1-430E... 38 6.8
34dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome 38 6.8
35dbj|BS000077.1| Pan troglodytes chromosome 22 clone:RP43-076N07,... 38 6.8
36gb|AC153379.1| Mus musculus 10 BAC RP23-230J20 (Roswell Park Can... 38 6.8
37dbj|AB012245.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 38 6.8
38gb|AC007911.8|AC007911 Homo sapiens chromosome 18, clone RP11-52... 38 6.8
39emb|AM180252.1| Lawsonia intracellularis PHE/MN1-00 38 6.8
40dbj|AP001683.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 38 6.8
41dbj|D79206.1|HUMRCP Homo sapiens gene for ryudocan core protein,... 38 6.8
42gb|AE017195.1| Bacillus cereus ATCC 10987 plasmid pBc10987, comp... 38 6.8
43emb|AL591882.12| Mouse DNA sequence from clone RP23-53L16 on chr... 38 6.8
44dbj|AP000705.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 38 6.8 
>gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5 of 8 of the
           complete sequence
          Length = 249995

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 24  tttatatgtttagcatttttg 44
           |||||||||||||||||||||
Sbjct: 296 tttatatgtttagcatttttg 316
to top
>gb|AC118017.15| Mus musculus chromosome 7, clone RP23-457C1, complete sequence
          Length = 196427

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 76    agcctggtggagggagaggcc 96
             |||||||||||||||||||||
Sbjct: 64406 agcctggtggagggagaggcc 64426
to top
>dbj|AK165048.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
            library, clone:E130320P15 product:excision repair
            cross-complementing rodent repair deficiency,
            complementation group 2, full insert sequence
          Length = 5751

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 76   agcctggtggagggagaggcc 96
            |||||||||||||||||||||
Sbjct: 3142 agcctggtggagggagaggcc 3122
to top
>gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta H, complete genome
          Length = 1751377

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 70      atcaagagcctggtggaggga 90
               |||||||||||||||||||||
Sbjct: 1008224 atcaagagcctggtggaggga 1008204
to top
>gb|L47235.1|MUSXPDG1 Mus musculus ERCC2 gene, genomic sequence
          Length = 32595

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 76    agcctggtggagggagaggcc 96
             |||||||||||||||||||||
Sbjct: 20474 agcctggtggagggagaggcc 20454
to top
>gb|AC118193.9| Mus musculus chromosome 8, clone RP23-241A10, complete sequence
          Length = 222682

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 77    gcctggtggagggagaggccagtg 100
             |||||||||| |||||||||||||
Sbjct: 12171 gcctggtggaaggagaggccagtg 12148
to top
>gb|AC150694.2| Bos taurus  BAC CH240-144A17 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 163920

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 20     actttttatatgtttagcat 39
              ||||||||||||||||||||
Sbjct: 158516 actttttatatgtttagcat 158535
to top
>emb|AL136304.10| Human DNA sequence from clone RP1-20C7 on chromosome 6p12.3-21.2
             Contains the PPP2R5D gene for delta variant of protein
             phosphatase 2 regulatory subunit B (B56), the MEA gene for
             male-enhanced antigen, the gene for testis intracellular
             mediator protein (PEAS), the gene for a novel protein
             (LOC88745), the 3' end of a  gene for a novel protein
             (KIAA0076 KIAA0708) and a CpG island, complete sequence
          Length = 65612

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 43    tgggaccaacactgcaaagc 62
             ||||||||||||||||||||
Sbjct: 53307 tgggaccaacactgcaaagc 53326
to top
>gb|AC021010.8| Homo sapiens, clone RP11-69D2, complete sequence
          Length = 187599

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 19     aactttttatatgtttagcatttt 42
              ||||||||||||||| ||||||||
Sbjct: 129608 aactttttatatgttcagcatttt 129585
to top
>gb|AC079900.15| Homo sapiens 3 BAC RP11-456E14 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 74817

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    ttagcatttttgggaccaac 52
             ||||||||||||||||||||
Sbjct: 70439 ttagcatttttgggaccaac 70458
to top
>gb|AC127366.4| Mus musculus BAC clone RP23-10E9 from 8, complete sequence
          Length = 177375

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 77    gcctggtggagggagaggccagtg 100
             |||||||||| |||||||||||||
Sbjct: 56346 gcctggtggaaggagaggccagtg 56323
to top
>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 10     attaggtgtaactttttat 28
              |||||||||||||||||||
Sbjct: 107398 attaggtgtaactttttat 107416
to top
>gb|AC146507.2| Homo sapiens chromosome 5 clone CTD-2301A4, complete sequence
          Length = 144503

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 75    gagcctggtggagggagag 93
             |||||||||||||||||||
Sbjct: 93994 gagcctggtggagggagag 93976
to top
>gb|AC093856.3| Homo sapiens BAC clone RP11-518I12 from 7, complete sequence
          Length = 205317

