ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet95g07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome... 389 e-105
2gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome... 389 e-105
3dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 389 e-105
4ref|XM_475912.1| Oryza sativa (japonica cultivar-group), predic... 387 e-104
5dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8,... 379 e-102
6dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 373 e-100
7dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic D... 373 e-100
8ref|NM_184371.1| Oryza sativa (japonica cultivar-group), mRNA 371 1e-99
9emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B 371 1e-99
10gb|BT016429.1| Zea mays clone Contig262 mRNA sequence 365 8e-98
11emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221) 365 8e-98
12dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic D... 365 8e-98
13dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic D... 365 8e-98
14ref|NM_184409.1| Oryza sativa (japonica cultivar-group), mRNA 363 3e-97
15ref|NM_184407.1| Oryza sativa (japonica cultivar-group), mRNA 363 3e-97
16ref|NM_184399.1| Oryza sativa (japonica cultivar-group), mRNA 355 8e-95
17gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full... 355 8e-95
18dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6,... 355 8e-95
19gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds 355 8e-95
20dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B15... 351 1e-93
21gb|BT016519.1| Zea mays clone Contig352 mRNA sequence 345 7e-92
22gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence 341 1e-90
23gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full i... 341 1e-90
24dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 341 1e-90
25dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic D... 341 1e-90
26dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complet... 341 1e-90
27ref|NM_184405.1| Oryza sativa (japonica cultivar-group), mRNA 339 5e-90
28ref|NM_184403.1| Oryza sativa (japonica cultivar-group), mRNA 339 5e-90
29ref|NM_184374.1| Oryza sativa (japonica cultivar-group), mRNA 339 5e-90
30ref|XM_483094.1| Oryza sativa (japonica cultivar-group), mRNA 339 5e-90
31emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214) 333 3e-88
32emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3) 321 1e-84
33gb|BT016350.1| Zea mays clone Contig183 mRNA sequence 317 2e-83
34gb|BT016478.1| Zea mays clone Contig311 mRNA sequence 315 7e-83
35gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 313 3e-82
36gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str... 313 3e-82
37dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 313 3e-82
38gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence 309 4e-81
39emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4) 307 2e-80
40dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D... 297 2e-77
41gb|BT016885.1| Zea mays clone Contig718 mRNA sequence 289 4e-75
42gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, parti... 281 9e-73
43gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partia... 280 4e-72
44ref|NM_190523.1| Oryza sativa (japonica cultivar-group), predic... 272 9e-70
45dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic D... 272 9e-70
46dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic D... 272 9e-70
47emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B 258 1e-65
48ref|XM_475367.1| Oryza sativa (japonica cultivar-group), predic... 252 8e-64
49gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome... 252 8e-64
50gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds 228 1e-56
51dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B12... 210 3e-51
52dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 4e-47
53gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),... 192 7e-46
54gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 184 2e-43
55gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I... 176 4e-41
56gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 176 4e-41
57ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B hist... 147 4e-32
58ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone ... 147 4e-32
59ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B hist... 147 4e-32
60ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B hist... 147 4e-32
61ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B hist... 147 4e-32
62ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B hist... 147 4e-32
63ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260... 139 9e-30
64ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG1... 139 9e-30
65gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c... 137 3e-29
66ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus simila... 135 1e-28
67emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 133 5e-28
68gb|BC077399.1| Xenopus laevis histone H2B, mRNA (cDNA clone MGC:... 133 5e-28
69gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial... 133 5e-28
70gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 133 5e-28
71gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG... 131 2e-27
72gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG... 131 2e-27
73gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG... 131 2e-27
74gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IM... 131 2e-27
75ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA 131 2e-27
76emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 131 2e-27
77emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A 131 2e-27
78emb|CR541895.1| Homo sapiens full open reading frame cDNA clone ... 131 2e-27
79gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG... 131 2e-27
80gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, comple... 131 2e-27
81gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870.... 131 2e-27
82gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 131 2e-27
83gb|BC098112.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 131 2e-27
84ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA 131 2e-27
85gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MG... 131 2e-27
86gb|M60756.1|HUMHISH2BA Human histone H2B.1 mRNA, 3' end 131 2e-27
87emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC... 127 3e-26
88emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F0... 127 3e-26
89ref|XM_524860.1| PREDICTED: Pan troglodytes LOC469477 (LOC469477... 125 1e-25
90dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone ... 125 1e-25
91emb|CR855675.2| Xenopus tropicalis finished cDNA, clone TGas058p09 125 1e-25
92ref|XM_518301.1| PREDICTED: Pan troglodytes similar to histone H... 123 5e-25
93ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3... 123 5e-25
94emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chr... 123 5e-25
95emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N2... 123 5e-25
96ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudo... 123 5e-25
97ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudo... 123 5e-25
98gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, ... 123 5e-25
99gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, ... 123 5e-25
100gb|BC106916.1| Homo sapiens similar to histone H2B histone famil... 123 5e-25
101gb|BC073925.1| Homo sapiens similar to histone H2B histone famil... 123 5e-25
102gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes,... 123 5e-25
103gb|BC077692.1| Xenopus tropicalis histone 1, H2bk, mRNA (cDNA cl... 117 3e-23
104ref|NM_001006890.1| Xenopus tropicalis histone 1, H2bk (hist1h2b... 117 3e-23
105ref|XM_527280.1| PREDICTED: Pan troglodytes similar to ribosomal... 115 1e-22
106gb|BC101411.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 115 1e-22
107gb|BC101413.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 115 1e-22
108gb|BC101412.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 115 1e-22
109ref|NG_001335.1| Homo sapiens genomic large histone family clust... 115 1e-22
110ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 115 1e-22
111ref|NM_003522.3| Homo sapiens histone 1, H2bf (HIST1H2BF), mRNA 115 1e-22
112ref|NM_003520.3| Homo sapiens histone 1, H2bn (HIST1H2BN), mRNA 115 1e-22
113gb|BC011372.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone IM... 115 1e-22
114gb|AF531297.1| Homo sapiens histone H2B (HIST1H2BN) gene, comple... 115 1e-22
115gb|AF531289.1| Homo sapiens histone H2B (HIST1H2BF) gene, comple... 115 1e-22
116gb|BC009783.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 115 1e-22
117gb|BC056264.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IM... 115 1e-22
118emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o... 115 1e-22
119emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o... 115 1e-22
120emb|Z83336.1|HSZ83336 H.sapiens hH2B/d gene 115 1e-22
121gb|BC096123.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MG... 115 1e-22
122gb|BC096120.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MG... 115 1e-22
123dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501 115 1e-22
124emb|Z80779.1|HSH2BG H.sapiens H2B/g gene 115 1e-22
125ref|XM_782648.1| PREDICTED: Strongylocentrotus purpuratus simila... 113 5e-22
126ref|XM_785670.1| PREDICTED: Strongylocentrotus purpuratus simila... 113 5e-22
127ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus simila... 111 2e-21
128gb|M14142.1|SUPH2B1 P.miliaris histone H2B-2.1 gene, complete cds 111 2e-21
129emb|X14731.1|CMHIST2B Duck H2B histone gene 109 8e-21
130gb|BC095697.1| Danio rerio zgc:112234, mRNA (cDNA clone MGC:1122... 109 8e-21
131ref|NM_001024398.1| Danio rerio zgc:112234 (zgc:112234), mRNA 109 8e-21
132gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partia... 109 8e-21
133gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partia... 109 8e-21
134gb|U93853.1|ECU93853 Euplotes crassus histone H2B (H2B(2)) gene,... 109 8e-21
135ref|XM_525086.1| PREDICTED: Pan troglodytes similar to Histone H... 107 3e-20
136ref|NM_023422.2| Mus musculus histone 1, H2bc (Hist1h2bc), mRNA 107 3e-20
137gb|AY656810.1| Homo sapiens H2B/t variant gene, complete cds 107 3e-20
138gb|AY648853.1| Homo sapiens histone H2B/s (HIST2H2BD) gene, comp... 107 3e-20
139gb|BC082774.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone IM... 107 3e-20
140gb|BC071638.1| Homo sapiens cDNA clone IMAGE:4390105, containing... 107 3e-20
141ref|NM_175055.2| Homo sapiens histone 3, H2bb (HIST3H2BB), mRNA 107 3e-20
142ref|NM_003519.3| Homo sapiens histone 1, H2bl (HIST1H2BL), mRNA 107 3e-20
143gb|BC068044.1| Homo sapiens cDNA clone IMAGE:6380649, containing... 107 3e-20
144gb|AF531295.1| Homo sapiens histone H2B (HIST1H2BL) gene, comple... 107 3e-20
145gb|BC100857.1| Homo sapiens cDNA clone IMAGE:40002416, partial cds 107 3e-20
146emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr... 107 3e-20
147emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o... 107 3e-20
148emb|Z83740.1|HSZ83740 H.sapiens hH2B/c gene 107 3e-20
149emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone ... 107 3e-20
150emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 107 3e-20
151dbj|AK091220.1| Homo sapiens cDNA FLJ33901 fis, clone CTONG20083... 107 3e-20
152ref|XM_936779.1| PREDICTED: Homo sapiens similar to H2B histone ... 107 3e-20
153dbj|AB168579.1| Macaca fascicularis testis cDNA clone: QtsA-1317... 107 3e-20
154dbj|AK005191.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 107 3e-20
155dbj|AK005407.1| Mus musculus adult female placenta cDNA, RIKEN f... 107 3e-20
156ref|NG_002619.1| Homo sapiens histone 2, H2bc (HIST2H2BC) pseudo... 107 3e-20
157ref|NG_002620.1| Homo sapiens histone 2, H2bd (HIST2H2BD) pseudo... 107 3e-20
158dbj|AK011516.1| Mus musculus 10 days embryo whole body cDNA, RIK... 107 3e-20
159gb|BC093761.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MG... 107 3e-20
160gb|BC093759.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MG... 107 3e-20
161gb|AY131977.1| Homo sapiens histone H2B (HIST2H2BC) pseudogene, ... 107 3e-20
162gb|AY131978.1| Homo sapiens histone H2B (HIST2H2BD) pseudogene, ... 107 3e-20
163gb|AY131981.1| Homo sapiens histone H2B (HIST3H2BB) gene, comple... 107 3e-20
164gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, comp... 107 3e-20
165gb|AY158907.1| Mus musculus histone protein Hist1h1e gene, compl... 107 3e-20
166ref|NM_214552.1| Strongylocentrotus purpuratus late histone L1 H... 107 3e-20
167ref|XM_786200.1| PREDICTED: Strongylocentrotus purpuratus simila... 105 1e-19
168ref|XM_786178.1| PREDICTED: Strongylocentrotus purpuratus simila... 105 1e-19
169ref|XM_781061.1| PREDICTED: Strongylocentrotus purpuratus simila... 105 1e-19
170emb|X06643.1|SPH2BL4 Strongylocentrotus purpuratus late histone ... 105 1e-19
171ref|XM_954347.1| Neurospora crassa OR74A hypothetical protein (N... 103 5e-19
172ref|XM_331210.1| Neurospora crassa OR74A hypothetical protein (N... 103 5e-19
173emb|X03017.1|XLHISH1 Xenopus laevis histone gene cluster Xlh1 wi... 103 5e-19
174ref|XM_686839.1| PREDICTED: Danio rerio similar to histone 2, H2... 103 5e-19
175ref|XM_693375.1| PREDICTED: Danio rerio similar to histone 2, H2... 103 5e-19
176gb|M21286.1|XELHX1H1 X.laevis histone H1B, H2A, H2B, and H4 gene... 103 5e-19
177ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B... 101 2e-18
178ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B... 101 2e-18
179emb|CR669650.2|CNS0FFO8 Tetraodon nigroviridis full-length cDNA 101 2e-18
180ref|XM_504425.1| Yarrowia lipolytica CLIB122, YALI0E26455g predi... 101 2e-18
181emb|BX072512.1|CNS09S44 Single read from an extremity of a full-... 101 2e-18
182emb|BX072414.1|CNS09S1E Single read from an extremity of a full-... 101 2e-18
183emb|BX051496.1|CNS09BWC Single read from an extremity of a full-... 101 2e-18
184emb|BX051495.1|CNS09BWB Single read from an extremity of a full-... 101 2e-18
185emb|BX047440.1|CNS098RO Single read from an extremity of a full-... 101 2e-18
186emb|BX038423.1|CNS091T7 Single read from an extremity of a full-... 101 2e-18
187emb|BX032827.1|CNS08XHR Single read from an extremity of a full-... 101 2e-18
188emb|BX031663.1|CNS08WLF Single read from an extremity of a full-... 101 2e-18
189emb|BX021771.1|CNS08OYN Single read from an extremity of a full-... 101 2e-18
190emb|BX013307.1|CNS08IFJ Single read from an extremity of a full-... 101 2e-18
191emb|BX012776.1|CNS08I0S Single read from an extremity of a full-... 101 2e-18
192emb|BX012380.1|CNS08HPS Single read from an extremity of a full-... 101 2e-18
193emb|BX009211.1|CNS08F9R Single read from an extremity of a full-... 101 2e-18
194emb|X98185.1|AGH2B A.gambiae mRNA for histone H2B 101 2e-18
195emb|AJ556871.1|XLA556871 Expression vector pET3-H2B H2B gene for... 101 2e-18
196emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from cl... 101 2e-18
197gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partia... 101 2e-18
198ref|XM_558160.1| Anopheles gambiae str. PEST ENSANGP00000027582 ... 101 2e-18
199ref|XM_320334.2| Anopheles gambiae str. PEST ENSANGP00000014097 ... 101 2e-18
200ref|XM_320329.2| Anopheles gambiae str. PEST ENSANGP00000014080 ... 101 2e-18
201ref|XM_314450.2| Anopheles gambiae str. PEST ENSANGP00000000674 ... 101 2e-18
202ref|XM_314448.2| Anopheles gambiae str. PEST ENSANGP00000016043 ... 101 2e-18
203ref|XM_306853.2| Anopheles gambiae str. PEST ENSANGP00000000106 ... 101 2e-18
204ref|XM_306255.2| Anopheles gambiae str. PEST ENSANGP00000000003 ... 101 2e-18
205emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 101 2e-18
206gb|J00981.1|XELHIS2BL xenopus laevis h2b histone gene & flanks 101 2e-18
207ref|XM_518302.1| PREDICTED: Pan troglodytes similar to H2B histo... 100 7e-18
208ref|XM_518287.1| PREDICTED: Pan troglodytes similar to Histone H... 100 7e-18
209gb|BC106720.1| Homo sapiens histone 1, H2bo, mRNA (cDNA clone MG... 100 7e-18
210ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261... 100 7e-18
211ref|NM_178194.2| Mus musculus histone 1, H2be (Hist1h2be), mRNA 100 7e-18
212ref|NM_003527.4| Homo sapiens histone 1, H2bo (HIST1H2BO), mRNA 100 7e-18
213ref|XM_425468.1| PREDICTED: Gallus gallus similar to H2B histone... 100 7e-18
214ref|XM_425462.1| PREDICTED: Gallus gallus similar to H2B histone... 100 7e-18
215ref|XM_425457.1| PREDICTED: Gallus gallus similar to H2B histone... 100 7e-18
216ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ... 100 7e-18
217gb|BC060304.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone MG... 100 7e-18
218ref|NM_021063.2| Homo sapiens histone 1, H2bd (HIST1H2BD), trans... 100 7e-18
219ref|NM_138720.1| Homo sapiens histone 1, H2bd (HIST1H2BD), trans... 100 7e-18
220gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 100 7e-18
221ref|XM_539321.2| PREDICTED: Canis familiaris similar to histone ... 100 7e-18
222gb|AF531298.1| Homo sapiens histone H2B (HIST1H2BO) gene, comple... 100 7e-18
223gb|AF531287.1| Homo sapiens histone H2B (HIST1H2BD) gene, comple... 100 7e-18
224emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro... 100 7e-18
225emb|BX008531.1|CNS08EQV Single read from an extremity of a full-... 100 7e-18
226emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2... 100 7e-18
227emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq... 100 7e-18
228emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) 100 7e-18
229emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 100 7e-18
230emb|AJ223353.1|HSAJ3353 Homo sapiens mRNA for histone H2B, clone... 100 7e-18
231gb|BC069889.1| Mus musculus histone 1, H2be, mRNA (cDNA clone MG... 100 7e-18
232gb|BC019673.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MG... 100 7e-18
233gb|BC096122.1| Homo sapiens histone 1, H2bd, transcript variant ... 100 7e-18
234gb|BC002842.2| Homo sapiens histone 1, H2bd, transcript variant ... 100 7e-18
235ref|XM_683203.1| PREDICTED: Danio rerio similar to histone 1, H2... 100 7e-18
236dbj|AK049948.1| Mus musculus adult male hippocampus cDNA, RIKEN ... 100 7e-18
237dbj|AK030546.1| Mus musculus adult male pituitary gland cDNA, RI... 100 7e-18
238gb|BC092138.1| Mus musculus histone 1, H2bh, mRNA (cDNA clone MG... 100 7e-18
239ref|NM_178196.2| Mus musculus histone 1, H2bg (Hist1h2bg), mRNA 100 7e-18
240ref|NM_178200.1| Mus musculus histone 1, H2bm (Hist1h2bm), mRNA 100 7e-18
241gb|AY158936.1| Mus musculus histone protein Hist1h2be gene, comp... 100 7e-18
242gb|AY158934.1| Mus musculus histone protein Hist1h2bg gene, comp... 100 7e-18
243gb|AY158933.1| Mus musculus histone protein Hist1h2bh gene, comp... 100 7e-18
244gb|AY158928.1| Mus musculus histone protein Hist1h2bm gene, comp... 100 7e-18
245emb|BX647290.1|HSM807434 Homo sapiens mRNA; cDNA DKFZp781B2436 (... 100 7e-18
246ref|NM_178197.1| Mus musculus histone 1, H2bh (Hist1h2bh), mRNA 100 7e-18
247emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 100 7e-18
248gb|M60751.1|HUMHISAF Human histone H2B.1 (H2B) gene, complete cds 100 7e-18
249gb|M57901.1|CHKH2BB Chicken histone H2B gene, complete cds 100 7e-18
250gb|BC051872.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG... 98 3e-17
251ref|XM_518889.1| PREDICTED: Pan troglodytes similar to histone H... 98 3e-17
252ref|XM_518294.1| PREDICTED: Pan troglodytes similar to H2B histo... 98 3e-17
