ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet95h06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF542967.1| Triticum aestivum annexin P35-like mRNA, partial ... 182 6e-43
2ref|XM_467846.1| Oryza sativa (japonica cultivar-group), mRNA 109 7e-21
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 109 7e-21
4dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic D... 109 7e-21
5dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic D... 109 7e-21
6dbj|AK101787.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-21
7dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 107 3e-20
8dbj|AP004727.2| Oryza sativa (japonica cultivar-group) genomic D... 107 3e-20
9dbj|AK072559.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 3e-20
10emb|X98245.1|ZMANNP35 Z.mays mRNA for annexin p35 80 6e-12
11gb|AY105105.1| Zea mays PCO122403 mRNA sequence 80 6e-12
12emb|X98244.2|ZMANNP33 Z.mays mRNA for annexin p33 76 1e-10
13gb|AY105151.1| Zea mays PCO072293 mRNA sequence 76 1e-10
14gb|AF373160.1| Rana macrocnemis macrocnemis haplotype M5 cytochr... 46 0.087
15gb|AF373159.1| Rana macrocnemis camerani haplotype M4 cytochrome... 46 0.087
16gb|AF373158.1| Rana macrocnemis macrocnemis haplotype M3 cytochr... 46 0.087
17gb|AF373157.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.087
18gb|AF373156.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.087
19gb|AF373155.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.087
20gb|AF373154.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.087
21gb|AF373153.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.087
22gb|AF373152.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.087
23gb|AF373151.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.087
24gb|AF373150.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.087
25gb|AF373149.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.087
26gb|AF373148.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.087
27gb|AF373147.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.087
28gb|AF373146.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.087
29gb|AF373145.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.087
30gb|AF373144.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.087
31gb|AF373143.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.087
32gb|AF373142.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.087
33gb|AF373141.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.087
34gb|AF373140.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.087
35gb|AF373139.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.087
36gb|AF373138.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.087
37gb|AF373137.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.087
38gb|AF373136.1| Rana macrocnemis camerani haplotype C6 cytochrome... 46 0.087
39gb|AF373135.1| Rana macrocnemis camerani haplotype C5 cytochrome... 46 0.087
40gb|AF373134.1| Rana macrocnemis camerani haplotype C5 cytochrome... 46 0.087
41gb|AF373133.1| Rana macrocnemis camerani haplotype C5 cytochrome... 46 0.087
42gb|AF373132.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.087
43gb|AF373131.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.087
44gb|AF373130.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.087
45gb|AF373129.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.087
46gb|AF373128.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.087
47gb|AF373127.1| Rana macrocnemis macrocnemis haplotype C4 cytochr... 46 0.087
48gb|AF373126.1| Rana macrocnemis macrocnemis haplotype C3 cytochr... 46 0.087
49gb|AF373125.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 46 0.087
50gb|AF373124.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 46 0.087
51gb|AF373123.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 46 0.087
52gb|AF373122.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.087
53gb|AF373121.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.087
54gb|AF373120.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.087
55gb|AF373119.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.087
56gb|AF373118.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.087
57gb|AF373117.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.087
58gb|AF373116.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.087
59gb|AF373115.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.087
60gb|AF373114.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.087
61gb|AY147969.1| Rana macrocnemis pseudodalmatina cytochrome b (cy... 46 0.087
62gb|AY147968.1| Rana macrocnemis macrocnemis cytochrome b (cytb) ... 46 0.087
63gb|AY147964.1| Rana holtzi cytochrome b (cytb) gene, partial cds... 46 0.087
64gb|AY147960.1| Rana macrocnemis cytochrome b (cytb) gene, partia... 46 0.087
65gb|AF021076.1| Megarthrus americanus cytochrome b (cytb) gene, m... 44 0.34
66gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, c... 42 1.4
67gb|DQ106808.1| Ephippiger provincialis clone Eprov7 cytochrome b... 42 1.4
68gb|AC104833.6| Mus Musculus Strain C57BL6/J Chromosome 15 BAC, R... 42 1.4
69dbj|AK082224.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 42 1.4
70dbj|AB201221.1| Microhyla ornata mitochondrial cytb gene for cyt... 42 1.4
71dbj|AB201218.1| Microhyla ornata mitochondrial cytb gene for cyt... 42 1.4
72dbj|AB201216.1| Microhyla ornata mitochondrial cytb gene for cyt... 42 1.4
73emb|AL136039.4|CNS01DVU Human chromosome 14 DNA sequence BAC R-7... 42 1.4
74gb|AC134914.5| Mus musculus BAC clone RP23-227C5 from 9, complet... 42 1.4
75ref|XM_775596.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 5.3
76emb|AJ298865.1|XLA298865 Xenopus laevis mRNA for winged helix tr... 40 5.3
77gb|AC011415.3| Homo sapiens chromosome 5 clone CTB-87P21, comple... 40 5.3
78gb|AC004823.1|AC004823 Homo sapiens PAC clone RP1-172A13 from Xq... 40 5.3
79gb|AC149341.2| Phakopsora pachyrhizi clone JGIAFNA-25D19, comple... 40 5.3

