Clone Name | rbaet98f11 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_472726.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 172 bits (87), Expect = 5e-40 Identities = 125/138 (90%) Strand = Plus / Minus Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314 |||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 757 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 698 Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374 |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| | Sbjct: 697 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 638 Query: 375 cggtgtcggngatgtaga 392 ||||||| | |||||||| Sbjct: 637 cggtgtccgggatgtaga 620
>emb|AL606636.4|OSJN00075 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0036B21, complete sequence Length = 138969 Score = 172 bits (87), Expect = 5e-40 Identities = 125/138 (90%) Strand = Plus / Plus Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314 |||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 19661 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 19720 Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374 |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| | Sbjct: 19721 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 19780 Query: 375 cggtgtcggngatgtaga 392 ||||||| | |||||||| Sbjct: 19781 cggtgtccgggatgtaga 19798
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 172 bits (87), Expect = 5e-40 Identities = 125/138 (90%) Strand = Plus / Plus Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314 |||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 22810886 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 22810945 Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374 |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| | Sbjct: 22810946 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 22811005 Query: 375 cggtgtcggngatgtaga 392 ||||||| | |||||||| Sbjct: 22811006 cggtgtccgggatgtaga 22811023
>dbj|AK108672.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-148-H08, full insert sequence Length = 1377 Score = 172 bits (87), Expect = 5e-40 Identities = 125/138 (90%) Strand = Plus / Plus Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314 |||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 41 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 100 Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374 |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| | Sbjct: 101 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 160 Query: 375 cggtgtcggngatgtaga 392 ||||||| | |||||||| Sbjct: 161 cggtgtccgggatgtaga 178
>dbj|AK104811.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G02, full insert sequence Length = 1138 Score = 172 bits (87), Expect = 5e-40 Identities = 125/138 (90%) Strand = Plus / Minus Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314 |||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 819 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 760 Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374 |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| | Sbjct: 759 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 700 Query: 375 cggtgtcggngatgtaga 392 ||||||| | |||||||| Sbjct: 699 cggtgtccgggatgtaga 682
>dbj|AK066070.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013055K10, full insert sequence Length = 1144 Score = 172 bits (87), Expect = 5e-40 Identities = 125/138 (90%) Strand = Plus / Minus Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314 |||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 820 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 761 Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374 |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| | Sbjct: 760 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 701 Query: 375 cggtgtcggngatgtaga 392 ||||||| | |||||||| Sbjct: 700 cggtgtccgggatgtaga 683
>gb|AY103838.1| Zea mays PCO113775 mRNA sequence Length = 958 Score = 172 bits (87), Expect = 5e-40 Identities = 125/138 (90%) Strand = Plus / Minus Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314 |||| ||||||||||||||||||||||||||||| |||||||||||||||||| ||||| Sbjct: 811 ataggccgagcgcgccgagcggcgtcttgccctgcccggcctcgaagtagaaggcgagca 752 Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374 ||||||||||||||| ||| | ||||||||||||||||| |||||||||||| ||||| | Sbjct: 751 tggcaagcatggcgatgcgggcgtgcttgatctcggccagcttgagccgctcgagcttgt 692 Query: 375 cggtgtcggngatgtaga 392 || ||||| |||||||| Sbjct: 691 cgacgtcggggatgtaga 674
>gb|U23190.1|ZMU23190 Zea mays chlorophyll a/b-binding apoprotein CP24 (Lhcb6-1) mRNA, complete cds Length = 1040 Score = 149 bits (75), Expect = 8e-33 Identities = 122/138 (88%) Strand = Plus / Minus Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314 |||| |||||||||||||| ||||||||||||| || ||||||||||||||| ||||| Sbjct: 774 ataggccgagcgcgccgaggcgcgtcttgccctgcccagcctcgaagtagaaggcgagca 715 Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374 ||||||||||||||| ||| | ||||||||||||||||| |||||||||||| ||||| | Sbjct: 714 tggcaagcatggcgatgcgggcgtgcttgatctcggccagcttgagccgctcgagcttgt 655 Query: 375 cggtgtcggngatgtaga 392 || ||||| |||||||| Sbjct: 654 cgacgtcggggatgtaga 637
>gb|DQ427744.1| Sorghum propinquum locus HHU11 genomic sequence Length = 757 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 757 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 698 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 697 gagcttgtcgacgtcggggatgtaga 672
>gb|DQ427743.1| Sorghum bicolor voucher PI585454 locus HHU11 genomic sequence Length = 755 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 696 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 695 gagcttgtcgacgtcggggatgtaga 670
