>ref|XM_955234.1| Neurospora crassa OR74A hypothetical protein (NCU07062.1) partial
           mRNA
          Length = 1506

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 70  gacaaactttgatgccacat 89
           ||||||||||||||||||||
Sbjct: 657 gacaaactttgatgccacat 676

>ref|XM_327347.1| Neurospora crassa OR74A hypothetical protein (NCU07062.1) partial
           mRNA
          Length = 1506

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 70  gacaaactttgatgccacat 89
           ||||||||||||||||||||
Sbjct: 657 gacaaactttgatgccacat 676

>gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESRRG) gene, complete cds
          Length = 590284

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 95     attgcacacactgaaaatga 114
              ||||||||||||||||||||
Sbjct: 276416 attgcacacactgaaaatga 276397

>dbj|AP008943.1| Oryzias latipes mitochondrial DNA, complete genome, isolate: Toyooka
          Length = 16437

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 31   taattctctagttctaatgacact 54
            ||||||||| ||||||||||||||
Sbjct: 8882 taattctcttgttctaatgacact 8905

>gb|AC096635.2| Homo sapiens chromosome 1 clone RP11-75H16, complete sequence
          Length = 173256

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 95     attgcacacactgaaaatga 114
              ||||||||||||||||||||
Sbjct: 168190 attgcacacactgaaaatga 168209

>gb|AC159237.2| Mus musculus BAC clone RP24-464G10 from chromosome 12, complete
             sequence
          Length = 222209

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 93    ttattgcacacactgaaaatgaag 116
             |||||||| |||||||||||||||
Sbjct: 31330 ttattgcagacactgaaaatgaag 31307

>dbj|AB075013.2| Rattus norvegicus gene, complete cds
          Length = 11945

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 93   ttattgcacacactgaaaatgaag 116
            |||||||| |||||||||||||||
Sbjct: 5316 ttattgcagacactgaaaatgaag 5293

>gb|AC127582.4| Mus musculus BAC clone RP24-89J3 from 12, complete sequence
          Length = 217949

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 93    ttattgcacacactgaaaatgaag 116
             |||||||| |||||||||||||||
Sbjct: 76428 ttattgcagacactgaaaatgaag 76451

>gb|AC018356.26| Homo sapiens 3 BAC RP11-258G22 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 120846

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 73    aaactttgatgccacattc 91
             |||||||||||||||||||
Sbjct: 77595 aaactttgatgccacattc 77577


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 860,173
Number of Sequences: 3902068
Number of extensions: 860173
Number of successful extensions: 48760
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48743
Number of HSP's gapped (non-prelim): 17
length of query: 116
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 95
effective length of database: 17,151,101,840
effective search space: 1629354674800
effective search space used: 1629354674800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)