ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet98c08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY921641.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR4... 56 7e-05
2emb|AJ297421.1|DCA297421 Daucus carota partial mRNA for putative... 56 7e-05
3emb|BX814348.1|CNS0ABZY Arabidopsis thaliana Full-length cDNA Co... 50 0.004
4ref|NM_106319.3| Arabidopsis thaliana OPR2; 12-oxophytodienoate ... 46 0.066
5ref|NM_106320.2| Arabidopsis thaliana heat shock protein binding... 46 0.066
6gb|BT025251.1| Arabidopsis thaliana At1g76690 mRNA, complete cds 46 0.066
7emb|BX813593.1|CNS0ACEC Arabidopsis thaliana Full-length cDNA Co... 46 0.066
8emb|BX816752.1|CNS0ABN0 Arabidopsis thaliana Full-length cDNA Co... 46 0.066
9emb|BX816748.1|CNS0ABM5 Arabidopsis thaliana Full-length cDNA Co... 46 0.066
10gb|AC010718.5|AC010718 Arabidopsis thaliana chromosome 1 BAC F28... 46 0.066
11dbj|AK117738.1| Arabidopsis thaliana At1g76690 mRNA for putative... 46 0.066
12gb|U92460.1|ATU92460 Arabidopsis thaliana 12-oxophytodienoate re... 46 0.066
13ref|NM_202428.1| Arabidopsis thaliana OPR1; 12-oxophytodienoate ... 42 1.0
14ref|NM_106318.3| Arabidopsis thaliana OPR1; 12-oxophytodienoate ... 42 1.0
15gb|BT020365.1| Arabidopsis thaliana At1g76680 gene, complete cds 42 1.0
16ref|XM_470425.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.0
17gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 1.0
18emb|Y10617.1|AT12OXOPR A.thaliana mRNA for 12-oxo-phytodienoate ... 42 1.0
19emb|Y10253.1|OSPANC O.sativa panC gene 42 1.0
20gb|AY074874.1| Arabidopsis thaliana At1g76680/F28O16_5 mRNA, com... 42 1.0
21dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.0
22emb|BX816218.1|CNS0ABRK Arabidopsis thaliana Full-length cDNA Co... 42 1.0
23emb|BX841572.1|CNS09YFC Arabidopsis thaliana Full-length cDNA Co... 42 1.0
24gb|AY087801.1| Arabidopsis thaliana clone 38527 mRNA, complete s... 42 1.0
25gb|AC096688.4| Oryza sativa chromosome 3 BAC OSJNBa0015N08 genom... 42 1.0
26dbj|AK104812.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.0
27emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 42 1.0
28dbj|AK066656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.0
29gb|AY921643.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR6... 40 4.1
30dbj|AB236163.1| Pichia minuta ADE1 gene for Phosphoribosyl-amino... 40 4.1
31gb|AC154731.2| Mus musculus BAC clone RP23-121M22 from chromosom... 40 4.1
32gb|AC154361.2| Mus musculus BAC clone RP23-170I24 from chromosom... 40 4.1
33dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.1
34dbj|AP003236.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.1
35dbj|AP002914.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.1
36dbj|AK121554.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.1
37gb|AY106849.1| Zea mays PCO134627 mRNA sequence 40 4.1

>gb|AY921641.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR4) mRNA, complete cds
          Length = 1833

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 64   cgaggaaggggtaatcggtgtatccaacgatggggtccgaggtgtagaaggt 115
            |||| |||||||| || |||||||||| || |||||| ||||||||||||||
Sbjct: 1750 cgagaaaggggtagtctgtgtatccaatgacggggtcggaggtgtagaaggt 1699



to top

>emb|AJ297421.1|DCA297421 Daucus carota partial mRNA for putative 12-oxophytodienoate
           reductase (opr2 gene)
          Length = 261

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 149 ctcaaaccgctttggcaggtctgggtttgccaggaa 184
           ||||||||||||||| || |||||||||||||||||
Sbjct: 197 ctcaaaccgctttggtagatctgggtttgccaggaa 162



to top

>emb|BX814348.1|CNS0ABZY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB69ZE10 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1221

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 61   attcgaggaaggggtaatcggtgtatccaacga 93
            |||||||||| |||||||||||||| |||||||
Sbjct: 1167 attcgaggaaagggtaatcggtgtaaccaacga 1135



to top

>ref|NM_106319.3| Arabidopsis thaliana OPR2; 12-oxophytodienoate reductase AT1G76690
            (OPR2) mRNA, complete cds
          Length = 1573

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 153  aaccgctttggcaggtctgggtt 175
            |||||||||||||||||||||||
Sbjct: 1108 aaccgctttggcaggtctgggtt 1086



to top

>ref|NM_106320.2| Arabidopsis thaliana heat shock protein binding / unfolded protein
            binding AT1G76700 mRNA, complete cds
          Length = 2266

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 153  aaccgctttggcaggtctgggtt 175
            |||||||||||||||||||||||
Sbjct: 1790 aaccgctttggcaggtctgggtt 1812



to top

>gb|BT025251.1| Arabidopsis thaliana At1g76690 mRNA, complete cds
          Length = 1125

