>gb|AC007807.8|AC007807 Drosophila melanogaster, chromosome 3R, region 89E-89E, BAC clone
              BACR01E04, complete sequence
          Length = 172674

 Score = 46.1 bits (23), Expect = 0.038
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 79     aataaaacaagagcgcattttgtttctcttt 109
              ||||||||||||| ||||||| |||||||||
Sbjct: 104407 aataaaacaagagagcattttctttctcttt 104437

>gb|AC007824.5|AC007824 Drosophila melanogaster, chromosome 3R, region 89E-90A, BAC clone
             BACR02L16, complete sequence
          Length = 190866

 Score = 46.1 bits (23), Expect = 0.038
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 79    aataaaacaagagcgcattttgtttctcttt 109
             ||||||||||||| ||||||| |||||||||
Sbjct: 44937 aataaaacaagagagcattttctttctcttt 44967

>gb|AF183178.1|AF183178S1 Drosophila melanogaster filamin isoforms A and B (Filamin) gene,
            exons 1 and 2
          Length = 5153

 Score = 46.1 bits (23), Expect = 0.038
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 79   aataaaacaagagcgcattttgtttctcttt 109
            ||||||||||||| ||||||| |||||||||
Sbjct: 1587 aataaaacaagagagcattttctttctcttt 1557

>gb|AE003716.5| Drosophila melanogaster chromosome 3R, section 54 of 118 of the
             complete sequence
          Length = 220035

 Score = 46.1 bits (23), Expect = 0.038
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 79    aataaaacaagagcgcattttgtttctcttt 109
             ||||||||||||| ||||||| |||||||||
Sbjct: 90982 aataaaacaagagagcattttctttctcttt 91012

>gb|AC122047.4| Mus musculus BAC clone RP24-456A9 from chromosome 2, complete sequence
          Length = 172110

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 165    gtgtgcagccgagcattttt 184
              ||||||||||||||||||||
Sbjct: 110194 gtgtgcagccgagcattttt 110213

>gb|AC158365.2| Mus musculus BAC clone RP23-182N12 from chromosome 12, complete sequence
          Length = 220129

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 154    aatctatcaatgtgtgcagc 173
              ||||||||||||||||||||
Sbjct: 102824 aatctatcaatgtgtgcagc 102805

>gb|AC007756.5|AC007756 Drosophila melanogaster, chromosome 3R, region 92E-92E, BAC clone
             BACR10P06, complete sequence
          Length = 170105

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   gagcacatgcatcaacctca 140
             ||||||||||||||||||||
Sbjct: 95042 gagcacatgcatcaacctca 95023

>gb|AC007757.5|AC007757 Drosophila melanogaster, chromosome 3R, region 92E-92F, BAC clone
             BACR13J19, complete sequence
          Length = 170939

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   gagcacatgcatcaacctca 140
             ||||||||||||||||||||
Sbjct: 11845 gagcacatgcatcaacctca 11826

>gb|AE003730.3| Drosophila melanogaster chromosome 3R, section 68 of 118 of the complete
              sequence
          Length = 221402

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    gagcacatgcatcaacctca 140
              ||||||||||||||||||||
Sbjct: 187426 gagcacatgcatcaacctca 187407

>emb|AL928635.5| Mouse DNA sequence from clone RP23-410E7 on chromosome 2, complete
              sequence
          Length = 175392

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 165    gtgtgcagccgagcattttt 184
              ||||||||||||||||||||
Sbjct: 114413 gtgtgcagccgagcattttt 114394

>gb|AC101593.16| Mus musculus chromosome 18, clone RP23-198A7, complete sequence
          Length = 206936

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 68     gcataataacgaataaaacaaga 90
              ||||||||| |||||||||||||
Sbjct: 133486 gcataataatgaataaaacaaga 133508

>gb|AF203536.1| Clover yellow vein virus polyprotein gene, partial cds
          Length = 1640

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 34  tgcatccatgatcgaagct 52
           |||||||||||||||||||
Sbjct: 384 tgcatccatgatcgaagct 402

>gb|AF185069.1| Leishmania donovani 5FI8BORFP and ADP-ribosylation factor-like
           protein 3A (ARL-3A) genes, complete cds; and 3FI8BORFP
           gene, partial cds
          Length = 3887

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 167 gtgcagccgagcatttttt 185
           |||||||||||||||||||
Sbjct: 148 gtgcagccgagcatttttt 166

>emb|CR759843.7| Zebrafish DNA sequence from clone DKEYP-82B4 in linkage group 22,
             complete sequence
          Length = 190165

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 94    cattttgtttctctttcgg 112
             |||||||||||||||||||
Sbjct: 57784 cattttgtttctctttcgg 57766

>emb|AL355344.20| Human DNA sequence from clone RP11-710A11 on chromosome 10 Contains the
             3' end for a novel gene (KIAA1274), the PRF1 gene
             forperforin 1 (pore forming protein), the 5' end of the
             ADAMTS14 gene for a disintegrin-like and metalloprotease
             (reprolysin type) with thrombospondin type 1 motif 14, and
             one CpG island, complete sequence
          Length = 149490

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 88    agagcgcattttgtttctc 106
             |||||||||||||||||||
Sbjct: 60176 agagcgcattttgtttctc 60158