253ref|NM_017445.1| Homo sapiens H2B histone family, member S (H2BF... 98 3e-17
254gb|BC000893.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG... 98 3e-17
255ref|XM_618175.2| PREDICTED: Bos taurus similar to H2B histone fa... 98 3e-17
256ref|NM_080593.1| Homo sapiens histone 1, H2bk (HIST1H2BK), mRNA 98 3e-17
257ref|NM_003524.2| Homo sapiens histone 1, H2bh (HIST1H2BH), mRNA 98 3e-17
258ref|XM_535910.2| PREDICTED: Canis familiaris similar to Histone ... 98 3e-17
259ref|XM_843136.1| PREDICTED: Canis familiaris similar to Histone ... 98 3e-17
260ref|XM_849151.1| PREDICTED: Canis familiaris similar to Histone ... 98 3e-17
261ref|XM_849134.1| PREDICTED: Canis familiaris similar to Histone ... 98 3e-17
262ref|XM_545412.2| PREDICTED: Canis familiaris similar to H2B hist... 98 3e-17
263ref|XM_545410.2| PREDICTED: Canis familiaris similar to H2B hist... 98 3e-17
264ref|XM_545401.2| PREDICTED: Canis familiaris similar to H2B hist... 98 3e-17
265ref|XM_545398.2| PREDICTED: Canis familiaris similar to Histone ... 98 3e-17
266ref|XM_848802.1| PREDICTED: Canis familiaris similar to H2B hist... 98 3e-17
267ref|XM_545418.1| PREDICTED: Canis familiaris similar to Histone ... 98 3e-17
268ref|XM_848724.1| PREDICTED: Canis familiaris similar to H2B hist... 98 3e-17
269ref|XM_545375.1| PREDICTED: Canis familiaris similar to testis-s... 98 3e-17
270ref|XM_545374.2| PREDICTED: Canis familiaris similar to testis-s... 98 3e-17
271ref|XM_844623.1| PREDICTED: Canis familiaris similar to Histone ... 98 3e-17
272ref|XM_854475.1| PREDICTED: Canis familiaris similar to Histone ... 98 3e-17
273ref|XM_854447.1| PREDICTED: Canis familiaris similar to H2B hist... 98 3e-17
274ref|XM_545425.2| PREDICTED: Canis familiaris similar to H2B hist... 98 3e-17
275ref|XM_854265.1| PREDICTED: Canis familiaris similar to Histone ... 98 3e-17
276ref|XM_545389.2| PREDICTED: Canis familiaris similar to Histone ... 98 3e-17
277ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ... 98 3e-17
278ref|XM_854116.1| PREDICTED: Canis familiaris similar to histone ... 98 3e-17
279ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ... 98 3e-17
280gb|AF531294.1| Homo sapiens histone H2B (HIST1H2BK) gene, comple... 98 3e-17
281gb|AF531291.1| Homo sapiens histone H2B (HIST1H2BH) gene, comple... 98 3e-17
282emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o... 98 3e-17
283ref|XM_792924.1| PREDICTED: Strongylocentrotus purpuratus simila... 98 3e-17
284emb|X06642.1|SPH2BAL3 Strongylocentrotus purpuratus late histone... 98 3e-17
285emb|AJ223352.1|HSAJ3352 Homo sapiens mRNA for for histone H2B, c... 98 3e-17
286gb|BC096116.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG... 98 3e-17
287gb|BC096119.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG... 98 3e-17
288gb|BC096117.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG... 98 3e-17
289gb|BC096118.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG... 98 3e-17
290gb|BC064959.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG... 98 3e-17
291dbj|AB041017.1| Homo sapiens H2BFS gene for H2B histone family p... 98 3e-17
292ref|NM_214554.1| Strongylocentrotus purpuratus late histone L3 H... 98 3e-17
293emb|X05100.1|GGH2B7 Chicken histone H2B gene (pPP2d-4.0) 98 3e-17
294dbj|AP001751.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 98 3e-17
295ref|NG_000827.2| Homo sapiens genomic histone family microcluste... 98 3e-17
296gb|BC108737.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG... 98 3e-17
297gb|M14143.1|SUPH2A1 P.miliaris histone H2B-2.2 gene, complete cds 98 3e-17
298dbj|AP001051.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 98 3e-17
299dbj|AP001050.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 98 3e-17
300emb|Z58592.1|HS45C9F H.sapiens CpG island DNA genomic Mse1 fragm... 96 1e-16
301gb|DQ215263.1| Taeniopygia guttata clone 0058P0013D11 histone 1 ... 94 5e-16
302gb|BC107301.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MG... 94 5e-16
303gb|BC107302.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MG... 94 5e-16
304gb|BC051921.1| Mus musculus histone 3, H2ba, mRNA (cDNA clone MG... 94 5e-16
305ref|XM_545431.2| PREDICTED: Canis familiaris similar to Histone ... 94 5e-16
306emb|BX068880.1|CNS09PB8 Single read from an extremity of a full-... 94 5e-16
307emb|BX053939.1|CNS09DS7 Single read from an extremity of a full-... 94 5e-16
308emb|BX053938.1|CNS09DS6 Single read from an extremity of a full-... 94 5e-16
309ref|NG_002618.1| Homo sapiens histone 3, H2ba (HIST3H2BA) pseudo... 94 5e-16
310dbj|AK018765.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 94 5e-16
311ref|NM_030082.1| Mus musculus histone 3, H2ba (Hist3h2ba), mRNA 94 5e-16
312gb|AY158942.1| Mus musculus histone protein Hist3h2ba gene, comp... 94 5e-16
313emb|X05094.1|GGH2B1 Chicken histone H2B gene (pKR1a-1.3) 94 5e-16
314dbj|AB085854.1| Rosellinia necatrix hh2b gene for histone H2B, c... 94 5e-16
315emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr... 94 5e-16
316gb|J00865.1|CHKH2B Chicken histone H2B gene and flanks 94 5e-16
317ref|XM_518295.1| PREDICTED: Pan troglodytes similar to H2B histo... 92 2e-15
318ref|XM_416196.1| PREDICTED: Gallus gallus similar to H2B histone... 92 2e-15
319ref|XM_868991.1| PREDICTED: Bos taurus similar to Histone H2B 29... 92 2e-15
320gb|AY769467.1| Stylonychia lemnae macronuclear development prote... 92 2e-15
321emb|BX034441.1|CNS08YQL Single read from an extremity of a full-... 92 2e-15
322emb|BX014617.1|CNS08JFX Single read from an extremity of a full-... 92 2e-15
323gb|BC108143.1| Bos taurus similar to Histone H2B 291B, mRNA (cDN... 92 2e-15
324ref|NM_001037469.1| Bos taurus similar to Histone H2B 291B (MGC1... 92 2e-15
325ref|XM_683632.1| PREDICTED: Danio rerio similar to H2B histone f... 92 2e-15
326ref|XM_220506.2| PREDICTED: Rattus norvegicus histone 3, H2ba (p... 92 2e-15
327emb|Z59559.1|HS163A6R H.sapiens CpG island DNA genomic Mse1 frag... 92 2e-15
328gb|BC106899.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IM... 90 7e-15
329ref|XM_527282.1| PREDICTED: Pan troglodytes similar to HIST1H2BM... 90 7e-15
330ref|NM_175664.1| Mus musculus histone 1, H2bb (Hist1h2bb), mRNA 90 7e-15
331ref|XM_868885.1| PREDICTED: Bos taurus similar to Histone H2B 29... 90 7e-15
332ref|XM_582734.2| PREDICTED: Bos taurus similar to Histone H2B 29... 90 7e-15
333ref|NM_021058.3| Homo sapiens histone 1, H2bj (HIST1H2BJ), mRNA 90 7e-15
334ref|NM_003526.2| Homo sapiens histone 1, H2bc (HIST1H2BC), mRNA 90 7e-15
335gb|BC009612.1| Homo sapiens histone 1, H2bc, mRNA (cDNA clone IM... 90 7e-15
336ref|XM_848767.1| PREDICTED: Canis familiaris similar to Histone ... 90 7e-15
337ref|XM_988254.1| PREDICTED: Mus musculus similar to Histone H2B ... 90 7e-15
338ref|XM_978232.1| PREDICTED: Mus musculus similar to Histone H2B ... 90 7e-15
339ref|XM_978035.1| PREDICTED: Mus musculus similar to Histone H2B ... 90 7e-15
340gb|BC038854.1| Homo sapiens SECIS binding protein 2, mRNA (cDNA ... 90 7e-15
341gb|AF531293.1| Homo sapiens histone H2B (HIST1H2BJ) gene, comple... 90 7e-15
342gb|AF531286.1| Homo sapiens histone H2B (HIST1H2BC) gene, comple... 90 7e-15
343ref|NM_022643.1| Rattus norvegicus histone 1, H2ba (Hist1h2ba), ... 90 7e-15
344gb|AC092896.9| Homo sapiens 3 BAC RP11-274J15 (Roswell Park Canc... 90 7e-15
345emb|Z80781.1|HSH2BJ H.sapiens H2B/j gene 90 7e-15
346emb|Z46225.1|HTHISH2B H.tubulosa gene encoding histone H2B 90 7e-15
347emb|X90778.1|MMTSHIS2B M.musculus H2B gene 90 7e-15
348emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 90 7e-15
349emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones 90 7e-15
350emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones 90 7e-15
351emb|X02621.1|MMHISH2B Mouse gene for histone H2b 90 7e-15
352emb|X00088.1|HSHISH2B Human histone H2b gene 90 7e-15
353emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr... 90 7e-15
354emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr... 90 7e-15
355emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom... 90 7e-15
356emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 90 7e-15
357gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 90 7e-15
358dbj|AK036389.1| Mus musculus adult male bone cDNA, RIKEN full-le... 90 7e-15
359gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 90 7e-15
360ref|NM_022647.1| Rattus norvegicus histone 1, H2bl (Hist1h2bl), ... 90 7e-15
361ref|NM_175663.1| Mus musculus histone 1, H2ba (Hist1h2ba), mRNA 90 7e-15
362ref|NM_178195.1| Mus musculus histone 1, H2bf (Hist1h2bf), mRNA 90 7e-15
363ref|NM_178198.1| Mus musculus histone 1, H2bj (Hist1h2bj), mRNA 90 7e-15
364ref|NM_178201.1| Mus musculus histone 1, H2bn (Hist1h2bn), mRNA 90 7e-15
365ref|XM_214483.3| PREDICTED: Rattus norvegicus histone 1, H2bn (p... 90 7e-15
366gb|AY158939.1| Mus musculus histone protein Hist1h2ba gene, comp... 90 7e-15
367gb|AY158938.1| Mus musculus histone protein Hist1h2bb gene, comp... 90 7e-15
368gb|AY158935.1| Mus musculus histone protein Hist1h2bf gene, comp... 90 7e-15
369gb|AY158932.1| Mus musculus histone protein Hist1h2bj gene, comp... 90 7e-15
370gb|AY158929.1| Mus musculus histone protein Hist1h2bn gene, comp... 90 7e-15
371dbj|D10396.1|RICT20 Oryza sativa mRNA for histone H2B (T20 gene)... 90 7e-15
372emb|Z57636.1|HS187F7F H.sapiens CpG island DNA genomic Mse1 frag... 90 7e-15
373gb|U93852.1|ECU93852 Euplotes crassus histone H2B (H2B(1)) gene,... 90 7e-15
374gb|M18046.1|RATHISTSA Rat testis-specific histone H2B mRNA, comp... 90 7e-15
375gb|M18045.1|RATHISTS Rat testis-specific histone TH2B mRNA, comp... 90 7e-15
376emb|Z80783.1|HSH2BL H.sapiens H2B/l gene 90 7e-15
377emb|BX014618.1|CNS08JFY Single read from an extremity of a full-... 88 3e-14
378gb|AY158931.1| Mus musculus histone protein Hist1h2bk gene, comp... 88 3e-14
379dbj|AK108119.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
380ref|NM_175665.1| Mus musculus histone 1, H2bk (Hist1h2bk), mRNA 88 3e-14
381ref|NM_001017251.2| Xenopus tropicalis hypothetical protein LOC5... 86 1e-13
382emb|BX013308.1|CNS08IFK Single read from an extremity of a full-... 86 1e-13
383emb|BX008532.1|CNS08EQW Single read from an extremity of a full-... 86 1e-13
384emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes 86 1e-13
385ref|XM_694239.1| PREDICTED: Danio rerio similar to histone 1, H2... 86 1e-13
386dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
387dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
388emb|X05099.1|GGH2B6 Chicken histone H2B gene (pBRA-5.4) 86 1e-13
389dbj|AK106505.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
390emb|CR760086.2| Xenopus tropicalis finished cDNA, clone TNeu063l06 86 1e-13
391gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H... 86 1e-13
392ref|XM_518288.1| PREDICTED: Pan troglodytes similar to Histone H... 84 4e-13
393gb|AF531288.1| Homo sapiens histone H2B (HIST1H2BE) gene, comple... 84 4e-13
394emb|BX038797.1|CNS0923L Single read from an extremity of a full-... 84 4e-13
395emb|Z80780.1|HSH2BH H.sapiens H2B/h gene 84 4e-13
396gb|DQ118972.1| Toxoplasma gondii histone 2B variant 2 mRNA, comp... 84 4e-13
397emb|AJ306724.1|PPI306724 Pinus pinaster mRNA for putative histon... 84 4e-13
398dbj|AK158416.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 84 4e-13
399emb|AL115825.1|CNS01CPL Botrytis cinerea strain T4 cDNA library 84 4e-13
400emb|X57263.1|GGH2B4G Chicken gene for histone H2B-IV 84 4e-13
401gb|BC101750.1| Homo sapiens histone 1, H2be, mRNA (cDNA clone MG... 84 4e-13
402gb|BC101748.1| Homo sapiens histone 1, H2be, mRNA (cDNA clone MG... 84 4e-13
403ref|NM_003523.2| Homo sapiens histone 1, H2be (HIST1H2BE), mRNA 84 4e-13
404ref|XM_527258.1| PREDICTED: Pan troglodytes similar to histone H... 82 2e-12
405ref|XM_605634.1| PREDICTED: Bos taurus similar to Histone H2B 29... 82 2e-12
406ref|XM_868357.1| PREDICTED: Bos taurus similar to Histone H2B 29... 82 2e-12
407ref|XM_865334.1| PREDICTED: Bos taurus similar to Histone H2B 29... 82 2e-12
408ref|XM_608099.2| PREDICTED: Bos taurus similar to Histone H2B 29... 82 2e-12
409ref|XM_866738.1| PREDICTED: Bos taurus similar to Histone H2B 29... 82 2e-12
410gb|BC061044.1| Mus musculus histone 1, H2bp, mRNA (cDNA clone MG... 82 2e-12
411emb|CR708520.2|CNS0G9N8 Tetraodon nigroviridis full-length cDNA 82 2e-12
412gb|BC011440.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MG... 82 2e-12
413emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ... 82 2e-12
414emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) 82 2e-12
415emb|CR859861.1| Pongo pygmaeus mRNA; cDNA DKFZp469M064 (from clo... 82 2e-12
416dbj|AB220463.1| Macaca fascicularis mRNA, clone QflA-14990: simi... 82 2e-12
417ref|NM_178199.1| Mus musculus histone 1, H2bl (Hist1h2bl), mRNA 82 2e-12
418ref|NM_178202.1| Mus musculus histone 1, H2bp (Hist1h2bp), mRNA 82 2e-12
419ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (p... 82 2e-12
420gb|AY158930.1| Mus musculus histone protein Hist1h2bp gene, comp... 82 2e-12
421gb|AY158927.1| Mus musculus histone protein Hist1h2bl gene, comp... 82 2e-12
422emb|Z58190.1|HS30H2F H.sapiens CpG island DNA genomic Mse1 fragm... 82 2e-12
423gb|M25487.1|MUSHIS2B Mus musculus histone H2b mRNA, 3' end 82 2e-12
424ref|XM_482672.1| Oryza sativa (japonica cultivar-group), mRNA 80 7e-12
425emb|BX047441.1|CNS098RP Single read from an extremity of a full-... 80 7e-12
426emb|BX026873.1|CNS08SWD Single read from an extremity of a full-... 80 7e-12
427emb|X71390.1|XLH2BB X.laevis H2B and H2A genes for histones H2B ... 80 7e-12
428emb|X71389.1|XLH2BA X.laevis H2B gene for histone H2B 80 7e-12
429gb|U64845.1| Caenorhabditis elegans cosmid F45F2, complete sequence 80 7e-12
430ref|NM_072796.1| Caenorhabditis elegans HIStone family member (h... 80 7e-12
431dbj|AP004665.4| Oryza sativa (japonica cultivar-group) genomic D... 80 7e-12
432dbj|AP004558.3| Oryza sativa (japonica cultivar-group) genomic D... 80 7e-12
433emb|Z56488.1|HS11G4F H.sapiens CpG island DNA genomic Mse1 fragm... 80 7e-12
434ref|XM_598274.2| PREDICTED: Bos taurus similar to Histone H2B 29... 78 3e-11
435ref|XM_868501.1| PREDICTED: Bos taurus similar to Histone H2B 29... 78 3e-11
436ref|XM_598732.2| PREDICTED: Bos taurus similar to Histone H2B 29... 78 3e-11
437ref|XM_870344.1| PREDICTED: Bos taurus similar to Histone H2B 29... 78 3e-11
438ref|XM_605298.2| PREDICTED: Bos taurus similar to Histone H2B 29... 78 3e-11
439ref|XM_868522.1| PREDICTED: Bos taurus similar to Histone H2B 29... 78 3e-11
440gb|BC067486.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 78 3e-11
441ref|XM_869788.1| PREDICTED: Bos taurus similar to Histone H2B 29... 78 3e-11
442gb|BC067489.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 78 3e-11
443gb|BC067488.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 78 3e-11
444gb|BC067487.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 78 3e-11
445ref|XM_599789.2| PREDICTED: Bos taurus similar to H2B histone fa... 78 3e-11
446ref|XM_868231.1| PREDICTED: Bos taurus similar to testis-specifi... 78 3e-11
447ref|XM_866923.1| PREDICTED: Bos taurus similar to testis-specifi... 78 3e-11
448ref|NM_003521.2| Homo sapiens histone 1, H2bm (HIST1H2BM), mRNA 78 3e-11
449gb|AF531296.1| Homo sapiens histone H2B (HIST1H2BM) gene, comple... 78 3e-11
450emb|AL136219.17| Human DNA sequence from clone RP11-149B7 on chr... 78 3e-11
451emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A... 78 3e-11
452emb|Z83738.1|HSZ83738 H.sapiens hH2B/e gene 78 3e-11
453emb|X04681.1|SPH2B1G S. purpuratus gene for sperm specific histo... 78 3e-11
454emb|AJ494852.1|ODI494852 Oikopleura dioica partial H2A.4 gene fo... 78 3e-11
455dbj|AK093747.1| Homo sapiens cDNA FLJ36428 fis, clone THYMU20115... 78 3e-11
456gb|BC067485.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone IM... 78 3e-11
457ref|NM_214541.1| Strongylocentrotus purpuratus histone H2B-1, sp... 78 3e-11
458gb|BC066244.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 78 3e-11
459ref|XM_599845.2| PREDICTED: Bos taurus similar to Histone H2B 29... 76 1e-10
460ref|XM_868390.1| PREDICTED: Bos taurus similar to histone 1, H2b... 76 1e-10
461ref|XM_686749.1| PREDICTED: Danio rerio similar to histone 2, H2... 76 1e-10
462gb|S49144.1| histone H2B-1, histone H2A [Tigriopus californicus,... 76 1e-10
463gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2... 76 1e-10
464emb|CR353801.1| Gallus gallus finished cDNA, clone ChEST919h3 76 1e-10
465emb|Z57637.1|HS187F7R H.sapiens CpG island DNA genomic Mse1 frag... 76 1e-10
466gb|M84797.1|TIGH1234A Tigriopus californicus histone H1 gene, co... 76 1e-10
467ref|XM_603141.2| PREDICTED: Bos taurus similar to Histone H2B 29... 74 4e-10
468ref|XM_866067.1| PREDICTED: Bos taurus similar to testis-specifi... 74 4e-10
469ref|XM_615258.2| PREDICTED: Bos taurus similar to testis-specifi... 74 4e-10
470ref|XM_870058.1| PREDICTED: Bos taurus similar to Histone H2B 29... 74 4e-10
471ref|XM_607722.1| PREDICTED: Bos taurus similar to Histone H2B 29... 74 4e-10
472ref|XM_865948.1| PREDICTED: Bos taurus similar to Histone H2B 29... 74 4e-10
473ref|XM_569066.1| Cryptococcus neoformans var. neoformans JEC21 h... 74 4e-10
474emb|BX017639.1|CNS08LRV Single read from an extremity of a full-... 74 4e-10
475emb|BX009212.1|CNS08F9S Single read from an extremity of a full-... 74 4e-10
476emb|AJ494848.1|ODI494848 Oikopleura dioica H3.1 gene, H4.1 gene,... 74 4e-10
477gb|U58750.1| Caenorhabditis elegans cosmid F55G1, complete sequence 74 4e-10
478gb|AY957499.1| Bos taurus glutamate-cysteine ligase catalytic su... 74 4e-10
479gb|BC109769.1| Bos taurus cDNA clone MGC:133753 IMAGE:8062200, c... 74 4e-10
480ref|NM_068801.1| Caenorhabditis elegans F55G1.3 (Histone) mRNA, ... 74 4e-10
481ref|NM_074630.2| Caenorhabditis elegans HIStone family member (h... 74 4e-10
482gb|BC079458.1| Rattus norvegicus histone 1, H2bh, mRNA (cDNA clo... 74 4e-10
483emb|Z93388.1|CET10C6 Caenorhabditis elegans Cosmid T10C6, comple... 74 4e-10
484ref|NM_100653.2| Arabidopsis thaliana DNA binding AT1G07790 mRNA... 72 2e-09
485ref|XM_527996.1| PREDICTED: Pan troglodytes similar to Histone H... 72 2e-09
486gb|AC024696.1| Caenorhabditis elegans cosmid F07B7, complete seq... 72 2e-09
487ref|XM_585020.2| PREDICTED: Bos taurus similar to testis-specifi... 72 2e-09
488ref|XM_601249.2| PREDICTED: Bos taurus similar to H2B histone fa... 72 2e-09
489gb|U64843.2| Caenorhabditis elegans cosmid K06C4, complete sequence 72 2e-09
490gb|AC021097.5| Homo sapiens PAC clone RP4-548D19 from 7, complet... 72 2e-09
491ref|XM_846014.1| PREDICTED: Canis familiaris similar to testis-s... 72 2e-09
492emb|CR719344.2|CNS0GHZQ Tetraodon nigroviridis full-length cDNA 72 2e-09
493emb|CR698920.2|CNS0G28K Tetraodon nigroviridis full-length cDNA 72 2e-09
494emb|CR689567.2|CNS0FV0R Tetraodon nigroviridis full-length cDNA 72 2e-09
495emb|CR686222.2|CNS0FSFU Tetraodon nigroviridis full-length cDNA 72 2e-09
496emb|AL512384.9| Human DNA sequence from clone RP11-317E16 on chr... 72 2e-09
497emb|BX032828.1|CNS08XHS Single read from an extremity of a full-... 72 2e-09
498gb|AY133638.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA, com... 72 2e-09
499gb|BC058562.1| Mus musculus cDNA clone IMAGE:6389884 72 2e-09
500gb|BC047137.1| Mus musculus histone 2, H2be, mRNA (cDNA clone MG... 72 2e-09