>gb|AF542967.1| Triticum aestivum annexin P35-like mRNA, partial sequence
          Length = 766

 Score =  182 bits (92), Expect = 6e-43
 Identities = 129/140 (92%), Gaps = 1/140 (0%)
 Strand = Plus / Minus

                                                                       
Query: 256 tccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcg 315
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 642 tccagcgggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcg 583

                                                                       
Query: 316 gcacgagtggttatcaccctagt-aagggtgtgctcgtctgtaccgacaccaccaagagc 374
           || ||||||||||| ||||| || |||||||| ||||||||| ||||| || ||||| ||
Sbjct: 582 gcgcgagtggttatgaccctcgtaaagggtgttctcgtctgtgccgacgcctccaagggc 523

                               
Query: 375 caaccggatgaccttctcaa 394
           ||||||||||| ||||||||
Sbjct: 522 caaccggatgatcttctcaa 503



to top

>ref|XM_467846.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1223

 Score =  109 bits (55), Expect = 7e-21
 Identities = 169/207 (81%)
 Strand = Plus / Minus

                                                                        
Query: 188  actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 247
            |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 1058 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 999

                                                                        
Query: 248  cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 307
            ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 998  cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 939

                                                                        
Query: 308  ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 367
            | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 938  ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 879

                                       
Query: 368  caagagccaaccggatgaccttctcaa 394
            | |||||||| || ||||| |||||||
Sbjct: 878  ctagagccaatcgaatgactttctcaa 852



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  109 bits (55), Expect = 7e-21
 Identities = 169/207 (81%)
 Strand = Plus / Plus

                                                                            
Query: 188      actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 247
                |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 31716862 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 31716921

                                                                            
Query: 248      cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 307
                ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 31716922 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 31716981

                                                                            
Query: 308      ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 367
                | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 31716982 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 31717041

                                           
Query: 368      caagagccaaccggatgaccttctcaa 394
                | |||||||| || ||||| |||||||
Sbjct: 31717042 ctagagccaatcgaatgactttctcaa 31717068



to top

>dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0627E03
          Length = 159861

 Score =  109 bits (55), Expect = 7e-21
 Identities = 169/207 (81%)
 Strand = Plus / Plus

                                                                         
Query: 188   actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 247
             |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 12660 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 12719

                                                                         
Query: 248   cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 307
             ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 12720 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 12779

                                                                         
Query: 308   ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 367
             | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 12780 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 12839

                                        
Query: 368   caagagccaaccggatgaccttctcaa 394
             | |||||||| || ||||| |||||||
Sbjct: 12840 ctagagccaatcgaatgactttctcaa 12866



to top

>dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1288_G09
          Length = 109672

 Score =  109 bits (55), Expect = 7e-21
 Identities = 169/207 (81%)
 Strand = Plus / Plus

                                                                         
Query: 188   actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 247
             |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 96649 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 96708

                                                                         
Query: 248   cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 307
             ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 96709 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 96768

                                                                         
Query: 308   ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 367
             | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 96769 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 96828

                                        
Query: 368   caagagccaaccggatgaccttctcaa 394
             | |||||||| || ||||| |||||||
Sbjct: 96829 ctagagccaatcgaatgactttctcaa 96855



to top

>dbj|AK101787.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033065F07, full
            insert sequence
          Length = 1223

 Score =  109 bits (55), Expect = 7e-21
 Identities = 169/207 (81%)
 Strand = Plus / Minus

                                                                        
Query: 188  actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 247
            |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 1058 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 999

                                                                        
Query: 248  cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 307
            ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 998  cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 939

                                                                        
Query: 308  ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 367
            | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 938  ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 879

                                       
Query: 368  caagagccaaccggatgaccttctcaa 394
            | |||||||| || ||||| |||||||
Sbjct: 878  ctagagccaatcgaatgactttctcaa 852



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                           
Query: 255     ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 314
               |||||| ||||| |||||||||||||||||||||||| | |||| |||||| ||||||||
Sbjct: 6264228 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 6264169

                                                         
Query: 315     ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 356
               |||||||||||| || | |||||| |||| || |||||||||
Sbjct: 6264168 ggcacgagtggtaatgatcctagtgagggagttctcgtctgt 6264127



to top

>dbj|AP004727.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0516A04
          Length = 145107

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                         
Query: 255   ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 314
             |||||| ||||| |||||||||||||||||||||||| | |||| |||||| ||||||||
Sbjct: 58304 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 58245