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 86   agggagaggccagtgcggc 104
            |||||||||||||||||||
Sbjct: 9248 agggagaggccagtgcggc 9230
to top
>gb|DP000038.2| Colobus guereza target 106 genomic scaffold
          Length = 481828

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 76     agcctggtggagggagagg 94
              |||||||||||||||||||
Sbjct: 464659 agcctggtggagggagagg 464641
to top
>gb|AE014837.1| Plasmodium falciparum 3D7 chromosome 11 section 2 of 8 of the complete
              sequence
          Length = 257757

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 16     tgtaactttttatatgttt 34
              |||||||||||||||||||
Sbjct: 251779 tgtaactttttatatgttt 251761
to top
>emb|AL357873.17| Human DNA sequence from clone RP11-344F13 on chromosome 1 Contains a
             novel gene, complete sequence
          Length = 143508

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 18    taactttttatatgtttag 36
             |||||||||||||||||||
Sbjct: 16396 taactttttatatgtttag 16378
to top
>gb|AC074327.6| Homo sapiens chromosome 10 clone RP11-556E13, complete sequence
          Length = 189250

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 22     tttttatatgtttagcatttttg 44
              ||||||||||||||| |||||||
Sbjct: 109185 tttttatatgtttaggatttttg 109163
to top
>emb|AL021578.4|HS453C12 Human DNA sequence from clone RP3-453C12 on chromosome 20q12-13.12
             Contains the MATN4 gene for matrilin 4, the RBPSUHL gene
             for recombining binding protein suppressor of hairless
             (Drosophila)-like, the SDC4 (syndecan 4 (amphiglycan,
             ryudocan)) gene, the C20orf169 gene for a novel protein
             similar to Drosophila CG11753, the C20orf10 gene for p53
             response element (clg01), the C20orf35 gene for
             uncharacterized hypothalamus protein, the C20orf10 gene,
             the PIGT gene for phosphatidyl inositol glycan class T, an
             NADH dehydrogenase (ubiquinone) 1 beta subcomplex 4
             (NDUFB4) pseudogene and CpG islands, complete sequence
          Length = 147620

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 76    agcctggtggagggagagg 94
             |||||||||||||||||||
Sbjct: 41453 agcctggtggagggagagg 41435
to top
>emb|AL929352.1|PFA929352 Plasmodium falciparum strain 3D7, chromosome 5, segment 2/4
          Length = 313050

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     ttttatatgtttagcattt 41
              |||||||||||||||||||
Sbjct: 105035 ttttatatgtttagcattt 105017
to top
>emb|AL662875.14| Mouse DNA sequence from clone RP23-67E18 on chromosome 11 Contains the 3'
              end of the gene for the likely ortholog of H. sapiens
              C/EBP-induced protein (5730593F17Rik), the Ugalt2 gene for
              UDP-galactose translocator 2, the Spop gene for
              speckle-type POZ protein, the Nxph3 gene for neurexophilin
              3, the Ngfr gene for nerve growth factor receptor (TNFR
              superfamily, member 16), the 5' end of a novel gene and a
              CpG island, complete sequence
          Length = 255199

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     tggtggagggagaggccag 98
              |||||||||||||||||||
Sbjct: 208182 tggtggagggagaggccag 208164
to top
>gb|AC158755.6| Mus musculus chromosome 1, clone RP23-461O16, complete sequence
          Length = 224116

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 17     gtaactttttatatgttta 35
              |||||||||||||||||||
Sbjct: 122870 gtaactttttatatgttta 122888
to top
>emb|BX664715.25| Zebrafish DNA sequence from clone DKEY-83M2 in linkage group 6, complete
              sequence
          Length = 231173

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 27     atatgtttagcatttttgg 45
              |||||||||||||||||||
Sbjct: 136908 atatgtttagcatttttgg 136890
to top
>gb|AC112170.2| Homo sapiens chromosome 5 clone CTD-2018G4, complete sequence
          Length = 76631

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 75    gagcctggtggagggagag 93
             |||||||||||||||||||
Sbjct: 53029 gagcctggtggagggagag 53047
to top
>gb|AC110005.2| Homo sapiens chromosome 5 clone RP11-265K23, complete sequence
          Length = 184157

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 75    gagcctggtggagggagag 93
             |||||||||||||||||||
Sbjct: 47251 gagcctggtggagggagag 47269
to top
>gb|AC006248.4| Arabidopsis thaliana chromosome 2 clone F9O13 map mi398, complete
             sequence
          Length = 119753

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 29    atgtttagcatttttggga 47
             |||||||||||||||||||
Sbjct: 41949 atgtttagcatttttggga 41931
to top
>gb|AF230361.1| Anabaena PCC7120 serine/threonine kinase (hstK), serine/threonine
            kinase (pknB), and sensor protein (msnA) genes, complete
            cds
          Length = 12320