>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10,
              complete sequence
          Length = 187034

 Score =  389 bits (196), Expect = e-105
 Identities = 211/216 (97%)
 Strand = Plus / Minus

                                                                          
Query: 226    cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 176408 cctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 176349

                                                                          
Query: 286    gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
              |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 176348 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 176289

                                                                          
Query: 346    tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
              ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 176288 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 176229

                                                  
Query: 406    tgaaggagttcatgatggacatggccttggaggaga 441
              ||||||||||||||||||||||||||||||||||||
Sbjct: 176228 tgaaggagttcatgatggacatggccttggaggaga 176193



to top

>gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1268_B08,
             complete sequence
          Length = 119500

 Score =  389 bits (196), Expect = e-105
 Identities = 211/216 (97%)
 Strand = Plus / Minus

                                                                         
Query: 226   cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 27090 cctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 27031

                                                                         
Query: 286   gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
             |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 27030 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 26971

                                                                         
Query: 346   tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
             ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 26970 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 26911

                                                 
Query: 406   tgaaggagttcatgatggacatggccttggaggaga 441
             ||||||||||||||||||||||||||||||||||||
Sbjct: 26910 tgaaggagttcatgatggacatggccttggaggaga 26875



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  389 bits (196), Expect = e-105
 Identities = 211/216 (97%)
 Strand = Plus / Minus

                                                                            
Query: 226      cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
                |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 28392166 cctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 28392107

                                                                            
Query: 286      gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
                |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 28392106 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 28392047

                                                                            
Query: 346      tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
                ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 28392046 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 28391987

                                                    
Query: 406      tgaaggagttcatgatggacatggccttggaggaga 441
                ||||||||||||||||||||||||||||||||||||
Sbjct: 28391986 tgaaggagttcatgatggacatggccttggaggaga 28391951



 Score =  252 bits (127), Expect = 8e-64
 Identities = 190/211 (90%)
 Strand = Plus / Minus

                                                                            
Query: 231      gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
                ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| 
Sbjct: 22480467 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 22480408

                                                                            
Query: 291      ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
                || ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 22480407 ccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttcttg 22480348

                                                                            
Query: 351      ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410
                ||||| |  || ||| | ||||||||     ||||||||||||| |||||||||| ||||
Sbjct: 22480347 ttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacgaag 22480288

                                               
Query: 411      gagttcatgatggacatggccttggaggaga 441
                || ||||||||||||||||||||||||||||
Sbjct: 22480287 gaattcatgatggacatggccttggaggaga 22480257



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                          
Query: 383     gagcttctcgaagatgtcgttgatgaa 409
               |||||||||||||||||||||||||||
Sbjct: 3720743 gagcttctcgaagatgtcgttgatgaa 3720769



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                            
Query: 382      cgagcttctcgaagatgtcgttgatgaa 409
                ||||||||||| ||||||||||||||||
Sbjct: 29356934 cgagcttctcggagatgtcgttgatgaa 29356961



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 382      cgagcttctcgaagatgtcgttgatgaa 409
                |||||||||||||||||||||| |||||
Sbjct: 18422090 cgagcttctcgaagatgtcgttaatgaa 18422063



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 384     agcttctcgaagatgtcgttgatgaa 409
               ||||||||||||||||| ||||||||
Sbjct: 6238958 agcttctcgaagatgtctttgatgaa 6238933



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                       
Query: 382     cgagcttctcgaagatgtcgttgatgaaggagttcatgat 421
               ||||||||| |||||| ||| | | |||||||||||||||
Sbjct: 6889823 cgagcttcttgaagatatcgataaagaaggagttcatgat 6889862



to top

>ref|XM_475912.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 459

 Score =  387 bits (195), Expect = e-104
 Identities = 210/215 (97%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 459 ctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 400

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 399 ctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 340

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 339 cttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgat 280

                                              
Query: 407 gaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||||||
Sbjct: 279 gaaggagttcatgatggacatggccttggaggaga 245



to top

>dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8, complete cds
          Length = 592

 Score =  379 bits (191), Expect = e-102
 Identities = 209/215 (97%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 479 ctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 420

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 419 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 360

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           |||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 359 cttgttgtagcgggcgagcttggcggactcgccggcgagcttctcgaagatgtcgttgat 300

                                              
Query: 407 gaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||||||
Sbjct: 299 gaaggagttcatgatggacatggccttggaggaga 265



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  373 bits (188), Expect = e-100
 Identities = 209/216 (96%)
 Strand = Plus / Minus

                                                                           
Query: 226     cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
               |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2673941 cctaagcggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcga 2673882

                                                                           
Query: 286     gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
               |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2673881 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 2673822

                                                                           
Query: 346     tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
               ||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||
Sbjct: 2673821 tcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttga 2673762

                                                   
Query: 406     tgaaggagttcatgatggacatggccttggaggaga 441
               ||||||||||||||||||||||||||||||||||||
Sbjct: 2673761 tgaaggagttcatgatggacatggccttggaggaga 2673726



 Score =  365 bits (184), Expect = 8e-98
 Identities = 208/216 (96%)
 Strand = Plus / Minus

                                                                           
Query: 226     cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
               |||||| ||||||||||||||| || |||||||||||||||||||||||||||||||| |
Sbjct: 2871656 cctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaa 2871597

                                                                           
Query: 286     gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
               |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2871596 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 2871537

                                                                           
Query: 346     tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
               ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2871536 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 2871477

                                                   
Query: 406     tgaaggagttcatgatggacatggccttggaggaga 441
               ||||||||||||||||||||||||||||||||||||
Sbjct: 2871476 tgaaggagttcatgatggacatggccttggaggaga 2871441



 Score =  365 bits (184), Expect = 8e-98
 Identities = 208/216 (96%)
 Strand = Plus / Plus

                                                                           
Query: 226     cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
               |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 2856597 cctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaa 2856656

                                                                           
Query: 286     gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
               |||| || ||||||||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct: 2856657 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 2856716

                                                                           
Query: 346     tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
               ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2856717 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 2856776

                                                   
Query: 406     tgaaggagttcatgatggacatggccttggaggaga 441
               ||||||||||||||||||||||||||||||||||||
Sbjct: 2856777 tgaaggagttcatgatggacatggccttggaggaga 2856812



 Score =  355 bits (179), Expect = 8e-95
 Identities = 206/215 (95%)
 Strand = Plus / Plus

                                                                           
Query: 227     ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
               ||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||
Sbjct: 2819235 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgag 2819294

                                                                           
Query: 287     ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
               ||| || |||||||||||||||||||||||||||||||| || |||||||||||||||||
Sbjct: 2819295 ctcgccggggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggctt 2819354

                                                                           
Query: 347     cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
               |||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||
Sbjct: 2819355 cttgttgtagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgat 2819414

                                                  
Query: 407     gaaggagttcatgatggacatggccttggaggaga 441
               |||||||||||||||||||||||||||||||||||
Sbjct: 2819415 gaaggagttcatgatggacatggccttggaggaga 2819449



 Score =  341 bits (172), Expect = 1e-90
 Identities = 205/216 (94%)
 Strand = Plus / Plus

                                                                           
Query: 226     cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
               |||||| ||| || ||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 2843658 cctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcga 2843717

                                                                           
Query: 286     gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
               |||| || |||||||||||||||||||||||||| ||||| |||||||||||||||||||
Sbjct: 2843718 gctcgccggggaggacgaggcggacggaggtctgaatctcccgggaggtgatggtgggct 2843777

                                                                           
Query: 346     tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
               ||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||
Sbjct: 2843778 tcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttga 2843837

                                                   
Query: 406     tgaaggagttcatgatggacatggccttggaggaga 441
               ||||||||||||||||||||||||||||||||||||
Sbjct: 2843838 tgaaggagttcatgatggacatggccttggaggaga 2843873



 Score =  341 bits (172), Expect = 1e-90
 Identities = 205/216 (94%)
 Strand = Plus / Plus

                                                                           
Query: 226     cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
               |||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 2837045 cctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcga 2837104

                                                                           
Query: 286     gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
               |||| || ||||||||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct: 2837105 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 2837164

                                                                           
Query: 346     tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
               ||||||||||||||||||||||||||| ||| |||||||||||||||||||| || ||||
Sbjct: 2837165 tcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattga 2837224

                                                   
Query: 406     tgaaggagttcatgatggacatggccttggaggaga 441
               ||||||||||||||||||||||||||||||||||||
Sbjct: 2837225 tgaaggagttcatgatggacatggccttggaggaga 2837260



