Clone Name | rbaet95g10 |
---|---|
Clone Library Name | barley_pub |
>gb|M58753.1|BLYACL1 Hordeum vulgare acyl carrier protein I (Acl1) gene, complete cds Length = 3822 Score = 99.6 bits (50), Expect = 9e-19 Identities = 66/70 (94%), Gaps = 1/70 (1%) Strand = Plus / Minus Query: 1 cataaatccattaccttttctataacaatag-tacaccacatatgaattcgaacttagga 59 |||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 3221 catagatccattagcttttctataacaataggtacaccacatatgaattcgaacttagga 3162 Query: 60 catggcccta 69 ||||| |||| Sbjct: 3161 catggtccta 3152
>emb|AL031779.5|HS445N2 Human DNA sequence from clone RP3-445N2 on chromosome 6p12.1-21.1 Contains the 5' end of the COL21A1 gene for collagen, type XXI, alpha 1 (collagen XXI, collagen, type XX, alpha 1, COLA1L, COL20A1, DKFZp564B052) and part of a novel gene, complete sequence Length = 101010 Score = 40.1 bits (20), Expect = 0.68 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 attaccttttctataacaat 29 |||||||||||||||||||| Sbjct: 27828 attaccttttctataacaat 27809
>gb|AF438327.1| Homo sapiens alpha 1 type XXI collagen precursor (COL21A1) gene, complete cds, alternatively spliced Length = 381696 Score = 40.1 bits (20), Expect = 0.68 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 attaccttttctataacaat 29 |||||||||||||||||||| Sbjct: 4075 attaccttttctataacaat 4056
>gb|AC129942.7| Mus musculus chromosome 8, clone RP23-267A22, complete sequence Length = 175030 Score = 38.2 bits (19), Expect = 2.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 4 aaatccattaccttttcta 22 ||||||||||||||||||| Sbjct: 92371 aaatccattaccttttcta 92389
>gb|AC119959.8| Mus musculus chromosome 15, clone RP24-467H19, complete sequence Length = 163783 Score = 38.2 bits (19), Expect = 2.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 6 atccattaccttttctata 24 ||||||||||||||||||| Sbjct: 147547 atccattaccttttctata 147565
>gb|AC157789.5| Mus musculus chromosome 8, clone RP24-95E2, complete sequence Length = 203403 Score = 38.2 bits (19), Expect = 2.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 4 aaatccattaccttttcta 22 ||||||||||||||||||| Sbjct: 192694 aaatccattaccttttcta 192676
>emb|AL589826.12| Human DNA sequence from clone RP11-67P15 on chromosome 6 Contains a ribosomal protein L6 (RPL6) pseudogene and a CpG island, complete sequence Length = 118097 Score = 38.2 bits (19), Expect = 2.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 aatccattaccttttctat 23 ||||||||||||||||||| Sbjct: 103399 aatccattaccttttctat 103381
>gb|AC155814.6| Mus musculus BAC clone RP24-137M22 from chromosome 8, complete sequence Length = 191336 Score = 38.2 bits (19), Expect = 2.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 4 aaatccattaccttttcta 22 ||||||||||||||||||| Sbjct: 190447 aaatccattaccttttcta 190465
>gb|AC007251.4| Homo sapiens BAC clone RP11-373G23 from 2, complete sequence Length = 180964 Score = 38.2 bits (19), Expect = 2.7 Identities = 22/23 (95%) Strand = Plus / Minus Query: 13 accttttctataacaatagtaca 35 |||||||||||||||||| |||| Sbjct: 54444 accttttctataacaatattaca 54422
>gb|AE017321.1| Wolbachia endosymbiont strain TRS of Brugia malayi, complete genome Length = 1080084 Score = 38.2 bits (19), Expect = 2.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 3 taaatccattaccttttct 21 ||||||||||||||||||| Sbjct: 822257 taaatccattaccttttct 822239 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 510,646 Number of Sequences: 3902068 Number of extensions: 510646 Number of successful extensions: 36488 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 36467 Number of HSP's gapped (non-prelim): 20 length of query: 69 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 48 effective length of database: 17,151,101,840 effective search space: 823252888320 effective search space used: 823252888320 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)