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 153  aaccgctttggcaggtctgggtt 175
            |||||||||||||||||||||||
Sbjct: 1022 aaccgctttggcaggtctgggtt 1000



to top

>emb|BX813593.1|CNS0ACEC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB26ZH11 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1264

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 153  aaccgctttggcaggtctgggtt 175
            |||||||||||||||||||||||
Sbjct: 1076 aaccgctttggcaggtctgggtt 1054



to top

>emb|BX816752.1|CNS0ABN0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH66ZH10 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1296

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 153  aaccgctttggcaggtctgggtt 175
            |||||||||||||||||||||||
Sbjct: 1108 aaccgctttggcaggtctgggtt 1086



to top

>emb|BX816748.1|CNS0ABM5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH66ZG08 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1226

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 153  aaccgctttggcaggtctgggtt 175
            |||||||||||||||||||||||
Sbjct: 1061 aaccgctttggcaggtctgggtt 1039



to top

>gb|AC010718.5|AC010718 Arabidopsis thaliana chromosome 1 BAC F28O16 genomic sequence, complete
             sequence
          Length = 87684

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 153   aaccgctttggcaggtctgggtt 175
             |||||||||||||||||||||||
Sbjct: 17024 aaccgctttggcaggtctgggtt 17002



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 61    attcgaggaaggggtaatcggtgta 85
             |||||||||| ||||||||||||||
Sbjct: 15032 attcgaggaaagggtaatcggtgta 15008



to top

>dbj|AK117738.1| Arabidopsis thaliana At1g76690 mRNA for putative 12-oxophytodienoate
            reductase (OPR2), complete cds, clone: RAFL17-42-I17
          Length = 1313

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 153  aaccgctttggcaggtctgggtt 175
            |||||||||||||||||||||||
Sbjct: 1082 aaccgctttggcaggtctgggtt 1060



to top

>gb|U92460.1|ATU92460 Arabidopsis thaliana 12-oxophytodienoate reductase OPR1 and
            12-oxophytodienoate reductase OPR2 genes, complete cds
          Length = 7079

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 153  aaccgctttggcaggtctgggtt 175
            |||||||||||||||||||||||
Sbjct: 6618 aaccgctttggcaggtctgggtt 6596



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 61   attcgaggaaggggtaatcggtgta 85
            |||||||||| ||||||||||||||
Sbjct: 4626 attcgaggaaagggtaatcggtgta 4602



to top

>ref|NM_202428.1| Arabidopsis thaliana OPR1; 12-oxophytodienoate reductase AT1G76680
            (OPR1) transcript variant AT1G76680.2 mRNA, complete cds
          Length = 1460

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 61   attcgaggaaggggtaatcggtgta 85
            |||||||||| ||||||||||||||
Sbjct: 1253 attcgaggaaagggtaatcggtgta 1229



to top

>ref|NM_106318.3| Arabidopsis thaliana OPR1; 12-oxophytodienoate reductase AT1G76680
            (OPR1) transcript variant AT1G76680.1 mRNA, complete cds
          Length = 1451

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 61   attcgaggaaggggtaatcggtgta 85
            |||||||||| ||||||||||||||
Sbjct: 1244 attcgaggaaagggtaatcggtgta 1220



to top

>gb|BT020365.1| Arabidopsis thaliana At1g76680 gene, complete cds
          Length = 1119

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 61   attcgaggaaggggtaatcggtgta 85
            |||||||||| ||||||||||||||
Sbjct: 1108 attcgaggaaagggtaatcggtgta 1084



to top

>ref|XM_470425.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1220

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 243 tcgcggtcgtacccaccattggcta 267
           ||||||||||||||||||| |||||
Sbjct: 146 tcgcggtcgtacccaccatgggcta 170



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 243      tcgcggtcgtacccaccattggcta 267
                ||||||||||||||||||| |||||
Sbjct: 35561461 tcgcggtcgtacccaccatgggcta 35561485



to top

>emb|Y10617.1|AT12OXOPR A.thaliana mRNA for 12-oxo-phytodienoate reductase
          Length = 1311

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 61   attcgaggaaggggtaatcggtgta 85
            |||||||||| ||||||||||||||
Sbjct: 1173 attcgaggaaagggtaatcggtgta 1149



to top

>emb|Y10253.1|OSPANC O.sativa panC gene
          Length = 1264

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 243 tcgcggtcgtacccaccattggcta 267
           ||||||||||||||||||| |||||
Sbjct: 163 tcgcggtcgtacccaccatgggcta 187



to top

>gb|AY074874.1| Arabidopsis thaliana At1g76680/F28O16_5 mRNA, complete cds
          Length = 1252

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 61   attcgaggaaggggtaatcggtgta 85
            |||||||||| ||||||||||||||
Sbjct: 1178 attcgaggaaagggtaatcggtgta 1154



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 243      tcgcggtcgtacccaccattggcta 267
                ||||||||||||||||||| |||||
Sbjct: 35651533 tcgcggtcgtacccaccatgggcta 35651557



to top

>emb|BX816218.1|CNS0ABRK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH34ZH11 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1237