 Score =  341 bits (172), Expect = 1e-90
 Identities = 205/216 (94%)
 Strand = Plus / Minus

                                                                           
Query: 226     cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
               |||||| ||||||||| || |||||||||||||||||||| |||||||||||||||||||
Sbjct: 2686264 cctaagcggaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcga 2686205

                                                                           
Query: 286     gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
               |||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 2686204 gctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggct 2686145

                                                                           
Query: 346     tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
               ||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||| ||||
Sbjct: 2686144 tcttgttgtagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattga 2686085

                                                   
Query: 406     tgaaggagttcatgatggacatggccttggaggaga 441
               ||||||||||||||||||||||||||||||||||||
Sbjct: 2686084 tgaaggagttcatgatggacatggccttggaggaga 2686049



 Score =  297 bits (150), Expect = 2e-77
 Identities = 192/206 (93%)
 Strand = Plus / Plus

                                                                            
Query: 236      ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
                |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||
Sbjct: 17421734 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 17421793

                                                                            
Query: 296      gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
                ||||||||||||||||||||||| ||||||||||||||||  | ||||||||||||||||
Sbjct: 17421794 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 17421853

                                                                            
Query: 356      gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
                ||| ||||| | |||||||||    |||||||||||||||||||||||||||||||||||
Sbjct: 17421854 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 17421913

                                          
Query: 416      catgatggacatggccttggaggaga 441
                |||||| |||||||||||||||||||
Sbjct: 17421914 catgatcgacatggccttggaggaga 17421939



 Score =  272 bits (137), Expect = 9e-70
 Identities = 191/209 (91%)
 Strand = Plus / Plus

                                                                            
Query: 228      taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287
                ||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 36007433 taagacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagc 36007492

                                                                            
Query: 288      tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347
                || || |||||||||||||| || ||||||||||||||||||||||||||||| ||||||
Sbjct: 36007493 tcgccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttc 36007552

                                                                            
Query: 348      ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407
                ||||||||||| |||||   |||||||||   |||||||||||||||||| |||||||||
Sbjct: 36007553 ttgttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatg 36007612

                                             
Query: 408      aaggagttcatgatggacatggccttgga 436
                || ||||||||||| ||||||||||||||
Sbjct: 36007613 aacgagttcatgatcgacatggccttgga 36007641



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                                 
Query: 384      agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggcct 432
                ||||||||||| | ||||||||||||||| |||||||| ||||||||||
Sbjct: 30942127 agcttctcgaaaacgtcgttgatgaaggatttcatgatagacatggcct 30942175



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 387   ttctcgaagatgtcgttgatgaaggagtt 415
             |||| |||||||||||||||||| |||||
Sbjct: 80259 ttcttgaagatgtcgttgatgaatgagtt 80287



to top

>dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0434B04
          Length = 167029

 Score =  373 bits (188), Expect = e-100
 Identities = 209/216 (96%)
 Strand = Plus / Minus

                                                                          
Query: 226    cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
              |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 123716 cctaagcggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcga 123657

                                                                          
Query: 286    gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
              |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 123656 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 123597

                                                                          
Query: 346    tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
              ||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||
Sbjct: 123596 tcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttga 123537

                                                  
Query: 406    tgaaggagttcatgatggacatggccttggaggaga 441
              ||||||||||||||||||||||||||||||||||||
Sbjct: 123536 tgaaggagttcatgatggacatggccttggaggaga 123501



 Score =  341 bits (172), Expect = 1e-90
 Identities = 205/216 (94%)
 Strand = Plus / Minus

                                                                          
Query: 226    cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
              |||||| ||||||||| || |||||||||||||||||||| |||||||||||||||||||
Sbjct: 136039 cctaagcggaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcga 135980

                                                                          
Query: 286    gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
              |||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 135979 gctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggct 135920

                                                                          
Query: 346    tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
              ||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||| ||||
Sbjct: 135919 tcttgttgtagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattga 135860

                                                  
Query: 406    tgaaggagttcatgatggacatggccttggaggaga 441
              ||||||||||||||||||||||||||||||||||||
Sbjct: 135859 tgaaggagttcatgatggacatggccttggaggaga 135824



to top

>ref|NM_184371.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  371 bits (187), Expect = 1e-99
 Identities = 208/215 (96%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 462 ctaagcggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgag 403

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 343

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           |||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||
Sbjct: 342 cttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgat 283

                                              
Query: 407 gaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||||||
Sbjct: 282 gaaggagttcatgatggacatggccttggaggaga 248



to top

>emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B
          Length = 712

 Score =  371 bits (187), Expect = 1e-99
 Identities = 205/211 (97%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 519 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 460

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 459 ccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttg 400

                                                                       
Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410
           ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 399 ttgtaccgcgccagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 340

                                          
Query: 411 gagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||
Sbjct: 339 gagttcatgatggacatggccttggaggaga 309



to top

>gb|BT016429.1| Zea mays clone Contig262 mRNA sequence
          Length = 564

 Score =  365 bits (184), Expect = 8e-98
 Identities = 202/208 (97%)
 Strand = Plus / Minus

                                                                       
Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 397 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccg 338

                                                                       
Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353
           |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 337 gggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtgggcttcttgttg 278

                                                                       
Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413
           || ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 277 taccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 218

                                       
Query: 414 ttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||| |||||||
Sbjct: 217 ttcatgatggacatggccttagaggaga 190



to top

>emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221)
          Length = 653

 Score =  365 bits (184), Expect = 8e-98
 Identities = 202/208 (97%)
 Strand = Plus / Minus

                                                                       
Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 463 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccg 404

                                                                       
Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353
           |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 403 gggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtgggcttcttgttg 344

                                                                       
Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413
           || ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 343 taccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 284

                                       
Query: 414 ttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||| |||||||
Sbjct: 283 ttcatgatggacatggccttagaggaga 256



to top

>dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0030H07
          Length = 168253

 Score =  365 bits (184), Expect = 8e-98
 Identities = 208/216 (96%)
 Strand = Plus / Minus

                                                                         
Query: 226   cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
             |||||| ||||||||||||||| || |||||||||||||||||||||||||||||||| |
Sbjct: 78654 cctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaa 78595

                                                                         
Query: 286   gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
             |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 78594 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 78535

                                                                         
Query: 346   tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
             ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 78534 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 78475

                                                 
Query: 406   tgaaggagttcatgatggacatggccttggaggaga 441
             ||||||||||||||||||||||||||||||||||||
Sbjct: 78474 tgaaggagttcatgatggacatggccttggaggaga 78439



 Score =  365 bits (184), Expect = 8e-98
 Identities = 208/216 (96%)
 Strand = Plus / Plus

                                                                         
Query: 226   cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
             |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 63595 cctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaa 63654

                                                                         
Query: 286   gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
             |||| || ||||||||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct: 63655 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 63714

                                                                         
Query: 346   tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
             ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 63715 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 63774

                                                 
Query: 406   tgaaggagttcatgatggacatggccttggaggaga 441
             ||||||||||||||||||||||||||||||||||||
Sbjct: 63775 tgaaggagttcatgatggacatggccttggaggaga 63810



 Score =  355 bits (179), Expect = 8e-95
 Identities = 206/215 (95%)
 Strand = Plus / Plus

                                                                         
Query: 227   ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
             ||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||
Sbjct: 26233 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgag 26292

                                                                         
Query: 287   ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
             ||| || |||||||||||||||||||||||||||||||| || |||||||||||||||||
Sbjct: 26293 ctcgccggggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggctt 26352

                                                                         
Query: 347   cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
             |||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||
Sbjct: 26353 cttgttgtagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgat 26412

                                                
Query: 407   gaaggagttcatgatggacatggccttggaggaga 441
             |||||||||||||||||||||||||||||||||||
Sbjct: 26413 gaaggagttcatgatggacatggccttggaggaga 26447



 Score =  341 bits (172), Expect = 1e-90
 Identities = 205/216 (94%)
 Strand = Plus / Plus

                                                                         
Query: 226   cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
             |||||| ||| || ||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 50656 cctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcga 50715

                                                                         
Query: 286   gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
             |||| || |||||||||||||||||||||||||| ||||| |||||||||||||||||||
Sbjct: 50716 gctcgccggggaggacgaggcggacggaggtctgaatctcccgggaggtgatggtgggct 50775

                                                                         
Query: 346   tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
             ||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||
Sbjct: 50776 tcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttga 50835

                                                 
Query: 406   tgaaggagttcatgatggacatggccttggaggaga 441
             ||||||||||||||||||||||||||||||||||||
Sbjct: 50836 tgaaggagttcatgatggacatggccttggaggaga 50871



 Score =  341 bits (172), Expect = 1e-90
 Identities = 205/216 (94%)
 Strand = Plus / Plus

                                                                         
Query: 226   cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
             |||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 44043 cctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcga 44102

                                                                         
Query: 286   gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
             |||| || ||||||||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct: 44103 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 44162

                                                                         
Query: 346   tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
             ||||||||||||||||||||||||||| ||| |||||||||||||||||||| || ||||
Sbjct: 44163 tcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattga 44222

                                                 
Query: 406   tgaaggagttcatgatggacatggccttggaggaga 441
             ||||||||||||||||||||||||||||||||||||
Sbjct: 44223 tgaaggagttcatgatggacatggccttggaggaga 44258



to top

>dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0009G03
          Length = 163526

 Score =  365 bits (184), Expect = 8e-98
 Identities = 208/216 (96%)
 Strand = Plus / Plus

                                                                          
Query: 226    cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
              |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 162274 cctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaa 162333

                                                                          
Query: 286    gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
              |||| || ||||||||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct: 162334 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 162393

                                                                          
Query: 346    tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
              ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 162394 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 162453

                                                  
Query: 406    tgaaggagttcatgatggacatggccttggaggaga 441
              ||||||||||||||||||||||||||||||||||||
Sbjct: 162454 tgaaggagttcatgatggacatggccttggaggaga 162489



 Score =  355 bits (179), Expect = 8e-95
 Identities = 206/215 (95%)
 Strand = Plus / Plus

                                                                          
Query: 227    ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
              ||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||
Sbjct: 124912 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgag 124971

                                                                          
Query: 287    ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
              ||| || |||||||||||||||||||||||||||||||| || |||||||||||||||||
Sbjct: 124972 ctcgccggggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggctt 125031

                                                                          
Query: 347    cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
              |||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||
Sbjct: 125032 cttgttgtagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgat 125091

                                                 
Query: 407    gaaggagttcatgatggacatggccttggaggaga 441
              |||||||||||||||||||||||||||||||||||
Sbjct: 125092 gaaggagttcatgatggacatggccttggaggaga 125126



 Score =  341 bits (172), Expect = 1e-90
 Identities = 205/216 (94%)
 Strand = Plus / Plus

                                                                          
Query: 226    cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
              |||||| ||| || ||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 149335 cctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcga 149394

                                                                          
Query: 286    gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
              |||| || |||||||||||||||||||||||||| ||||| |||||||||||||||||||
Sbjct: 149395 gctcgccggggaggacgaggcggacggaggtctgaatctcccgggaggtgatggtgggct 149454

                                                                          
Query: 346    tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
              ||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||
Sbjct: 149455 tcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttga 149514

                                                  
Query: 406    tgaaggagttcatgatggacatggccttggaggaga 441
              ||||||||||||||||||||||||||||||||||||
Sbjct: 149515 tgaaggagttcatgatggacatggccttggaggaga 149550



 Score =  341 bits (172), Expect = 1e-90
 Identities = 205/216 (94%)
 Strand = Plus / Plus

                                                                          
Query: 226    cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
              |||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 142722 cctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcga 142781

                                                                          
Query: 286    gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
              |||| || ||||||||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct: 142782 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 142841

                                                                          
Query: 346    tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
              ||||||||||||||||||||||||||| ||| |||||||||||||||||||| || ||||
Sbjct: 142842 tcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattga 142901

                                                  
Query: 406    tgaaggagttcatgatggacatggccttggaggaga 441
              ||||||||||||||||||||||||||||||||||||
Sbjct: 142902 tgaaggagttcatgatggacatggccttggaggaga 142937



to top

>ref|NM_184409.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 468

 Score =  363 bits (183), Expect = 3e-97
 Identities = 207/215 (96%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           ||||| ||||||||||||||| || |||||||||||||||||||||||||||||||| ||
Sbjct: 468 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaag 409

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 408 ctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 349

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 348 cttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgat 289

                                              
Query: 407 gaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||||||
Sbjct: 288 gaaggagttcatgatggacatggccttggaggaga 254



to top

>ref|NM_184407.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  363 bits (183), Expect = 3e-97
 Identities = 207/215 (96%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 462 ctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaag 403

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || ||||||||||||||||||| |||||||||||| ||||||||||||||||||||
Sbjct: 402 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 343

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 342 cttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgat 283

                                              
Query: 407 gaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||||||
Sbjct: 282 gaaggagttcatgatggacatggccttggaggaga 248



to top

>ref|NM_184399.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  355 bits (179), Expect = 8e-95
 Identities = 206/215 (95%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           ||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||
Sbjct: 462 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgag 403

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || |||||||||||||||||||||||||||||||| || |||||||||||||||||
Sbjct: 402 ctcgccggggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggctt 343

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           |||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||
Sbjct: 342 cttgttgtagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgat 283

                                              
Query: 407 gaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||||||
Sbjct: 282 gaaggagttcatgatggacatggccttggaggaga 248



to top

>gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full insert mRNA
           sequence
          Length = 764

 Score =  355 bits (179), Expect = 8e-95
 Identities = 206/215 (95%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           |||||| |||||||||||||||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 552 ctaagacgaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgag 493

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 492 ctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 433

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           ||||||||| || |||||||||||||||||  ||||||||||||||||||||||||||||
Sbjct: 432 cttgttgtaccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgat 373

                                              
Query: 407 gaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||||||
Sbjct: 372 gaaggagttcatgatggacatggccttggaggaga 338



to top

>dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6, complete cds
          Length = 564

 Score =  355 bits (179), Expect = 8e-95
 Identities = 203/211 (96%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 410 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 351

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || |||||||||||||| |||| |||||||||||| ||||||||||||||||||||||||
Sbjct: 350 ccggggaggacgaggcgcacggcggtctggatctcccgggaggtgatggtgggcttcttg 291

                                                                       
Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410
           ||||||||||| |||||||| | |||||||||||||||||||||||||||||||||||||
Sbjct: 290 ttgtagcgcgccagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaag 231

                                          
Query: 411 gagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||
Sbjct: 230 gagttcatgatggacatggccttggaggaga 200



to top

>gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds
          Length = 678

 Score =  355 bits (179), Expect = 8e-95
 Identities = 206/215 (95%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           |||||| |||||||||||||||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 485 ctaagacgaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgag 426

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 425 ctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 366

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           ||||||||| || |||||||||||||||||  ||||||||||||||||||||||||||||
Sbjct: 365 cttgttgtaccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgat 306

                                              
Query: 407 gaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||||||
Sbjct: 305 gaaggagttcatgatggacatggccttggaggaga 271



to top

>dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B153, complete cds
          Length = 3209

 Score =  351 bits (177), Expect = 1e-93
 Identities = 201/209 (96%)
 Strand = Plus / Minus

                                                                        
Query: 233  ggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 292
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1699 ggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 1640

                                                                        
Query: 293  agggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgtt 352
             |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 1639 tgggaggacgaggcggacggaggtctggatctcccgggatgtgatggtgggcttcttgtt 1580

                                                                        
Query: 353  gtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaagga 412
            ||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1579 gtaccgcgccagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaagga 1520

                                         
Query: 413  gttcatgatggacatggccttggaggaga 441
            |||| ||||||||||||||||||||||||
Sbjct: 1519 gttcgtgatggacatggccttggaggaga 1491



to top

>gb|BT016519.1| Zea mays clone Contig352 mRNA sequence
          Length = 789

 Score =  345 bits (174), Expect = 7e-92
 Identities = 198/206 (96%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||||||||||||||||||||||| ||||||||||||||||| ||||||||||| || ||
Sbjct: 522 ggtgaacttggtgacggccttggttccctcggagacggcgtgtttggcgagctctcctgg 463

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 462 gaggacgaggcgcacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
            || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ccgggcgagcttagcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 343

                                     
Query: 416 catgatggacatggccttggaggaga 441
           ||||||||||||||||||||||||||
Sbjct: 342 catgatggacatggccttggaggaga 317



to top

>gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence
          Length = 574

 Score =  341 bits (172), Expect = 1e-90
 Identities = 199/208 (95%)
 Strand = Plus / Minus

                                                                       
Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293
           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || 
Sbjct: 519 gaggtgaacttggtgacggccttggtgccctccgagacggcgtgcttggcgagctcgccg 460

                                                                       
Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353
           || || |||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 459 ggtagaacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 400