>emb|AL137060.13| Human DNA sequence from clone RP11-34F20 on chromosome 13 Contains the 3'
              end of the RFP2 gene for ret finger protein 2, the DLEU2
              gene for deleted in lymphocytic leukemia 2 (LEU2 BCMSUN),
              the 5' end of the DLEU1 gene for deleted in lymphocytic
              leukemia 1 (BCMS LEU1), a ribosomal protein L18 (RPL18)
              pseudogene, a novel gene and four CpG islands, complete
              sequence
          Length = 154887

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 24     atatatataatgcatccat 42
              |||||||||||||||||||
Sbjct: 148088 atatatataatgcatccat 148070

>emb|AL590450.1|CNS07EGH chromosome XI of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 267509

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 133   caacctcattatccaggtc 151
             |||||||||||||||||||
Sbjct: 77200 caacctcattatccaggtc 77182

>emb|AJ012470.1|ECU012470 Encephalitozoon cuniculi genes encoding mitochondrial-type hsp70,
            tryptophanyl tRNA synthetase and zinc finger protein
          Length = 2585

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 133  caacctcattatccaggtc 151
            |||||||||||||||||||
Sbjct: 1201 caacctcattatccaggtc 1183

>emb|BX897726.10| Zebrafish DNA sequence from clone DKEY-7J22 in linkage group 14,
             complete sequence
          Length = 143690

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 94    cattttgtttctctttcgg 112
             |||||||||||||||||||
Sbjct: 11291 cattttgtttctctttcgg 11309

>gb|AF440619.1|AF440619 Homo sapiens 13q14 chronic lymphocytic leukemia suppressor locus section
              1 of 2
          Length = 350000

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 24     atatatataatgcatccat 42
              |||||||||||||||||||
Sbjct: 205295 atatatataatgcatccat 205277

>gb|AF279660.2|AF279660 Homo sapiens CAR (RFP2) gene, complete cds; DLEU2 and DLEU1 genes,
              complete sequence; and RPL18 and p48/Hip pseudogenes,
              complete sequence
          Length = 347503

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 24     atatatataatgcatccat 42
              |||||||||||||||||||
Sbjct: 157576 atatatataatgcatccat 157558

>gb|AC069475.27| Homo sapiens chromosome 13 clone 317g11 map 13q14, complete sequence
          Length = 153092

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 24     atatatataatgcatccat 42
              |||||||||||||||||||
Sbjct: 105905 atatatataatgcatccat 105887

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 21       gggatatatataatgcatc 39
                |||||||||||||||||||
Sbjct: 18519989 gggatatatataatgcatc 18520007

>gb|AC026723.5|AC026723 Homo sapiens chromosome 5 clone CTD-2209N14, complete sequence
          Length = 131999

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 71    taataacgaataaaacaag 89
             |||||||||||||||||||
Sbjct: 44925 taataacgaataaaacaag 44907

>gb|AE013218.1| Buchnera aphidicola str. Sg (Schizaphis graminum), complete genome
          Length = 641454

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 117    ggaagagcacatgcatcaa 135
              |||||||||||||||||||
Sbjct: 229800 ggaagagcacatgcatcaa 229818

>dbj|AP003956.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1457_D07
          Length = 103688

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    gggatatatataatgcatc 39
             |||||||||||||||||||
Sbjct: 48745 gggatatatataatgcatc 48763

>gb|AF185959.1|AF185959 Clover yellow vein virus polyprotein gene, partial cds
          Length = 1618

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 34  tgcatccatgatcgaagct 52
           |||||||||||||||||||
Sbjct: 384 tgcatccatgatcgaagct 402

>gb|DQ333346.1| Clover yellow vein virus polyprotein gene, partial cds
          Length = 1640

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 34  tgcatccatgatcgaagct 52
           |||||||||||||||||||
Sbjct: 384 tgcatccatgatcgaagct 402

>dbj|AB011819.1| Clover yellow vein virus genomic RNA for polyprotein, complete cds
          Length = 9584

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 34   tgcatccatgatcgaagct 52
            |||||||||||||||||||
Sbjct: 8341 tgcatccatgatcgaagct 8359

>dbj|AB003308.1| Clover yellow vein virus genomic RNA for polyprotein, partial cds,
           isolate:NFU
          Length = 1819

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 34  tgcatccatgatcgaagct 52
           |||||||||||||||||||
Sbjct: 576 tgcatccatgatcgaagct 594

>dbj|D86044.1|CYVNIB Clover yellow vein virus genomic RNA for coat protein, partial cds
          Length = 1351

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 34  tgcatccatgatcgaagct 52
           |||||||||||||||||||
Sbjct: 108 tgcatccatgatcgaagct 126

>dbj|D89539.1| Clover yellow vein virus genomic RNA for polyprotein, partial
          cds, isolate:90-1
          Length = 1249

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 34 tgcatccatgatcgaagct 52
          |||||||||||||||||||
Sbjct: 6  tgcatccatgatcgaagct 24


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,880,217
Number of Sequences: 3902068
Number of extensions: 1880217
Number of successful extensions: 112850
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 112759
Number of HSP's gapped (non-prelim): 91
length of query: 188
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 166
effective length of database: 17,147,199,772
effective search space: 2846435162152
effective search space used: 2846435162152
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)