>gb|DQ427742.1| Sorghum bicolor voucher PI267539 locus HHU11 genomic sequence Length = 755 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 696 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 695 gagcttgtcgacgtcggggatgtaga 670
>gb|DQ427741.1| Sorghum bicolor voucher PI267408 locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>gb|DQ427740.1| Sorghum bicolor voucher PI221607 locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>gb|DQ427739.1| Sorghum bicolor voucher PI152702 locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>gb|DQ427738.1| Sorghum bicolor voucher NSL92371 locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>gb|DQ427737.1| Sorghum bicolor voucher NSL87902b locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>gb|DQ427736.1| Sorghum bicolor voucher NSL87902a locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>gb|DQ427735.1| Sorghum bicolor voucher NSL87666 locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>gb|DQ427734.1| Sorghum bicolor voucher NSL77217 locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>gb|DQ427733.1| Sorghum bicolor voucher NSL77034 locus HHU11 genomic sequence Length = 755 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 696 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 695 gagcttgtcgacgtcggggatgtaga 670
>gb|DQ427732.1| Sorghum bicolor voucher NSL56174 locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>gb|DQ427731.1| Sorghum bicolor voucher NSL55243 locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>gb|DQ427730.1| Sorghum bicolor voucher NSL51365 locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>gb|DQ427729.1| Sorghum bicolor voucher NSL51030 locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>gb|DQ427728.1| Sorghum bicolor voucher NSL50875 locus HHU11 genomic sequence Length = 761 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| |||||||||||||| | ||||||||||||||| | |||||||||||| Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702 Query: 367 aagcttctcggtgtcggngatgtaga 392 ||||| ||| ||||| |||||||| Sbjct: 701 gagcttgtcgacgtcggggatgtaga 676
>emb|Z50801.1|ZMCABCP29 Z.mays mRNA for chlorophyll a/b-binding protein CP29 Length = 1162 Score = 50.1 bits (25), Expect = 0.005 Identities = 40/45 (88%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||||| |||||||||||| |||| || |||||||| Sbjct: 760 catggcgaggcgcgcgtgcttgatctccgccagctgcagccgctc 716
>gb|AY103995.1| Zea mays PCO102677 mRNA sequence Length = 1225 Score = 50.1 bits (25), Expect = 0.005 Identities = 40/45 (88%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||||| |||||||||||| |||| || |||||||| Sbjct: 805 catggcgaggcgcgcgtgcttgatctccgccagctgcagccgctc 761
>gb|AE005909.1| Caulobacter crescentus CB15 section 235 of 359 of the complete genome Length = 10294 Score = 46.1 bits (23), Expect = 0.085 Identities = 23/23 (100%) Strand = Plus / Plus Query: 265 cgcgccgagcggcgtcttgccct 287 ||||||||||||||||||||||| Sbjct: 9269 cgcgccgagcggcgtcttgccct 9291
>ref|NM_139299.1| Mus musculus interleukin 31 receptor A (Il31ra), mRNA Length = 3680 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Minus Query: 121 taaaagaagtcacggacacaga 142 |||||||||||||||||||||| Sbjct: 1294 taaaagaagtcacggacacaga 1273
>gb|AY509151.1| Mus musculus muzcytor17x2 interleukin 31RA (Il31ra) mRNA, complete cds Length = 2728 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Minus Query: 121 taaaagaagtcacggacacaga 142 |||||||||||||||||||||| Sbjct: 1191 taaaagaagtcacggacacaga 1170
>gb|AY509150.1| Mus musculus muzcytor17x1 interleukin 31RA (Il31ra) mRNA, complete cds Length = 2748 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Minus Query: 121 taaaagaagtcacggacacaga 142 |||||||||||||||||||||| Sbjct: 1191 taaaagaagtcacggacacaga 1170
>gb|BC066164.1| Mus musculus interleukin 31 receptor A, mRNA (cDNA clone MGC:76531 IMAGE:30475340), complete cds Length = 2020 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Minus Query: 121 taaaagaagtcacggacacaga 142 |||||||||||||||||||||| Sbjct: 1016 taaaagaagtcacggacacaga 995
>gb|AC159196.2| Mus musculus BAC clone RP23-430O17 from chromosome 13, complete sequence Length = 198595 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Minus Query: 121 taaaagaagtcacggacacaga 142 |||||||||||||||||||||| Sbjct: 22923 taaaagaagtcacggacacaga 22902
>gb|AF486621.1| Mus musculus gp130-like monocyte receptor mRNA, complete cds Length = 2151 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Minus Query: 121 taaaagaagtcacggacacaga 142 |||||||||||||||||||||| Sbjct: 874 taaaagaagtcacggacacaga 853
>gb|AC154767.2| Mus musculus BAC clone RP23-105P19 from chromosome 13, complete sequence Length = 189362 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Plus Query: 121 taaaagaagtcacggacacaga 142 |||||||||||||||||||||| Sbjct: 22495 taaaagaagtcacggacacaga 22516
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Plus Query: 345 tctcggccaccttgagccgctc 366 |||||||||||||||||||||| Sbjct: 3855385 tctcggccaccttgagccgctc 3855406
>dbj|AB083111.1| Mus musculus mRNA for cytokine receptor NR10, complete cds Length = 3680 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Minus Query: 121 taaaagaagtcacggacacaga 142 |||||||||||||||||||||| Sbjct: 1294 taaaagaagtcacggacacaga 1273
>ref|XM_507368.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA Length = 1156 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 791 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 747
>ref|XM_478692.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1152 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 786 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 742
>ref|XM_507367.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA Length = 1162 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749
>ref|XM_507366.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA Length = 1183 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749