                                                                       
Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413
           ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 399 tagcgggcgagcttggccgcctcgccggcgagcttctcgaagatgtcgttgatgaatgag 340

                                       
Query: 414 ttcatgatggacatggccttggaggaga 441
           ||||||||||||||||||||||||||||
Sbjct: 339 ttcatgatggacatggccttggaggaga 312



to top

>gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full insert mRNA
           sequence
          Length = 940

 Score =  341 bits (172), Expect = 1e-90
 Identities = 199/208 (95%)
 Strand = Plus / Minus

                                                                       
Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293
           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || 
Sbjct: 772 gaggtgaacttggtgacggccttggtgccctctgagacggcgtgcttggcgagctcgccg 713

                                                                       
Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353
           |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 712 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 653

                                                                       
Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413
           ||||| ||||||||||||| ||| || |||||||||||||||||||||||||||||||||
Sbjct: 652 tagcgggcgagcttggcggactccccagcgagcttctcgaagatgtcgttgatgaaggag 593

                                       
Query: 414 ttcatgatggacatggccttggaggaga 441
           ||||||||||||||||||||||||||||
Sbjct: 592 ttcatgatggacatggccttggaggaga 565



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  341 bits (172), Expect = 1e-90
 Identities = 205/216 (94%)
 Strand = Plus / Minus

                                                                            
Query: 226      cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
                ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24254625 cctaagagctggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 24254566

                                                                            
Query: 286      gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
                |||| || |||||||||||||||||||||||||||||||| | |||||||||||||||||
Sbjct: 24254565 gctcgccggggaggacgaggcggacggaggtctggatctccctggaggtgatggtgggct 24254506

                                                                            
Query: 346      tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
                |||||||||| |  ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24254505 tcttgttgtacctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 24254446

                                                    
Query: 406      tgaaggagttcatgatggacatggccttggaggaga 441
                |||| ||||||||||| |||||||||||||||||||
Sbjct: 24254445 tgaacgagttcatgattgacatggccttggaggaga 24254410



 Score =  188 bits (95), Expect = 1e-44
 Identities = 140/155 (90%)
 Strand = Plus / Minus

                                                                            
Query: 237      gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccaggg 296
                |||||||||||||||||||| |  |||||||||||||| |||||||||||||| ||  ||
Sbjct: 24251113 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 24251054

                                                                            
Query: 297      aggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356
                |||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||| 
Sbjct: 24251053 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 24250994

                                                   
Query: 357      cgcgcgagcttggcggcctcgccggcgagcttctc 391
                || ||||||||||||||||| ||| | ||||||||
Sbjct: 24250993 cgggcgagcttggcggcctcaccgacaagcttctc 24250959



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                        
Query: 384      agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
                ||||||| ||||||| ||||||||||||||||||| |||||||||||||| |||||
Sbjct: 21802131 agcttcttgaagatgccgttgatgaaggagttcataatggacatggccttagagga 21802076



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                                  
Query: 387      ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttgga 436
                ||||||| ||| || ||||||||||||||||||||||||||| |||||||
Sbjct: 11770130 ttctcgaggatttcattgatgaaggagttcatgatggacatgaccttgga 11770179



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                     
Query: 383      gagcttctcgaagatgtcgttgatgaaggagttcatg 419
                ||||||||||||||||| | ||| |||||||||||||
Sbjct: 11729269 gagcttctcgaagatgttgatgaagaaggagttcatg 11729305



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 402      ttgatgaaggagttcatgatggac 425
                ||||||||||||||||||||||||
Sbjct: 17523219 ttgatgaaggagttcatgatggac 17523242



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 384      agcttctcgaagatgtcgttgatgaa 409
                ||||||||||||||||| ||||||||
Sbjct: 19095814 agcttctcgaagatgtctttgatgaa 19095839



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 387      ttctcgaagatgtcgttgatgaagga 412
                |||||||||||||||||| |||||||
Sbjct: 15287651 ttctcgaagatgtcgttggtgaagga 15287626



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 380      ggcgagcttctcgaagatgtcgttgatga 408
                ||||||||||| ||||||||| |||||||
Sbjct: 24608038 ggcgagcttcttgaagatgtctttgatga 24608066



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 386      cttctcgaagatgtcgttgatgaa 409
                ||||||||||||||| ||||||||
Sbjct: 13969661 cttctcgaagatgtcattgatgaa 13969684



to top

>dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0605H02
          Length = 175547

 Score =  341 bits (172), Expect = 1e-90
 Identities = 205/216 (94%)
 Strand = Plus / Minus

                                                                          
Query: 226    cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
              ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120964 cctaagagctggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 120905

                                                                          
Query: 286    gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
              |||| || |||||||||||||||||||||||||||||||| | |||||||||||||||||
Sbjct: 120904 gctcgccggggaggacgaggcggacggaggtctggatctccctggaggtgatggtgggct 120845

                                                                          
Query: 346    tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
              |||||||||| |  ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120844 tcttgttgtacctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 120785

                                                  
Query: 406    tgaaggagttcatgatggacatggccttggaggaga 441
              |||| ||||||||||| |||||||||||||||||||
Sbjct: 120784 tgaacgagttcatgattgacatggccttggaggaga 120749



 Score =  188 bits (95), Expect = 1e-44
 Identities = 140/155 (90%)
 Strand = Plus / Minus

                                                                          
Query: 237    gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccaggg 296
              |||||||||||||||||||| |  |||||||||||||| |||||||||||||| ||  ||
Sbjct: 117452 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 117393

                                                                          
Query: 297    aggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356
              |||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||| 
Sbjct: 117392 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 117333

                                                 
Query: 357    cgcgcgagcttggcggcctcgccggcgagcttctc 391
              || ||||||||||||||||| ||| | ||||||||
Sbjct: 117332 cgggcgagcttggcggcctcaccgacaagcttctc 117298



to top

>dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complete cds
          Length = 552

 Score =  341 bits (172), Expect = 1e-90
 Identities = 205/216 (94%)
 Strand = Plus / Minus

                                                                       
Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
           |||||| ||| || ||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 479 cctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcga 420

                                                                       
Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
           |||| || |||||||||||||||||||||||||| ||||| |||||||||||||||||||
Sbjct: 419 gctcgccggggaggacgaggcggacggaggtctgaatctcccgggaggtgatggtgggct 360

                                                                       
Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
           ||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||
Sbjct: 359 tcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttga 300

                                               
Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441
           ||||||||||||||||||||||||||||||||||||
Sbjct: 299 tgaaggagttcatgatggacatggccttggaggaga 264



to top

>ref|NM_184405.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  339 bits (171), Expect = 5e-90
 Identities = 204/215 (94%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           ||||| ||| || ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 462 ctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcgag 403

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || |||||||||||||||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 402 ctcgccggggaggacgaggcggacggaggtctgaatctcccgggaggtgatggtgggctt 343

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           |||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||
Sbjct: 342 cttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgat 283

                                              
Query: 407 gaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||||||
Sbjct: 282 gaaggagttcatgatggacatggccttggaggaga 248



to top

>ref|NM_184403.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  339 bits (171), Expect = 5e-90
 Identities = 201/211 (95%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 458 gaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcg 399

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||
Sbjct: 398 ccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttg 339

                                                                       
Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410
           |||||||||||||||||||||| ||| |||||||||||||||||||| || |||||||||
Sbjct: 338 ttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgatgaag 279

                                          
Query: 411 gagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||
Sbjct: 278 gagttcatgatggacatggccttggaggaga 248



to top

>ref|NM_184374.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  339 bits (171), Expect = 5e-90
 Identities = 204/215 (94%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           ||||| ||||||||| || |||||||||||||||||||| ||||||||||||||||||||
Sbjct: 462 ctaagcggaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgag 403

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 402 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 343

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           |||||||||||| ||||||||||||| ||| ||||||||||||||||||||||| |||||
Sbjct: 342 cttgttgtagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgat 283

                                              
Query: 407 gaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||||||
Sbjct: 282 gaaggagttcatgatggacatggccttggaggaga 248



to top

>ref|XM_483094.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 453

 Score =  339 bits (171), Expect = 5e-90
 Identities = 204/215 (94%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           |||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 453 ctaagagctggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 394

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || |||||||||||||||||||||||||||||||| | ||||||||||||||||||
Sbjct: 393 ctcgccggggaggacgaggcggacggaggtctggatctccctggaggtgatggtgggctt 334

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           ||||||||| |  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 333 cttgttgtacctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 274

                                              
Query: 407 gaaggagttcatgatggacatggccttggaggaga 441
           ||| ||||||||||| |||||||||||||||||||
Sbjct: 273 gaacgagttcatgattgacatggccttggaggaga 239



to top

>emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214)
          Length = 580

 Score =  333 bits (168), Expect = 3e-88
 Identities = 204/216 (94%)
 Strand = Plus / Minus

                                                                       
Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
           ||||||| ||||||||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 460 cctaagacgaggtgaacttcgtaacggccttagtgccctcggagacggcgtgcttggcga 401

                                                                       
Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
           ||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||
Sbjct: 400 gctccccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggct 341

                                                                       
Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405
           |||||||||||||||| |||||||||| |||| | |||||||||||||||||||||||||
Sbjct: 340 tcttgttgtagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttga 281

                                               
Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441
           ||||||||||||||||||||||||||||||| ||||
Sbjct: 280 tgaaggagttcatgatggacatggccttggacgaga 245



to top

>emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3)
          Length = 1728

 Score =  321 bits (162), Expect = 1e-84
 Identities = 201/214 (93%)
 Strand = Plus / Minus

                                                                       
Query: 228 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287
           ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 495 taagaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 436

                                                                       
Query: 288 tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347
           || || |||||||||||||| || ||||||||||||||||||||||||| ||||||||||
Sbjct: 435 tcgccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgacggtgggcttc 376

                                                                       
Query: 348 ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407
           ||||| |||||||| |||||||||| |||| | |||||||||||||||||||||||||||
Sbjct: 375 ttgttatagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatg 316

                                             
Query: 408 aaggagttcatgatggacatggccttggaggaga 441
           ||||||||||||||||||||||||||||| ||||
Sbjct: 315 aaggagttcatgatggacatggccttggacgaga 282



to top

>gb|BT016350.1| Zea mays clone Contig183 mRNA sequence
          Length = 706

 Score =  317 bits (160), Expect = 2e-83
 Identities = 196/208 (94%)
 Strand = Plus / Minus

                                                                       
Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 507 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccg 448

                                                                       
Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353
           || ||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| 
Sbjct: 447 ggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtaggcttcttgtta 388

                                                                       
Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413
           |||||||||||||||||||||||  | ||||||||||||||||| ||||| |||||||||
Sbjct: 387 tagcgcgcgagcttggcggcctcagcagcgagcttctcgaagatatcgttaatgaaggag 328

                                       
Query: 414 ttcatgatggacatggccttggaggaga 441
           |||||||| |||||||||||||||||||
Sbjct: 327 ttcatgatcgacatggccttggaggaga 300



to top

>gb|BT016478.1| Zea mays clone Contig311 mRNA sequence
          Length = 836

 Score =  315 bits (159), Expect = 7e-83
 Identities = 201/215 (93%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           |||||| || |||||||||||||| ||||| ||||| || ||||||||||||||||||||
Sbjct: 552 ctaagacgaagtgaacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgag 493

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || || ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 492 ctcgccgggtaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 433

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           |||||||||||| |||||||||||||||||  ||||||||||||||||||||||||||||
Sbjct: 432 cttgttgtagcgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgat 373

                                              
Query: 407 gaaggagttcatgatggacatggccttggaggaga 441
           |||||| ||||||||||||||||||||||| ||||
Sbjct: 372 gaaggaattcatgatggacatggccttggacgaga 338



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  313 bits (158), Expect = 3e-82
 Identities = 194/206 (94%)
 Strand = Plus / Minus

                                                                           
Query: 236     ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
               ||||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||
Sbjct: 9465324 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9465265

                                                                           
Query: 296     gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9465264 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9465205

                                                                           
Query: 356     gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
               ||| |||||   |||||||||    |||||||||||||||||||||||||||||||||||
Sbjct: 9465204 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9465145

                                         
Query: 416     catgatggacatggccttggaggaga 441
               |||||| |||||||||||||||||||
Sbjct: 9465144 catgatcgacatggccttggaggaga 9465119



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                      
Query: 386      cttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
                ||||| |||||| ||||||||||||||||| ||||||| ||||||||| |||||
Sbjct: 11567062 cttcttgaagatatcgttgatgaaggagttgatgatggtcatggccttagagga 11567115



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                      
Query: 382      cgagcttctcgaagatgtcgttgatgaaggagttcatg 419
                ||||||||||||||||||||  ||||||||||||||||
Sbjct: 25627557 cgagcttctcgaagatgtcgaggatgaaggagttcatg 25627594



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 380      ggcgagcttctcgaagatgtcgttgatgaa 409
                |||||||||||| |||||||| ||||||||
Sbjct: 23486139 ggcgagcttctcaaagatgtctttgatgaa 23486110



to top

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  313 bits (158), Expect = 3e-82
 Identities = 194/206 (94%)
 Strand = Plus / Minus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              ||||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||
Sbjct: 162724 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 162665

                                                                          
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 162664 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 162605

                                                                          
Query: 356    gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
              ||| |||||   |||||||||    |||||||||||||||||||||||||||||||||||
Sbjct: 162604 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 162545

                                        
Query: 416    catgatggacatggccttggaggaga 441
              |||||| |||||||||||||||||||
Sbjct: 162544 catgatcgacatggccttggaggaga 162519



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  313 bits (158), Expect = 3e-82
 Identities = 194/206 (94%)
 Strand = Plus / Minus

                                                                           
Query: 236     ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
               ||||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||
Sbjct: 9463445 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9463386

                                                                           
Query: 296     gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9463385 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9463326

                                                                           
Query: 356     gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
               ||| |||||   |||||||||    |||||||||||||||||||||||||||||||||||
Sbjct: 9463325 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9463266

                                         
Query: 416     catgatggacatggccttggaggaga 441
               |||||| |||||||||||||||||||
Sbjct: 9463265 catgatcgacatggccttggaggaga 9463240



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                      
Query: 386      cttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
                ||||| |||||| ||||||||||||||||| ||||||| ||||||||| |||||
Sbjct: 11563825 cttcttgaagatatcgttgatgaaggagttgatgatggtcatggccttagagga 11563878



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                      
Query: 382      cgagcttctcgaagatgtcgttgatgaaggagttcatg 419
                ||||||||||||||||||||  ||||||||||||||||
Sbjct: 25718866 cgagcttctcgaagatgtcgaggatgaaggagttcatg 25718903



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 380      ggcgagcttctcgaagatgtcgttgatgaa 409
                |||||||||||| |||||||| ||||||||
Sbjct: 23479167 ggcgagcttctcaaagatgtctttgatgaa 23479138



to top

>gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence
          Length = 574

 Score =  309 bits (156), Expect = 4e-81
 Identities = 195/208 (93%)
 Strand = Plus / Minus

                                                                       
Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 299 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccg 240

                                                                       
Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353
           || ||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| 
Sbjct: 239 ggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtaggcttcttgtta 180

                                                                       
Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413
           |||||||| ||||||||||||||  | ||||||||||||||||| ||||| |||||||||
Sbjct: 179 tagcgcgccagcttggcggcctcagcagcgagcttctcgaagatatcgttaatgaaggag 120

                                       
Query: 414 ttcatgatggacatggccttggaggaga 441
           |||||||| |||||||||||||||||||
Sbjct: 119 ttcatgatcgacatggccttggaggaga 92



to top

>emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4)
          Length = 2361

 Score =  307 bits (155), Expect = 2e-80
 Identities = 200/215 (93%)
 Strand = Plus / Minus

                                                                        
Query: 227  ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
            ||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1378 ctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 1319

                                                                        
Query: 287  ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
            ||| ||||| ||||||||||| || || ||||||||||| |||||||| |||||||||||
Sbjct: 1318 ctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggctt 1259

                                                                        
Query: 347  cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
            |||||||||||| |||||||||||||||||| | || |||||||||||||||||||||||
Sbjct: 1258 cttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgat 1199

                                               
Query: 407  gaaggagttcatgatggacatggccttggaggaga 441
            |||||||||||||||||||||||||||||| ||||
Sbjct: 1198 gaaggagttcatgatggacatggccttggacgaga 1164



to top

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  297 bits (150), Expect = 2e-77
 Identities = 192/206 (93%)
 Strand = Plus / Plus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||
Sbjct: 75126 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 75185

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
             ||||||||||||||||||||||| ||||||||||||||||  | ||||||||||||||||
Sbjct: 75186 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 75245

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             ||| ||||| | |||||||||    |||||||||||||||||||||||||||||||||||
Sbjct: 75246 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 75305