                                                       
Query: 315   ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 356
             |||||||||||| || | |||||| |||| || |||||||||
Sbjct: 58244 ggcacgagtggtaatgatcctagtgagggagttctcgtctgt 58203



to top

>dbj|AK072559.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132A10, full
           insert sequence
          Length = 1274

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 255 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 314
           |||||| ||||| |||||||||||||||||||||||| | |||| |||||| ||||||||
Sbjct: 977 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 918

                                                     
Query: 315 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 356
           |||||||||||| || | |||||| |||| || |||||||||
Sbjct: 917 ggcacgagtggtaatgatcctagtgagggagttctcgtctgt 876



to top

>emb|X98245.1|ZMANNP35 Z.mays mRNA for annexin p35
          Length = 1257

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                        
Query: 205  gcaagcatcatatcttcatagtctctggttgtgtccttggaaacagccttctccaggggg 264
            |||||||| ||||| ||||| ||||| ||||| || ||||  |||||   |||||| || 
Sbjct: 1057 gcaagcataatatcctcataatctctagttgtatctttggccacagcacgctccagcggc 998

                                                                        
Query: 265  acgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacgagtg 324
            || ||||| |||||||| || ||||||||||||| ||||||||| |||||||| ||||| 
Sbjct: 997  acactgtttctcttctgataagcctcctttatcagcttcaggtcgacctcggcgcgagta 938

                
Query: 325  gtta 328
            ||||
Sbjct: 937  gtta 934



to top

>gb|AY105105.1| Zea mays PCO122403 mRNA sequence
          Length = 1401

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                        
Query: 205  gcaagcatcatatcttcatagtctctggttgtgtccttggaaacagccttctccaggggg 264
            |||||||| ||||| ||||| ||||| ||||| || ||||  |||||   |||||| || 
Sbjct: 1151 gcaagcataatatcctcataatctctagttgtatctttggccacagcacgctccagcggc 1092

                                                                        
Query: 265  acgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacgagtg 324
            || ||||| |||||||| || ||||||||||||| ||||||||| |||||||| ||||| 
Sbjct: 1091 acactgtttctcttctgataagcctcctttatcagcttcaggtcgacctcggcgcgagta 1032

                
Query: 325  gtta 328
            ||||
Sbjct: 1031 gtta 1028



to top

>emb|X98244.2|ZMANNP33 Z.mays mRNA for annexin p33
          Length = 1277

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 86/102 (84%)
 Strand = Plus / Minus

                                                                       
Query: 255 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 314
           |||||| || ||||||||||||||||||||||||||||| ||||  || |||||||||||
Sbjct: 960 ctccagcggcacgctgttcctcttctggtacgcctccttaatcagtttgaggtccacctc 901

                                                     
Query: 315 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 356
            || || ||||| || ||||| || |||| || ||| |||||
Sbjct: 900 agcgcgggtggtgatgaccctggtcagggagttctcatctgt 859



to top

>gb|AY105151.1| Zea mays PCO072293 mRNA sequence
          Length = 1369

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 86/102 (84%)
 Strand = Plus / Minus

                                                                       
Query: 255 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 314
           |||||| || ||||||||||||||||||||||||||||| ||||  || |||||||||||
Sbjct: 977 ctccagcggcacgctgttcctcttctggtacgcctccttaatcagtttgaggtccacctc 918

                                                     
Query: 315 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 356
            || || ||||| || ||||| || |||| || ||| |||||
Sbjct: 917 agcgcgggtggtgatgaccctggtcagggagttctcatctgt 876



to top

>gb|AF373160.1| Rana macrocnemis macrocnemis haplotype M5 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373159.1| Rana macrocnemis camerani haplotype M4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373158.1| Rana macrocnemis macrocnemis haplotype M3 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373157.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373156.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373155.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373154.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373153.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373152.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373151.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373150.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373149.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373148.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373147.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373146.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373145.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373144.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373143.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373142.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373141.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373140.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373139.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373138.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373137.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373136.1| Rana macrocnemis camerani haplotype C6 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373135.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373134.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373133.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373132.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373131.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373130.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373129.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373128.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373127.1| Rana macrocnemis macrocnemis haplotype C4 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373126.1| Rana macrocnemis macrocnemis haplotype C3 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373125.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373124.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373123.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373122.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373121.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373120.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373119.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373118.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373117.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373116.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373115.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373114.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AY147969.1| Rana macrocnemis pseudodalmatina cytochrome b (cytb) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400



to top

>gb|AY147968.1| Rana macrocnemis macrocnemis cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400



to top

>gb|AY147964.1| Rana holtzi cytochrome b (cytb) gene, partial cds; mitochondrial
           gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400



to top

>gb|AY147960.1| Rana macrocnemis cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 137 atctcttattcctccatcaaaca 159
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400



to top

>gb|AF021076.1| Megarthrus americanus cytochrome b (cytb) gene, mitochondrial gene
           encoding mitochondrial protein, partial cds
          Length = 465