>ref|XM_506405.2| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA Length = 1221 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 807 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 763
>gb|AC149483.1| Populus trichocarpa clone Pop1-69I13, complete sequence Length = 51685 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atcccattcaatccatgcgtc 195 ||||||||||||||||||||| Sbjct: 5637 atcccattcaatccatgcgtc 5617
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Plus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 22263178 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 22263222
>dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0567H04 Length = 181420 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Plus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 68424 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 68468
>dbj|AK119534.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B02, full insert sequence Length = 1234 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749
>dbj|AK104619.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F11, full insert sequence Length = 1152 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 786 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 742
>dbj|AK104309.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D03, full insert sequence Length = 1169 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 800 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 756
>dbj|AK103924.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-C12, full insert sequence Length = 1183 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749
>dbj|AK098992.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H13, full insert sequence Length = 1156 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 791 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 747
>dbj|AK058293.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-F01, full insert sequence Length = 1221 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 807 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 763
>gb|AF058796.1|AF058796 Oryza sativa chlorophyll a/b-binding protein (RCABP69) mRNA, complete cds Length = 1178 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366 |||||||||||| | |||||||||||| |||| || |||||||| Sbjct: 791 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 747
>gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosome 14, complete sequence Length = 199215 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 tatatattacatggtacata 68 |||||||||||||||||||| Sbjct: 53057 tatatattacatggtacata 53076
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 260 ccgagcgcgccgagcggcgt 279 |||||||||||||||||||| Sbjct: 1691401 ccgagcgcgccgagcggcgt 1691420
>gb|L16687.2| Caenorhabditis elegans cosmid C04D8, complete sequence Length = 21034 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 297 cgaagtagaagatgagcatg 316 |||||||||||||||||||| Sbjct: 13041 cgaagtagaagatgagcatg 13022
>emb|AL391601.6| Human DNA sequence from clone RP11-551D9 on chromosome 13, complete sequence Length = 145871 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 aaatgtcttttgcccattct 25 |||||||||||||||||||| Sbjct: 67934 aaatgtcttttgcccattct 67953
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 260 ccgagcgcgccgagcggcgt 279 |||||||||||||||||||| Sbjct: 3026363 ccgagcgcgccgagcggcgt 3026382
>emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 55 Length = 194916 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 245 aaatcatcttatagaccgag 264 |||||||||||||||||||| Sbjct: 55520 aaatcatcttatagaccgag 55539
>emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BAC clone F18E5 (ESSAII project) Length = 95266 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 245 aaatcatcttatagaccgag 264 |||||||||||||||||||| Sbjct: 42512 aaatcatcttatagaccgag 42531
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 258 gaccgagcgcgccgagcggc 277 |||||||||||||||||||| Sbjct: 404087 gaccgagcgcgccgagcggc 404068
>gb|AC113380.2| Homo sapiens chromosome 5 clone RP11-304B20, complete sequence Length = 143534 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 actatatattacatggtaca 66 |||||||||||||||||||| Sbjct: 110106 actatatattacatggtaca 110125
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 260 ccgagcgcgccgagcggcgt 279 |||||||||||||||||||| Sbjct: 2175170 ccgagcgcgccgagcggcgt 2175189
>emb|AJ006296.1|HVU6296 Hordeum vulgare partial mRNA for chlorophyll a/b-binding protein Length = 470 Score = 40.1 bits (20), Expect = 5.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 322 catggcgaggcgcgagtgcttgatctcggcca 353 |||||||||||| | |||||||||||| |||| Sbjct: 107 catggcgaggcgggcgtgcttgatctccgcca 76
>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome Length = 2178400 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 358 gagccgctcaagcttctcgg 377 |||||||||||||||||||| Sbjct: 1360159 gagccgctcaagcttctcgg 1360140
>gb|AC121960.3| Mus musculus BAC clone RP24-248C17 from 14, complete sequence Length = 160030 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tatatattacatggtacata 68 |||||||||||||||||||| Sbjct: 14348 tatatattacatggtacata 14329 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,251,409 Number of Sequences: 3902068 Number of extensions: 4251409 Number of successful extensions: 64266 Number of sequences better than 10.0: 65 Number of HSP's better than 10.0 without gapping: 65 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 63680 Number of HSP's gapped (non-prelim): 586 length of query: 392 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 370 effective length of database: 17,147,199,772 effective search space: 6344463915640 effective search space used: 6344463915640 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)