                                       
Query: 416   catgatggacatggccttggaggaga 441
             |||||| |||||||||||||||||||
Sbjct: 75306 catgatcgacatggccttggaggaga 75331



to top

>gb|BT016885.1| Zea mays clone Contig718 mRNA sequence
          Length = 568

 Score =  289 bits (146), Expect = 4e-75
 Identities = 191/206 (92%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||||||||||||||||| ||||||||||||||||||||||||||||||||||| || ||
Sbjct: 326 ggtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcgccggg 267

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
           |||||||||||| ||||||||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 266 gaggacgaggcgaacggaggtctggatctcgcgggacgtaatggtaggcttcttgttgta 207

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
            ||||| |||||||| |||||  | || ||||||||||||||||||||||||||||||||
Sbjct: 206 ccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcgttgatgaaggagtt 147

                                     
Query: 416 catgatggacatggccttggaggaga 441
           ||||||||||||||||||||| ||||
Sbjct: 146 catgatggacatggccttggacgaga 121



to top

>gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, partial cds
          Length = 427

 Score =  281 bits (142), Expect = 9e-73
 Identities = 190/206 (92%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           ||||||||||||||||||||| || ||||||||||||||||||||||||||||| || ||
Sbjct: 289 ggtgaacttggtgacggccttagttccctcggagacggcgtgcttggcgagctcgccggg 230

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 229 gaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 170

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           ||| |||||    ||||| ||    |||||||||||||||||||||||||||||||||||
Sbjct: 169 gcgggcgaggcgtgcggcttcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 110

                                     
Query: 416 catgatggacatggccttggaggaga 441
           ||||||||||||||||||||||||||
Sbjct: 109 catgatggacatggccttggaggaga 84



to top

>gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partial cds
          Length = 410

 Score =  280 bits (141), Expect = 4e-72
 Identities = 195/213 (91%)
 Strand = Plus / Minus

                                                                       
Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286
           |||||| || ||||||||||||||||||||||||||||| || |||||||||||||||||
Sbjct: 213 ctaagaagaagtgaacttggtgacggccttggtgccctcagacacggcgtgcttggcgag 154

                                                                       
Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346
           ||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 153 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 94

                                                                       
Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406
           ||||||||| |  ||||||||||||| ||| || || |  ||||||||||||||| ||||
Sbjct: 93  cttgttgtacctggcgagcttggcggactcaccagccaatttctcgaagatgtcgctgat 34

                                            
Query: 407 gaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||||||||||||| |||||||
Sbjct: 33  gaaggagttcatgatggacatggccctggagga 1



to top

>ref|NM_190523.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 420

 Score =  272 bits (137), Expect = 9e-70
 Identities = 191/209 (91%)
 Strand = Plus / Minus

                                                                       
Query: 228 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287
           ||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 419 taagacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagc 360

                                                                       
Query: 288 tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347
           || || |||||||||||||| || ||||||||||||||||||||||||||||| ||||||
Sbjct: 359 tcgccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttc 300

                                                                       
Query: 348 ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407
           ||||||||||| |||||   |||||||||   |||||||||||||||||| |||||||||
Sbjct: 299 ttgttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatg 240

                                        
Query: 408 aaggagttcatgatggacatggccttgga 436
           || ||||||||||| ||||||||||||||
Sbjct: 239 aacgagttcatgatcgacatggccttgga 211



to top

>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0408C03
          Length = 141273

 Score =  272 bits (137), Expect = 9e-70
 Identities = 191/209 (91%)
 Strand = Plus / Plus

                                                                         
Query: 228   taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287
             ||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 20158 taagacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagc 20217

                                                                         
Query: 288   tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347
             || || |||||||||||||| || ||||||||||||||||||||||||||||| ||||||
Sbjct: 20218 tcgccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttc 20277

                                                                         
Query: 348   ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407
             ||||||||||| |||||   |||||||||   |||||||||||||||||| |||||||||
Sbjct: 20278 ttgttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatg 20337

                                          
Query: 408   aaggagttcatgatggacatggccttgga 436
             || ||||||||||| ||||||||||||||
Sbjct: 20338 aacgagttcatgatcgacatggccttgga 20366



to top

>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0031D11
          Length = 138108

 Score =  272 bits (137), Expect = 9e-70
 Identities = 191/209 (91%)
 Strand = Plus / Plus

                                                                          
Query: 228    taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287
              ||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 106111 taagacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagc 106170

                                                                          
Query: 288    tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347
              || || |||||||||||||| || ||||||||||||||||||||||||||||| ||||||
Sbjct: 106171 tcgccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttc 106230

                                                                          
Query: 348    ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407
              ||||||||||| |||||   |||||||||   |||||||||||||||||| |||||||||
Sbjct: 106231 ttgttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatg 106290

                                           
Query: 408    aaggagttcatgatggacatggccttgga 436
              || ||||||||||| ||||||||||||||
Sbjct: 106291 aacgagttcatgatcgacatggccttgga 106319



to top

>emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B
          Length = 492

 Score =  258 bits (130), Expect = 1e-65
 Identities = 172/186 (92%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 452 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccggg 393

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
           ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 333

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           ||| || ||   || ||||||   ||| |||||||||||||||||||||||||| |||||
Sbjct: 332 gcgggccaggcgggaggcctcctgggccagcttctcgaagatgtcgttgatgaacgagtt 273

                 
Query: 416 catgat 421
           ||||||
Sbjct: 272 catgat 267



to top

>ref|XM_475367.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 375

 Score =  252 bits (127), Expect = 8e-64
 Identities = 190/211 (90%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| 
Sbjct: 371 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 312

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 311 ccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttcttg 252

                                                                       
Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410
           ||||| |  || ||| | ||||||||     ||||||||||||| |||||||||| ||||
Sbjct: 251 ttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacgaag 192

                                          
Query: 411 gagttcatgatggacatggccttggaggaga 441
           || ||||||||||||||||||||||||||||
Sbjct: 191 gaattcatgatggacatggccttggaggaga 161



to top

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
             complete sequence
          Length = 163130

 Score =  252 bits (127), Expect = 8e-64
 Identities = 190/211 (90%)
 Strand = Plus / Minus

                                                                         
Query: 231   gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| 
Sbjct: 69874 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 69815

                                                                         
Query: 291   ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
             || ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 69814 ccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttcttg 69755

                                                                         
Query: 351   ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410
             ||||| |  || ||| | ||||||||     ||||||||||||| |||||||||| ||||
Sbjct: 69754 ttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacgaag 69695

                                            
Query: 411   gagttcatgatggacatggccttggaggaga 441
             || ||||||||||||||||||||||||||||
Sbjct: 69694 gaattcatgatggacatggccttggaggaga 69664



to top

>gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds
          Length = 627

 Score =  228 bits (115), Expect = 1e-56
 Identities = 178/199 (89%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||||||||||| |||||||||||||| |||||||||||||||||||||||||| || ||
Sbjct: 519 ggtgaacttggtcacggccttggtgccgtcggagacggcgtgcttggcgagctcgccggg 460

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
           ||| ||||| | ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 459 gagcacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 400

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           ||| || ||    | || |||   ||||||||||||||||||||||||||||||||||||
Sbjct: 399 gcgggccaggcgagaggactcctgggcgagcttctcgaagatgtcgttgatgaaggagtt 340

                              
Query: 416 catgatggacatggccttg 434
           ||||||   ||||||||||
Sbjct: 339 catgatccccatggccttg 321



to top

>dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B123, complete cds
          Length = 2901

 Score =  210 bits (106), Expect = 3e-51
 Identities = 175/198 (88%)
 Strand = Plus / Minus

                                                                        
Query: 244  tggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacga 303
            |||| ||||||||||| ||||||||||||||||||||||| ||||| || || | ||| |
Sbjct: 1985 tggtaacggccttggttccctcggagacggcgtgcttggcaagctcgcctggaaagacaa 1926

                                                                        
Query: 304  ggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcga 363
            |||| ||||  ||||||||||| || ||||||||||||||||||||||||||||| ||||
Sbjct: 1925 ggcgcacggcagtctggatctcccgagaggtgatggtgggcttcttgttgtagcgtgcga 1866

                                                                        
Query: 364  gcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatgg 423
            |||| || | ||| ||||||||||||||||||||||||||||||| |||||| |||||||
Sbjct: 1865 gctttgccgactctccggcgagcttctcgaagatgtcgttgatgatggagttgatgatgg 1806

                              
Query: 424  acatggccttggaggaga 441
            |||| |  ||||||||||
Sbjct: 1805 acattgatttggaggaga 1788



to top

>dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-D03, full
           insert sequence
          Length = 288

 Score =  196 bits (99), Expect = 4e-47
 Identities = 120/127 (94%)
 Strand = Plus / Minus

                                                                       
Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285
           |||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 135 cctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcga 76

                                                                       
Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345
           |||| || ||||||||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct: 75  gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 16

                  
Query: 346 tcttgtt 352
           |||||||
Sbjct: 15  tcttgtt 9



to top

>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV),
            and histone H2B (ch2b-IV) genes, complete cds
          Length = 4502

 Score =  192 bits (97), Expect = 7e-46
 Identities = 175/201 (87%)
 Strand = Plus / Minus

                                                                        
Query: 234  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293
            |||||||||||||| ||||||||||||||||| || || ||||||||||| ||||| || 
Sbjct: 4211 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 4152

                                                                        
Query: 294  gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353
            || || || ||||| |||| ||||||||||||||||||||| | ||||||||||||||||
Sbjct: 4151 ggcagcaccaggcgcacggcggtctggatctcgcgggaggtcacggtgggcttcttgttg 4092

                                                                        
Query: 354  tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413
            |||||    ||||||| |||||||  ||| | |||||| ||||||||||||||||||  |
Sbjct: 4091 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 4032

                                 
Query: 414  ttcatgatggacatggccttg 434
            |||||||||||||||||||||
Sbjct: 4031 ttcatgatggacatggccttg 4011



to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score =  184 bits (93), Expect = 2e-43
 Identities = 174/201 (86%)
 Strand = Plus / Plus

                                                                        
Query: 234  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293
            |||||||||||||| ||||||||||||||||| || || ||||||||||| ||||| |||
Sbjct: 3040 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgcca 3099

                                                                        
Query: 294  gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353
            || || || ||||| |||| |||||||||||| |||||||| | ||||||||||||||||
Sbjct: 3100 ggcagcaccaggcgcacggcggtctggatctcacgggaggtcacggtgggcttcttgttg 3159

                                                                        
Query: 354  tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413
            |||||    ||||||| |||||||  ||| | |||||| ||||||||||||||||||  |
Sbjct: 3160 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 3219

                                 
Query: 414  ttcatgatggacatggccttg 434
            |||||||| ||||||||||||
Sbjct: 3220 ttcatgatagacatggccttg 3240



to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III),
            histone H2B (ch2b-III) and histone H2A (ch2a-III) genes,
            complete cds
          Length = 4582

 Score =  176 bits (89), Expect = 4e-41
 Identities = 173/201 (86%)
 Strand = Plus / Plus

                                                                        
Query: 234  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293
            |||||||||||||| ||||||||||||||||| || || ||||||||||| ||||| || 
Sbjct: 2338 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 2397

                                                                        
Query: 294  gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353
            || || || ||||| || | ||||||||||||||||||||| | ||||||||||||||||
Sbjct: 2398 ggcagcaccaggcgcaccgcggtctggatctcgcgggaggtcacggtgggcttcttgttg 2457

                                                                        
Query: 354  tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413
            |||||    ||||||| ||||||   ||| | |||||| ||||||||||||||||||  |
Sbjct: 2458 tagcggctcagcttggaggcctcagtggccaccttctcaaagatgtcgttgatgaagctg 2517

                                 
Query: 414  ttcatgatggacatggccttg 434
            |||||||||||||||||||||
Sbjct: 2518 ttcatgatggacatggccttg 2538



to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score =  176 bits (89), Expect = 4e-41
 Identities = 173/201 (86%)
 Strand = Plus / Plus

                                                                        
Query: 234  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293
            |||||||||||||| ||||||||||||||||| || || |||||||| || ||||| || 
Sbjct: 2456 gaggtgaacttggtcacggccttggtgccctctgacaccgcgtgcttagccagctcaccg 2515

                                                                        
Query: 294  gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353
            || || || ||||| |||| ||||||||||||||| ||||| | ||||||||||||||||
Sbjct: 2516 ggcagcaccaggcgcacggcggtctggatctcgcgagaggtcacggtgggcttcttgttg 2575

                                                                        
Query: 354  tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413
            |||||    ||||||| |||||||  ||| | |||||| ||||||||||||||||||  |
Sbjct: 2576 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 2635

                                 
Query: 414  ttcatgatggacatggccttg 434
            |||||||||||||||||||||
Sbjct: 2636 ttcatgatggacatggccttg 2656



to top

>ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC483173), mRNA
          Length = 2193

 Score =  147 bits (74), Expect = 4e-32
 Identities = 173/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||||||||||||||    |||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 266

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   || ||||||||||||||    ||||||||||||||||| ||| |||||
Sbjct: 265 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 206

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 205 catgatgcccatggccttggacgaga 180



to top

>ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC483164), mRNA
          Length = 659

 Score =  147 bits (74), Expect = 4e-32
 Identities = 173/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 333

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||||||||||||||    |||||||||
Sbjct: 332 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 273

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   || ||||||||||||||    ||||||||||||||||| ||| |||||
Sbjct: 272 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 213

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 212 catgatgcccatggccttggacgaga 187



to top

>ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 1 (LOC483169), mRNA
          Length = 432

 Score =  147 bits (74), Expect = 4e-32
 Identities = 173/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 379 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 320

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||||||||||||||    |||||||||
Sbjct: 319 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 260

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   || ||||||||||||||    ||||||||||||||||| ||| |||||
Sbjct: 259 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 200

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 199 catgatgcccatggccttggacgaga 174



to top

>ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 2 (LOC483169), mRNA
          Length = 516

 Score =  147 bits (74), Expect = 4e-32
 Identities = 173/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||||||||||||||    |||||||||
Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 298

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   || ||||||||||||||    ||||||||||||||||| ||| |||||
Sbjct: 297 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 238

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 237 catgatgcccatggccttggacgaga 212



to top

>ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 5 (LOC483170), mRNA
          Length = 415

 Score =  147 bits (74), Expect = 4e-32
 Identities = 173/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||||||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   || ||||||||||||||    ||||||||||||||||| ||| |||||
Sbjct: 249 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 4 (LOC483170), mRNA
          Length = 597

 Score =  147 bits (74), Expect = 4e-32
 Identities = 173/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||||||||||||||    |||||||||
Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 298

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   || ||||||||||||||    ||||||||||||||||| ||| |||||
Sbjct: 297 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 238

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 237 catgatgcccatggccttggacgaga 212



to top

>ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260), mRNA
          Length = 753

 Score =  139 bits (70), Expect = 9e-30
 Identities = 172/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 384 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 325

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||||||||||||||    |||||||||
Sbjct: 324 cagcagcaggcgcacggccgtctggatctcgcgggaggtgatggtggagcgcttgttgta 265

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 264 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 205

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 204 catgatgcccatggccttggacgaga 179



to top

>ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG11626.1) partial mRNA
          Length = 414

 Score =  139 bits (70), Expect = 9e-30
 Identities = 160/190 (84%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           ||||||| ||||||||||| ||||||||||||||||||||||| ||||| || |||||||
Sbjct: 394 acttggtaacggccttggtaccctcggagacggcgtgcttggcaagctcaccggggagga 335

                                                                       
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
            ||||||||| |||||||| ||||| ||||| | |||||||| |||||||||||||   |
Sbjct: 334 tgaggcggacagaggtctgaatctctcgggaagagatggtggacttcttgttgtaggcgg 275

                                                                       
Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
           | |||||||  |||||    ||||    |||||| |||||||||| ||| ||||||| ||
Sbjct: 274 caagcttggaagcctcagaagcgacacgctcgaaaatgtcgttgacgaaagagttcagga 215

                     
Query: 421 tggacatggc 430
           ||||||||||
Sbjct: 214 tggacatggc 205



to top

>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds
          Length = 2132

 Score =  137 bits (69), Expect = 3e-29
 Identities = 165/197 (83%)
 Strand = Plus / Minus

                                                                        
Query: 237  gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccaggg 296
            |||||||||||||| ||||||||||||||||| |||||||||||||| ||||| || || 
Sbjct: 1583 gtgaacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgcccgga 1524

                                                                        
Query: 297  aggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356
            || || ||||| || |  ||||| || ||||| || || | |||||||||||||||||||
Sbjct: 1523 agaaccaggcgcacagcagtctgaatttcgcgcgacgtcacggtgggcttcttgttgtag 1464

                                                                        
Query: 357  cgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 416
            ||    ||||||| |||||||  ||| | |||||| ||||||||||||||||||  ||||
Sbjct: 1463 cggctcagcttggaggcctcggtggcaaccttctcaaagatgtcgttgatgaagctgttc 1404