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 61   attcgaggaaggggtaatcggtgta 85
            |||||||||| ||||||||||||||
Sbjct: 1162 attcgaggaaagggtaatcggtgta 1138



to top

>emb|BX841572.1|CNS09YFC Arabidopsis thaliana Full-length cDNA Complete sequence from
          clone GSLTPGH92ZF02 of Hormone Treated Callus of strain
          col-0 of Arabidopsis thaliana (thale cress)
          Length = 1165

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 61 attcgaggaaggggtaatcggtgta 85
          |||||||||| ||||||||||||||
Sbjct: 61 attcgaggaaagggtaatcggtgta 85



to top

>gb|AY087801.1| Arabidopsis thaliana clone 38527 mRNA, complete sequence
          Length = 1280

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 61   attcgaggaaggggtaatcggtgta 85
            |||||||||| ||||||||||||||
Sbjct: 1178 attcgaggaaagggtaatcggtgta 1154



to top

>gb|AC096688.4| Oryza sativa chromosome 3 BAC OSJNBa0015N08 genomic sequence, complete
             sequence
          Length = 145290

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 243   tcgcggtcgtacccaccattggcta 267
             ||||||||||||||||||| |||||
Sbjct: 94424 tcgcggtcgtacccaccatgggcta 94448



to top

>dbj|AK104812.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G05, full
           insert sequence
          Length = 1160

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 243 tcgcggtcgtacccaccattggcta 267
           ||||||||||||||||||| |||||
Sbjct: 76  tcgcggtcgtacccaccatgggcta 100



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 206     gtcggtgtatccctcggtgatcaccttgc 234
               ||||||||| |||||| ||||||||||||
Sbjct: 1322892 gtcggtgtagccctcgatgatcaccttgc 1322920



to top

>dbj|AK066656.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013072H13, full
           insert sequence
          Length = 1220

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 243 tcgcggtcgtacccaccattggcta 267
           ||||||||||||||||||| |||||
Sbjct: 148 tcgcggtcgtacccaccatgggcta 172



to top

>gb|AY921643.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR6) mRNA, complete cds
          Length = 1267

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 102  gaggtgtagaaggtcatcctatcgtacttgttcagc 137
            ||||| ||||||||  ||||||| ||||||||||||
Sbjct: 1108 gaggtatagaaggtgctcctatcatacttgttcagc 1073



to top

>dbj|AB236163.1| Pichia minuta ADE1 gene for
            Phosphoribosyl-amino-imidazolesuccinocarbozamide
            synthetase, complete cds
          Length = 2560

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 132  ttcagctctgcgccaacctc 151
            ||||||||||||||||||||
Sbjct: 1381 ttcagctctgcgccaacctc 1362



to top

>gb|AC154731.2| Mus musculus BAC clone RP23-121M22 from chromosome 14, complete
             sequence
          Length = 215346

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    aaggaagaatctacatatat 56
             ||||||||||||||||||||
Sbjct: 54911 aaggaagaatctacatatat 54892



to top

>gb|AC154361.2| Mus musculus BAC clone RP23-170I24 from chromosome 14, complete sequence
          Length = 202760

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 37     aaggaagaatctacatatat 56
              ||||||||||||||||||||
Sbjct: 195527 aaggaagaatctacatatat 195508



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 229      ccttgcccccttcctcgcggtcgtaccc 256
                ||||| |||||||||| |||||||||||
Sbjct: 15175241 ccttgtccccttcctcccggtcgtaccc 15175268



to top

>dbj|AP003236.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0043B10
          Length = 167399

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 229    ccttgcccccttcctcgcggtcgtaccc 256
              ||||| |||||||||| |||||||||||
Sbjct: 147207 ccttgtccccttcctcccggtcgtaccc 147234



to top

>dbj|AP002914.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0493G01
          Length = 167587

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 229   ccttgcccccttcctcgcggtcgtaccc 256
             ||||| |||||||||| |||||||||||
Sbjct: 28614 ccttgtccccttcctcccggtcgtaccc 28641



to top

>dbj|AK121554.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033033G12, full
            insert sequence
          Length = 1613

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 229  ccttgcccccttcctcgcggtcgtaccc 256
            ||||| |||||||||| |||||||||||
Sbjct: 1211 ccttgtccccttcctcccggtcgtaccc 1184



to top

>gb|AY106849.1| Zea mays PCO134627 mRNA sequence
          Length = 1274

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 102  gaggtgtagaaggtcatcctatcgtacttgttcagc 137
            ||||| ||||||||  ||||||| ||||||||||||
Sbjct: 1115 gaggtatagaaggtgctcctatcatacttgttcagc 1080


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,632,024
Number of Sequences: 3902068
Number of extensions: 1632024
Number of successful extensions: 23874
Number of sequences better than 10.0: 37
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 23778
Number of HSP's gapped (non-prelim): 96
length of query: 310
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 288
effective length of database: 17,147,199,772
effective search space: 4938393534336
effective search space used: 4938393534336
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top