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 10   attaggtgtaactttttat 28
            |||||||||||||||||||
Sbjct: 3507 attaggtgtaactttttat 3525
to top
>gb|DP000036.1| Papio anubis target 106 genomic scaffold
          Length = 492848

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 76     agcctggtggagggagagg 94
              |||||||||||||||||||
Sbjct: 362442 agcctggtggagggagagg 362424
to top
>gb|DP000045.1| Pongo pygmaeus target 106 genomic scaffold
          Length = 644818

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 76     agcctggtggagggagagg 94
              |||||||||||||||||||
Sbjct: 494223 agcctggtggagggagagg 494205
to top
>gb|DP000046.1| Aotus nancymaae target 106 genomic scaffold
          Length = 387541

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 76     agcctggtggagggagagg 94
              |||||||||||||||||||
Sbjct: 338105 agcctggtggagggagagg 338087
to top
>gb|DP000048.1| Cercopithecus aethiops target 106 genomic scaffold
          Length = 583711

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 76     agcctggtggagggagagg 94
              |||||||||||||||||||
Sbjct: 478991 agcctggtggagggagagg 478973
to top
>gb|AC009709.7|AC009709 Homo sapiens chromosome 18, clone RP11-319O9, complete sequence
          Length = 187615

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 18    taactttttatatgtttag 36
             |||||||||||||||||||
Sbjct: 61985 taactttttatatgtttag 61967
to top
>gb|AF314058.1|AF314058 Homo sapiens chromosome 20 clone GS1-430E01 map 20q12-q13.12, complete
              sequence
          Length = 189656

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 76     agcctggtggagggagagg 94
              |||||||||||||||||||
Sbjct: 144389 agcctggtggagggagagg 144407
to top
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 10      attaggtgtaactttttat 28
               |||||||||||||||||||
Sbjct: 2712654 attaggtgtaactttttat 2712672
to top
>dbj|BS000077.1| Pan troglodytes chromosome 22 clone:RP43-076N07, map 22, complete
             sequences
          Length = 186185

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 20    actttttatatgtttagca 38
             |||||||||||||||||||
Sbjct: 61847 actttttatatgtttagca 61829
to top
>gb|AC153379.1| Mus musculus 10 BAC RP23-230J20 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 174195

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 83    tggagggagaggccagtgc 101
             |||||||||||||||||||
Sbjct: 19261 tggagggagaggccagtgc 19243
to top
>dbj|AB012245.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRA19
          Length = 86722

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 23    ttttatatgtttagcatttttgg 45
             |||||||||||| ||||||||||
Sbjct: 21268 ttttatatgtttggcatttttgg 21290
to top
>gb|AC007911.8|AC007911 Homo sapiens chromosome 18, clone RP11-520K18, complete sequence
          Length = 160299

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 18    taactttttatatgtttag 36
             |||||||||||||||||||
Sbjct: 55744 taactttttatatgtttag 55726
to top
>emb|AM180252.1| Lawsonia intracellularis PHE/MN1-00
          Length = 1457619

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 11     ttaggtgtaactttttata 29
              |||||||||||||||||||
Sbjct: 981599 ttaggtgtaactttttata 981617
to top
>dbj|AP001683.1| Homo sapiens genomic DNA, chromosome 21q, section 27/105
          Length = 340000

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 20     actttttatatgtttagca 38
              |||||||||||||||||||
Sbjct: 279436 actttttatatgtttagca 279418
to top
>dbj|D79206.1|HUMRCP Homo sapiens gene for ryudocan core protein, exon1-5, complete cds
          Length = 23822

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    agcctggtggagggagagg 94
             |||||||||||||||||||
Sbjct: 18492 agcctggtggagggagagg 18510
to top
>gb|AE017195.1| Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence
          Length = 208369

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    aggtgtaactttttatatg 31
             |||||||||||||||||||
Sbjct: 41521 aggtgtaactttttatatg 41503
to top
>emb|AL591882.12| Mouse DNA sequence from clone RP23-53L16 on chromosome 2, complete
              sequence
          Length = 251814

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 69     tatcaagagcctggtggag 87
              |||||||||||||||||||
Sbjct: 178854 tatcaagagcctggtggag 178872
to top
>dbj|AP000705.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2 clone:B745D19,
             LL56-APP region, complete sequence
          Length = 145869

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 20    actttttatatgtttagca 38
             |||||||||||||||||||
Sbjct: 40910 actttttatatgtttagca 40892


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,287,118
Number of Sequences: 3902068
Number of extensions: 1287118
Number of successful extensions: 104445
Number of sequences better than 10.0: 44
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 104262
Number of HSP's gapped (non-prelim): 183
length of query: 143
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 122
effective length of database: 17,151,101,840
effective search space: 2092434424480
effective search space used: 2092434424480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top