                             
Query: 417  atgatggacatggcctt 433
            || || |||||||||||
Sbjct: 1403 ataatcgacatggcctt 1387



to top

>ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus similar to testis-specific
           histone 2b (LOC589998), mRNA
          Length = 372

 Score =  135 bits (68), Expect = 1e-28
 Identities = 170/204 (83%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           |||| |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 365 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctct 306

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || ||||||| ||| ||||| | |||||||||||| |||  | ||||||||| |||||||
Sbjct: 305 ccggggaggaggagacggacagcggtctggatctctcggctgctgatggtggccttcttg 246

                                                                       
Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410
           |||||||  || ||   ||  ||||| |||||||    ||||||||  ||||||| ||||
Sbjct: 245 ttgtagcctgcaaggcgggaagcctcaccggcgatacgctcgaagacatcgttgacgaag 186

                                   
Query: 411 gagttcatgatggacatggccttg 434
             ||||||||||||||||||||||
Sbjct: 185 ctgttcatgatggacatggccttg 162



to top

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score =  133 bits (67), Expect = 5e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                        
Query: 236  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
            |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 2063 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 2004

                                                           
Query: 296  gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
             | ||  |||||||| | |||||||||||| ||||||||||||||||
Sbjct: 2003 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 1957



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 408  aaggagttcatgatggacatggccttggaggaga 441
            |||||||||||||||  |||||||||||| ||||
Sbjct: 1891 aaggagttcatgatgctcatggccttggaagaga 1858



to top

>gb|BC077399.1| Xenopus laevis histone H2B, mRNA (cDNA clone MGC:81709
           IMAGE:6865010), complete cds
          Length = 1379

 Score =  133 bits (67), Expect = 5e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 333

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            | ||  |||||||| | |||||||||||| ||||||||||||||||
Sbjct: 332 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 286



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 408 aaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||  |||||||||||| ||||
Sbjct: 220 aaggagttcatgatgctcatggccttggaagaga 187



to top

>gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial cds
          Length = 478

 Score =  133 bits (67), Expect = 5e-28
 Identities = 166/199 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           ||||||||| || ||||||||||| || || || || ||||||||||||||||| |||||
Sbjct: 274 ggtgaacttagtcacggccttggtcccttccgaaacagcgtgcttggcgagctcaccagg 215

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
           ||| ||||| |  |||||||||||||| || ||||| ||||| || || |||||||||||
Sbjct: 214 gagcacgagcctcacggaggtctggatttcccgggaagtgatcgtcggtttcttgttgta 155

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
            | ||||||| |||  | |||   ||||||||||||||| |||||||||||||||  |||
Sbjct: 154 cctcgcgagcctggacgactcctgggcgagcttctcgaaaatgtcgttgatgaagctgtt 95

                              
Query: 416 catgatggacatggccttg 434
           ||||||   ||||||||||
Sbjct: 94  catgattcccatggccttg 76



to top

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score =  133 bits (67), Expect = 5e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                        
Query: 236  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
            |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 2073 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 2014

                                                           
Query: 296  gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
             | ||  |||||||| | |||||||||||| ||||||||||||||||
Sbjct: 2013 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 1967



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 408  aaggagttcatgatggacatggccttggaggaga 441
            |||||||||||||||  |||||||||||| ||||
Sbjct: 1901 aaggagttcatgatgctcatggccttggaagaga 1868



to top

>gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129733
           IMAGE:40014260), complete cds
          Length = 459

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 311

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 310 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 251

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 250 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 191

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 190 catgatgcccatggccttggacgaga 165



to top

>gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129734
           IMAGE:40014264), complete cds
          Length = 459

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 311

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 310 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 251

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 250 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 191

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 190 catgatgcccatggccttggacgaga 165



to top

>gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:78419
           IMAGE:3936695), complete cds
          Length = 2224

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 393 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 334

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 274

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 273 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 214

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 213 catgatgcccatggccttggacgaga 188



to top

>gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IMAGE:2989788), with
           apparent retained intron
          Length = 2210

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 381 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 322

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 321 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 262

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 261 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 202

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 201 catgatgcccatggccttggacgaga 176



to top

>ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA
          Length = 2223

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 352

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 351 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 292

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 291 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 232

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 231 catgatgcccatggccttggacgaga 206



to top

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
              (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
              IgG, high affinity Ia, receptor for (CD64), a novel gene
              similar to histone 2, H2be (HIST2H2BE), a novel gene
              similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
              histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
              HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
              pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
              (HIST2H2BC), a novel gene similar to histone 2, H2aa
              (HIST2H2AA), a novel gene similar to histone 2, H3c
              (HIST2H3C), a novel gene similar to histone 1, H4
              (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
              HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
              histone 2, H2ab, a novel protein similar to histone 2, a
              novel gene, the SV2A gene for synaptic vesicle glycoprotein
              2A, the 3' end of the SF3B4 gene for splicing factor 3b,
              subunit 4, 49kDa and five CpG islands, complete sequence
          Length = 188956

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Plus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 147982 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 148041

                                                                          
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
               || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 148042 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 148101

                                                                          
Query: 356    gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
              | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 148102 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 148161

                                        
Query: 416    catgatggacatggccttggaggaga 441
              |||||||  |||||||||||| ||||
Sbjct: 148162 catgatgcccatggccttggacgaga 148187



 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Plus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 73670 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 73729

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 73730 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 73789

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 73790 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 73849

                                       
Query: 416   catgatggacatggccttggaggaga 441
             |||||||  |||||||||||| ||||
Sbjct: 73850 catgatgcccatggccttggacgaga 73875



 Score =  107 bits (54), Expect = 3e-20
 Identities = 160/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Plus

                                                                          
Query: 241    acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
              |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 112138 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 112197

                                                                          
Query: 301    cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
                ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||| |||
Sbjct: 112198 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 112256

                                                                          
Query: 361    cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
              | ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||||||||
Sbjct: 112257 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 112316

                            
Query: 421    tggacatggccttg 434
              ||  ||||||||||
Sbjct: 112317 tgcccatggccttg 112330



 Score =  107 bits (54), Expect = 3e-20
 Identities = 160/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                          
Query: 241    acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
              |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 105128 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 105069

                                                                          
Query: 301    cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
                ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||| |||
Sbjct: 105068 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 105010

                                                                          
Query: 361    cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
              | ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||||||||
Sbjct: 105009 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 104950

                            
Query: 421    tggacatggccttg 434
              ||  ||||||||||
Sbjct: 104949 tgcccatggccttg 104936



to top

>emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A
          Length = 2964

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 869 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 810

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 809 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 750

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 749 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 690

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 689 catgatgcccatggccttggacgaga 664



to top

>emb|CR541895.1| Homo sapiens full open reading frame cDNA clone RZPDo834A0933D for
           gene HIST2H2BE, histone 2, H2be; complete cds, incl.
           stopcodon
          Length = 381

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 249 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:116767
           IMAGE:40002353), complete cds
          Length = 430

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 249 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, complete cds
          Length = 1137

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 749 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 690

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 689 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 630

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 629 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 570

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 569 catgatgcccatggccttggacgaga 544



to top

>gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870.01X histone 2 H2be
           (HIST2H2BE) mRNA, complete cds
          Length = 381

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 249 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119804
           IMAGE:40014249), complete cds
          Length = 456

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 249 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>gb|BC098112.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119802
           IMAGE:40014245), complete cds
          Length = 458

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 249 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA
          Length = 1858

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 283

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 282 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 223

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 222 catgatgcccatggccttggacgaga 197



to top

>gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MGC:131639
           IMAGE:5224812), complete cds
          Length = 1858

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 283

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 282 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 223

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 222 catgatgcccatggccttggacgaga 197



to top

>gb|M60756.1|HUMHISH2BA Human histone H2B.1 mRNA, 3' end
          Length = 2100

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 294 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 235

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 234 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 175

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 174 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 115

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 114 catgatgcccatggccttggacgaga 89



to top

>emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC DP26B06, DP34F04, DP16D11,
             DP09G08, DP35C12 of chromosome 5  of Podospora anserina
          Length = 322194

 Score =  127 bits (64), Expect = 3e-26
 Identities = 103/116 (88%)
 Strand = Plus / Minus

                                                                         
Query: 241   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
             |||||||||||||||||||||| || || |||||||||||||| ||||| || || ||||
Sbjct: 23470 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 23411

                                                                     
Query: 301   cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356
              |||||| ||||||||||||||||| ||||| | |||||||| |||||||||||||
Sbjct: 23410 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgtag 23355



to top

>emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F04 of chromosome 5 of Podospora
             anserina
          Length = 103568

 Score =  127 bits (64), Expect = 3e-26
 Identities = 103/116 (88%)
 Strand = Plus / Plus

                                                                         
Query: 241   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
             |||||||||||||||||||||| || || |||||||||||||| ||||| || || ||||
Sbjct: 81641 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 81700

                                                                     
Query: 301   cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356
              |||||| ||||||||||||||||| ||||| | |||||||| |||||||||||||
Sbjct: 81701 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgtag 81756



to top

>ref|XM_524860.1| PREDICTED: Pan troglodytes LOC469477 (LOC469477), mRNA
          Length = 1068

 Score =  125 bits (63), Expect = 1e-25
 Identities = 172/207 (83%), Gaps = 1/207 (0%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacg-gccttggtgccctcggagacggcgtgcttggcgagctccccag 294
           |||| ||||||||||| ||||||||||||||||| |||||||||||||| ||||| || |
Sbjct: 370 ggtgtacttggtgacgcgccttggtgccctcggacacggcgtgcttggccagctcgccgg 311

                                                                       
Query: 295 ggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgt 354
           | || |  ||||| ||||  ||||||||||||||||| ||||||||||    ||||||||
Sbjct: 310 gcagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgt 251

                                                                       
Query: 355 agcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagt 414
           || |||| ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||
Sbjct: 250 agtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagt 191

                                      
Query: 415 tcatgatggacatggccttggaggaga 441
           ||||||||  |||||||||||| ||||
Sbjct: 190 tcatgatgcccatggccttggacgaga 164



to top

>dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone H2B, complete cds
          Length = 425

 Score =  125 bits (63), Expect = 1e-25
 Identities = 96/107 (89%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||| ||||||||||||||||||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggctttggtgccctcggagacggcgtgcttggccagctctccggg 310

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            || |  |||||||||| |||||||||||| ||||||||||||||||
Sbjct: 309 cagcagcaggcggacggcggtctggatctcccgggaggtgatggtgg 263



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           ||||||||||||||||| ||||||||||||||||  |||||||||||||||||
Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgctcatggccttggaggaga 164



to top

>emb|CR855675.2| Xenopus tropicalis finished cDNA, clone TGas058p09
          Length = 484

 Score =  125 bits (63), Expect = 1e-25
 Identities = 96/107 (89%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 375 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctccccagg 316

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            || |  |||||||| | |||||||||||| ||||||||||||||||
Sbjct: 315 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 269



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 399 tcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||  |||||||||||| ||||
Sbjct: 212 tcgttgacaaaggagttcatgatgctcatggccttggaagaga 170



to top

>ref|XM_518301.1| PREDICTED: Pan troglodytes similar to histone H2B (LOC462508), mRNA
          Length = 1026

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 461 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 402

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
           ||| |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 401 gagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 342

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||||||||    |||||||||||| |||| |||||||||
Sbjct: 341 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 282

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 281 catgatgcccatggccttggacgaga 256



to top

>ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3, H2bb (LOC469701),
           mRNA
          Length = 399

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 387 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccagg 328

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||| |  |||||||| ||||||||||    |||||||||
Sbjct: 327 cagcagcaggcgcacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 268

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   || |||||||| |||||    |||||||||||| |||| |||||||||
Sbjct: 267 gtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 208

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 207 catgatgcccatggccttggacgaga 182



to top

>emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chromosome 1 Contains four
              novel genes, a novel gene (MGC57827), a ribosomal protein
              L22 (RPL22) pseudogene, a histone 2 H3c (HIST2H3C)
              pseudogene, the HIST2H2BB gene for histone 2 H2bb, the
              FCGR1B gene for Fc fragment of IgG high affinity Ib
              receptor for (CD64) and three CpG islands, complete
              sequence
          Length = 189539

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 159255 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 159196

                                                                          
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
               || |  ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 159195 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 159136

                                                                          
Query: 356    gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
              | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 159135 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 159076

                                        
Query: 416    catgatggacatggccttggaggaga 441
              |||||||  |||||||||||| ||||
Sbjct: 159075 catgatgcccatggccttggacgaga 159050



to top

>emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N21 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme HBUCE1 pseudogene, the FCGR1C
             gene for Fc fragment of IgG high affinity Ic receptor for
             (CD64), two novel genes, the HIST2H2BA gene for histone 2
             H2ba, the gene for a novel protein similar to histone 2
             H3c (HIST2H3C), a novel gene, a ribosomal protein L22
             (RPL22) pseudogene, a novel gene and three CpG islands,
             complete sequence
          Length = 129426

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Plus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 68592 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 68651

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 68652 cagcagcaggcgcacggccgtctggatctcgcgggacgtgatggtggagcgcttgttgta 68711

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 68712 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 68771

                                       
Query: 416   catgatggacatggccttggaggaga 441
             |||||||  ||||| |||||| ||||
Sbjct: 68772 catgatgcccatggtcttggacgaga 68797



to top

>ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudogene on chromosome 1
          Length = 1137

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 629

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 628 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 569

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 568 catgatgcccatggccttggacgaga 543



to top

>ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudogene on chromosome 1
          Length = 1137

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 629

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 628 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 569

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 568 catgatgcccatggccttggacgaga 543



to top

>gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, complete sequence
          Length = 1137

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 629

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 628 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 569

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 568 catgatgcccatggccttggacgaga 543



to top

>gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, complete sequence
          Length = 1137

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 629

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 628 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 569

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 568 catgatgcccatggccttggacgaga 543



to top

>gb|BC106916.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA
           clone MGC:126031 IMAGE:40032208), complete cds
          Length = 520

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 378 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 319

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 318 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 259

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 258 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 199

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 198 catgatgcccatggccttggacgaga 173



to top

>gb|BC073925.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA
           clone MGC:90432 IMAGE:5190019), complete cds
          Length = 2221

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 350 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 291

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 290 cagcagcaggcgcacggccgtctggatctcgcgggacgtgatggtggagcgcttgttgta 231

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  ||||| || ||||    ||||||||||||||||| |||||||||
Sbjct: 230 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 171

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  ||||| |||||| ||||
Sbjct: 170 catgatgcccatggtcttggacgaga 145



to top

>gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes, complete cds
          Length = 1442

 Score =  123 bits (62), Expect = 5e-25
 Identities = 173/210 (82%)
 Strand = Plus / Minus

                                                                        
Query: 228  taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287
            |||| ||| |||||||||||||| |||||||| |||||||| || ||||||||||| |||
Sbjct: 1273 taagcggacgtgaacttggtgacagccttggttccctcggacacagcgtgcttggccagc 1214

                                                                        
Query: 288  tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347
            || || || ||||| ||||| ||||  |||||||| ||||| || |||| ||| ||||||
Sbjct: 1213 tcgcctggcaggacaaggcgcacggcagtctggatttcgcgagacgtgacggtcggcttc 1154

                                                                        
Query: 348  ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407
            |||||||| ||    ||||| |  ||||||  ||||| |||||| || ||||||||||||
Sbjct: 1153 ttgttgtaacggctaagctttgaagcctcggtggcgaccttctcaaatatgtcgttgatg 1094

                                          
Query: 408  aaggagttcatgatggacatggccttggag 437
            |||  ||||||||||  ||| |||||||||
Sbjct: 1093 aagctgttcatgatgctcatcgccttggag 1064



to top

>gb|BC077692.1| Xenopus tropicalis histone 1, H2bk, mRNA (cDNA clone MGC:89948
           IMAGE:7030528), complete cds
          Length = 540

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||| || ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 409 ggtgtacttggtaacagccttggtgccctcggacacggcgtgcttggccagctccccagg 350

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            || |  |||||||| | |||||||||||| ||||||||||||||||
Sbjct: 349 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 303



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 399 tcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||  |||||||||||||||||
Sbjct: 246 tcgttgacaaaggagttcatgatgctcatggccttggaggaga 204



to top

>ref|NM_001006890.1| Xenopus tropicalis histone 1, H2bk (hist1h2bk), mRNA
          Length = 540

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||| || ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 409 ggtgtacttggtaacagccttggtgccctcggacacggcgtgcttggccagctccccagg 350

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            || |  |||||||| | |||||||||||| ||||||||||||||||
Sbjct: 349 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 303



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 399 tcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||  |||||||||||||||||
Sbjct: 246 tcgttgacaaaggagttcatgatgctcatggccttggaggaga 204



to top

>ref|XM_527280.1| PREDICTED: Pan troglodytes similar to ribosomal protein L24-like;
           homolog of yeast ribosomal like protein 24; 60S
           ribosomal protein L30 isolog; my024 protein (LOC471902),
           mRNA
          Length = 1131