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 137 atctcttattcctccatcaaac 158
           ||||||||||||||||||||||
Sbjct: 185 atctcttattcctccatcaaac 206



to top

>gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, complete sequence
          Length = 191054

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 260    gggggacgctgttcctcttct 280
              |||||||||||||||||||||
Sbjct: 157842 gggggacgctgttcctcttct 157822



to top

>gb|DQ106808.1| Ephippiger provincialis clone Eprov7 cytochrome b (Cytb) gene,
           partial cds; mitochondrial
          Length = 427

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 139 ctcttattcctccatcaaaca 159
           |||||||||||||||||||||
Sbjct: 144 ctcttattcctccatcaaaca 164



to top

>gb|AC104833.6| Mus Musculus Strain C57BL6/J Chromosome 15 BAC, RP23-319B16, Complete
             Sequence, complete sequence
          Length = 171061

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 260   gggggacgctgttcctcttct 280
             |||||||||||||||||||||
Sbjct: 36422 gggggacgctgttcctcttct 36402



to top

>dbj|AK082224.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230026C11 product:hypothetical
            Beta tubulin containing protein, full insert sequence
          Length = 1819

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 260  gggggacgctgttcctcttct 280
            |||||||||||||||||||||
Sbjct: 1159 gggggacgctgttcctcttct 1139



to top

>dbj|AB201221.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial
           cds, specimen_voucher:KUHE34324
          Length = 629

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 139 ctcttattcctccatcaaaca 159
           |||||||||||||||||||||
Sbjct: 456 ctcttattcctccatcaaaca 476



to top

>dbj|AB201218.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial
           cds, specimen_voucher:KUHE34130
          Length = 625

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 139 ctcttattcctccatcaaaca 159
           |||||||||||||||||||||
Sbjct: 452 ctcttattcctccatcaaaca 472



to top

>dbj|AB201216.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial
           cds, specimen_voucher:KUHE21982
          Length = 629

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 139 ctcttattcctccatcaaaca 159
           |||||||||||||||||||||
Sbjct: 456 ctcttattcctccatcaaaca 476



to top

>emb|AL136039.4|CNS01DVU Human chromosome 14 DNA sequence BAC R-799P8 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 174788

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 153   tcaaacataaggtagatcaaacata 177
             |||||||| ||||||||||||||||
Sbjct: 56048 tcaaacattaggtagatcaaacata 56024



to top

>gb|AC134914.5| Mus musculus BAC clone RP23-227C5 from 9, complete sequence
          Length = 206831

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 22     tatttctgcagcttaaatgacgaaa 46
              ||||| |||||||||||||||||||
Sbjct: 165234 tatttatgcagcttaaatgacgaaa 165210



to top

>ref|XM_775596.1| PREDICTED: Strongylocentrotus purpuratus similar to tudor domain
            containing 1 (LOC575181), mRNA
          Length = 7881

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 293  ttatcaccttcaggtccacc 312
            ||||||||||||||||||||
Sbjct: 5800 ttatcaccttcaggtccacc 5781



to top

>emb|AJ298865.1|XLA298865 Xenopus laevis mRNA for winged helix transcription factor (foxd3a
           gene)
          Length = 3240

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 104 aaacaacacactcgccagttttat 127
           |||||||||||||||| |||||||
Sbjct: 478 aaacaacacactcgcctgttttat 455



to top

>gb|AC011415.3| Homo sapiens chromosome 5 clone CTB-87P21, complete sequence
          Length = 116976

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 190   tctgctcccagaagtgcaag 209
             ||||||||||||||||||||
Sbjct: 94606 tctgctcccagaagtgcaag 94587



to top

>gb|AC004823.1|AC004823 Homo sapiens PAC clone RP1-172A13 from Xq23, complete sequence
          Length = 115973

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     tcaaaacaccaatgatattt 26
             ||||||||||||||||||||
Sbjct: 17082 tcaaaacaccaatgatattt 17101



to top

>gb|AC149341.2| Phakopsora pachyrhizi clone JGIAFNA-25D19, complete sequence
          Length = 38997

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 138   tctcttattcctccatcaaa 157
             ||||||||||||||||||||
Sbjct: 21072 tctcttattcctccatcaaa 21091


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,658,968
Number of Sequences: 3902068
Number of extensions: 3658968
Number of successful extensions: 92930
Number of sequences better than 10.0: 79
Number of HSP's better than 10.0 without gapping: 79
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 92813
Number of HSP's gapped (non-prelim): 116
length of query: 400
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 378
effective length of database: 17,147,199,772
effective search space: 6481641513816
effective search space used: 6481641513816
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top