 Score =  115 bits (58), Expect = 1e-22
 Identities = 154/186 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| |||| |||||||||||| | |||||||||||| |    |||||||||
Sbjct: 309 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  |||||||  |||||   ||||||||||||||||| |||||||||
Sbjct: 249 gtgcgccaggcgggaagcctcgcttgcgaggcgctcgaagatgtcgttgacgaaggagtt 190

                 
Query: 416 catgat 421
           ||||||
Sbjct: 189 catgat 184



to top

>gb|BC101411.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125414
           IMAGE:40021691), complete cds
          Length = 432

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||||||||    |||||||||||| |||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>gb|BC101413.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125416
           IMAGE:40021695), complete cds
          Length = 431

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||||||||    |||||||||||| |||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>gb|BC101412.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125415
           IMAGE:40021693), complete cds
          Length = 431

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||||||||    |||||||||||| |||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6
          Length = 269712

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| ||
Sbjct: 183927 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 183868

                                                                          
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
               || |  ||||| ||||  ||||||||||| | ||||||||||||||    |||||||||
Sbjct: 183867 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 183808

                                                                          
Query: 356    gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
                |||| ||   ||  |||||||| ||||    ||||||||| ||||||| |||||||||
Sbjct: 183807 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 183748

                                        
Query: 416    catgatggacatggccttggaggaga 441
              |||||||  |||||||||||| ||||
Sbjct: 183747 catgatgcccatggccttggatgaga 183722



 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 142538 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 142479

                                                                          
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
               || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 142478 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 142419

                                                                          
Query: 356    gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
                |||| ||   ||  |||||||| ||||    ||||||||||||||||| |||||| ||
Sbjct: 142418 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 142359

                    
Query: 416    catgat 421
              ||||||
Sbjct: 142358 catgat 142353



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| |||||||||||||||| ||||||||||| |||||||||||||| || ||||||||
Sbjct: 236019 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 235960

                                                           
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340
               || |  ||||| ||||  ||||||||||| | ||||||||||||
Sbjct: 235959 cagcagcaggcgcacggctgtctggatctccctggaggtgatggt 235915



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 107478 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 107537

                                                           
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340
               || |  ||||| ||||  ||||||||||| | ||||||||||||
Sbjct: 107538 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 107582



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 150/186 (80%)
 Strand = Plus / Minus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| ||||||| ||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 168164 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 168105

                                                                          
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
               || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 168104 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 168045

                                                                          
Query: 356    gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
                |||| ||   ||  |||||||||||||    |||||||||||||||||  ||||| ||
Sbjct: 168044 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 167985

                    
Query: 416    catgat 421
              ||||||
Sbjct: 167984 catgat 167979



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                       
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 292
              |||| |||||||||| |||||||||||||| || || ||||| ||||| ||||||||
Sbjct: 257344 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctcccc 257288



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 389   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
             ||||||||||||||||| |||||| ||||||||   |||||||||||| ||||
Sbjct: 27384 ctcgaagatgtcgttgacgaaggaattcatgatccccatggccttggatgaga 27436



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                  
Query: 390    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
              |||||||||||||| | |||||| |||||||||  |||||||||||| ||||
Sbjct: 200429 tcgaagatgtcgttaacgaaggaattcatgatgcccatggccttggatgaga 200480



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                          
Query: 241    acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
              |||||||||| |||||||| || ||||| || ||||||||||| ||||| || || || |
Sbjct: 200280 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagca 200339

                                                      
Query: 301    cgaggcggacggaggtctggatctcgcgggaggtgatggt 340
                || || |||| |||||||||||| | |||||| |||||
Sbjct: 200340 gcagacgcacggcggtctggatctccctggaggtaatggt 200379



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 81/100 (81%)
 Strand = Plus / Plus

                                                                         
Query: 241   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
             ||||||| || ||||| ||||||||||| || || ||||| || ||||||||||| || |
Sbjct: 27236 acttggtaactgccttagtgccctcggacacagcatgcttagccagctccccaggcagca 27295

                                                     
Query: 301   cgaggcggacggaggtctggatctcgcgggaggtgatggt 340
               ||||| || |  ||||| ||||| | ||||||||||||
Sbjct: 27296 gcaggcgcacagccgtctgaatctccctggaggtgatggt 27335



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 389    ctcgaagatgtcgttgatgaaggagttcat 418
              |||||| |||||||||| ||||||||||||
Sbjct: 257191 ctcgaaaatgtcgttgacgaaggagttcat 257162



to top

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Plus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 55422 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 55481

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 55482 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 55541

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
               |||| ||   ||  |||||||||||||    |||||||||||| |||| |||||||||
Sbjct: 55542 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 55601

                                       
Query: 416   catgatggacatggccttggaggaga 441
             |||||||  |||||||||||| ||||
Sbjct: 55602 catgatgcccatggccttggacgaga 55627



 Score =  107 bits (54), Expect = 3e-20
 Identities = 153/186 (82%)
 Strand = Plus / Minus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 86914 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 86855

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| |||| |||||||||||| | |||||||||||| |    |||||||||
Sbjct: 86854 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 86795

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             | |||| ||   ||  |||||||  ||||    ||||||||||||||||| |||||||||
Sbjct: 86794 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 86735

                   
Query: 416   catgat 421
             ||||||
Sbjct: 86734 catgat 86729



 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 161/198 (81%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| ||
Sbjct: 621 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 680

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 681 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 740

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||| |||||||| |||| |||||||||
Sbjct: 741 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 800

                             
Query: 416 catgatggacatggcctt 433
           |||||||  |||||||||
Sbjct: 801 catgatgcccatggcctt 818



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 42/43 (97%)
 Strand = Plus / Plus

                                                        
Query: 241   acttggtgacggccttggtgccctcggagacggcgtgcttggc 283
             |||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 79045 acttggtgacggccttggtgccctcggacacggcgtgcttggc 79087



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 393   aagatgtcgttgatgaaggagttcatgat 421
             ||||||||||||| |||||||||||||||
Sbjct: 79197 aagatgtcgttgacgaaggagttcatgat 79225



to top

>ref|NM_003522.3| Homo sapiens histone 1, H2bf (HIST1H2BF), mRNA
          Length = 430

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | ||||||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||| ||||||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggatgaga 164



to top

>ref|NM_003520.3| Homo sapiens histone 1, H2bn (HIST1H2BN), mRNA
          Length = 449

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||||||||    |||||||||||| |||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>gb|BC011372.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone IMAGE:3871305), with
           apparent retained intron
          Length = 2200

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 430 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 371

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 370 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 311

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||||||||    |||||||||||| |||| |||||||||
Sbjct: 310 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 251

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 250 catgatgcccatggccttggacgaga 225



to top

>gb|AF531297.1| Homo sapiens histone H2B (HIST1H2BN) gene, complete cds
          Length = 1137

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 749 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 690

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 689 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 630

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||||||||    |||||||||||| |||| |||||||||
Sbjct: 629 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 570

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 569 catgatgcccatggccttggacgaga 544



to top

>gb|AF531289.1| Homo sapiens histone H2B (HIST1H2BF) gene, complete cds
          Length = 1137

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| ||
Sbjct: 749 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 690

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | ||||||||||||||    |||||||||
Sbjct: 689 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 630

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||| ||||||| |||||||||
Sbjct: 629 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 570

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 569 catgatgcccatggccttggatgaga 544



to top

>gb|BC009783.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:13513
           IMAGE:4132165), complete cds
          Length = 744

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 491 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 432

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 431 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 372

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||||||||    |||||||||||| |||| |||||||||
Sbjct: 371 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 312

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 311 catgatgcccatggccttggacgaga 286



to top

>gb|BC056264.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IMAGE:6668499),
           partial cds
          Length = 1219

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| ||
Sbjct: 412 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 353

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | ||||||||||||||    |||||||||
Sbjct: 352 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 293

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||| ||||||| |||||||||
Sbjct: 292 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 233

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 232 catgatgcccatggccttggatgaga 207



to top

>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3
            Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ,
            H2AFN, and H2BFN histone genes, the OR2B2 gene for
            olfactory receptor 2B2, histone H2B family member I
            pseudogene H2BFIP, a hypothetical protein pseudogene,
            ESTs, STSs, GSSs and CpG islands, complete sequence
          Length = 100374

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                        
Query: 236  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
            |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 2771 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 2712

                                                                        
Query: 296  gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
             || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 2711 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 2652

                                                                        
Query: 356  gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
              |||| ||   ||  |||||||||||||    |||||||||||| |||| |||||||||
Sbjct: 2651 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 2592

                                      
Query: 416  catgatggacatggccttggaggaga 441
            |||||||  |||||||||||| ||||
Sbjct: 2591 catgatgcccatggccttggacgaga 2566



 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 161/198 (81%)
 Strand = Plus / Minus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| ||
Sbjct: 57572 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 57513

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 57512 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 57453

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
               |||| ||   ||  |||||||| ||||    ||| |||||||| |||| |||||||||
Sbjct: 57452 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 57393

                               
Query: 416   catgatggacatggcctt 433
             |||||||  |||||||||
Sbjct: 57392 catgatgcccatggcctt 57375



to top

>emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 on chromosome 6p21.31-22.2
            Contains seventeen histone (pseudo)genes and gene RPS10P1
            (40S Ribosomal protein S10 pseudogene 1), three CpG
            islands, ESTs, STSs and GSSs, complete sequence
          Length = 89301

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                        
Query: 236  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
            |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| ||
Sbjct: 5309 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 5250

                                                                        
Query: 296  gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
             || |  ||||| ||||  ||||||||||| | ||||||||||||||    |||||||||
Sbjct: 5249 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 5190

                                                                        
Query: 356  gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
              |||| ||   ||  |||||||| ||||    ||||||||| ||||||| |||||||||
Sbjct: 5189 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 5130

                                      
Query: 416  catgatggacatggccttggaggaga 441
            |||||||  |||||||||||| ||||
Sbjct: 5129 catgatgcccatggccttggatgaga 5104



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||||||||||||||| ||||||||||| |||||||||||||| || ||||||||
Sbjct: 57401 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 57342

                                                          
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340
              || |  ||||| ||||  ||||||||||| | ||||||||||||
Sbjct: 57341 cagcagcaggcgcacggctgtctggatctccctggaggtgatggt 57297



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                      
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 292
             |||| |||||||||| |||||||||||||| || || ||||| ||||| ||||||||
Sbjct: 78726 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctcccc 78670



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                 
Query: 390   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
             |||||||||||||| | |||||| |||||||||  |||||||||||| ||||
Sbjct: 21811 tcgaagatgtcgttaacgaaggaattcatgatgcccatggccttggatgaga 21862



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                         
Query: 241   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
             |||||||||| |||||||| || ||||| || ||||||||||| ||||| || || || |
Sbjct: 21662 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagca 21721

                                                     
Query: 301   cgaggcggacggaggtctggatctcgcgggaggtgatggt 340
               || || |||| |||||||||||| | |||||| |||||
Sbjct: 21722 gcagacgcacggcggtctggatctccctggaggtaatggt 21761



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 389   ctcgaagatgtcgttgatgaaggagttcat 418
             |||||| |||||||||| ||||||||||||
Sbjct: 78573 ctcgaaaatgtcgttgacgaaggagttcat 78544



to top

>emb|Z83336.1|HSZ83336 H.sapiens hH2B/d gene
          Length = 701

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 599 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 540

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 539 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 480

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||||||||    |||||||||||| |||| |||||||||
Sbjct: 479 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 420

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 419 catgatgcccatggccttggacgaga 394



to top

>gb|BC096123.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MGC:116769
           IMAGE:40002357), complete cds
          Length = 430

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | ||||||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||| ||||||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggatgaga 164



to top

>gb|BC096120.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MGC:116766
           IMAGE:40002352), complete cds
          Length = 430

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | ||||||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||| ||||||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggatgaga 164



to top

>dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501
          Length = 1723

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                        
Query: 236  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
            |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 1271 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 1212

                                                                        
Query: 296  gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
             || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 1211 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 1152

                                                                        
Query: 356  gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
              |||| ||   ||  |||||||||||||    |||||||||||| |||| |||||||||
Sbjct: 1151 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 1092

                                      
Query: 416  catgatggacatggccttggaggaga 441
            |||||||  |||||||||||| ||||
Sbjct: 1091 catgatgcccatggccttggacgaga 1066



to top

>emb|Z80779.1|HSH2BG H.sapiens H2B/g gene
          Length = 1020

 Score =  115 bits (58), Expect = 1e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| ||
Sbjct: 566 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 507

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | ||||||||||||||    |||||||||
Sbjct: 506 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 447

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||| ||||||| |||||||||
Sbjct: 446 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 387

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 386 catgatgcccatggccttggatgaga 361



to top

>ref|XM_782648.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC582704), mRNA
          Length = 372

 Score =  113 bits (57), Expect = 5e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           |||| |||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 365 gaggtggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctct 306

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || ||||||| ||| ||||| | |||||||||||| |||  | ||||||||| |||||||
Sbjct: 305 ccggggaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttg 246

                
Query: 351 ttgta 355
           |||||
Sbjct: 245 ttgta 241



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 434
           ||||||||  ||||||| ||||  ||||||||||||||||||||||
Sbjct: 207 ctcgaagacatcgttgacgaagctgttcatgatggacatggccttg 162



to top

>ref|XM_785670.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC585864), mRNA
          Length = 372

 Score =  113 bits (57), Expect = 5e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           |||| |||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 365 gaggtggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctct 306

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || ||||||| ||| ||||| | |||||||||||| |||  | ||||||||| |||||||
Sbjct: 305 ccggggaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttg 246

                
Query: 351 ttgta 355
           |||||
Sbjct: 245 ttgta 241



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 434
           ||||||||  ||||||| ||||  ||||||||||||||||||||||
Sbjct: 207 ctcgaagacatcgttgacgaagctgttcatgatggacatggccttg 162



to top

>ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC587419), mRNA
          Length = 372

 Score =  111 bits (56), Expect = 2e-21
 Identities = 155/188 (82%)
 Strand = Plus / Minus

                                                                       
Query: 243 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacg 302
           ||||||||||||||||||||||| ||||||||||||||||| ||||| || ||||||| |
Sbjct: 353 ttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggggaggagg 294

                                                                       
Query: 303 aggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcg 362
           || | ||| | |||||||| ||| |||  ||||||||| | ||||||||||||| | || 
Sbjct: 293 agtctgacagcggtctggacctcacggctggtgatggtagacttcttgttgtagtgggca 234

                                                                       
Query: 363 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 422
           ||   ||  |||||| ||||||    ||||||||  ||||||| ||||  ||||||||||
Sbjct: 233 agacgggaagcctcggcggcgatgcgctcgaagacatcgttgacgaagctgttcatgatg 174

                   
Query: 423 gacatggc 430
           ||||||||
Sbjct: 173 gacatggc 166



to top

>gb|M14142.1|SUPH2B1 P.miliaris histone H2B-2.1 gene, complete cds
          Length = 375

 Score =  111 bits (56), Expect = 2e-21
 Identities = 164/200 (82%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           |||| |||| ||||||||||||||||||||||||| |||||||||||||||||||| || 
Sbjct: 368 gaggtggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggcgagttca 309

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || |||||||  || | ||| | |||||||| ||| |||  | ||||||||| |||||||
Sbjct: 308 ccggggaggagaagtctgacagcggtctggacctcacggctgctgatggtggacttcttg 249

                                                                       
Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410
           |||||| | || ||   ||  ||||| |||||||    ||||||||  ||||||| ||||
Sbjct: 248 ttgtagtgggcaagacgggaagcctcaccggcgatgcgctcgaagacatcgttgacgaag 189

                               
Query: 411 gagttcatgatggacatggc 430
             ||||||||||||||||||
Sbjct: 188 ctgttcatgatggacatggc 169



to top

>emb|X14731.1|CMHIST2B Duck H2B histone gene
          Length = 1179

 Score =  109 bits (55), Expect = 8e-21
 Identities = 171/207 (82%), Gaps = 2/207 (0%)
 Strand = Plus / Minus

                                                                        
Query: 236  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
            |||| |||||||||| |||||||||||||||||||||||||||||||| ||||| || ||
Sbjct: 1042 ggtgtacttggtgaccgccttggtgccctcggagacggcgtgcttggccagctcgccggg 983

                                                                        
Query: 296  gagga-cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgt 354
             || | |||  || ||||  ||||||||||| || ||||||||||| |    ||||||||
Sbjct: 982  cagcagcga-ccgcacggccgtctggatctcccgcgaggtgatggtcgagcgcttgttgt 924

                                                                        
Query: 355  agcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagt 414
            || |||| ||    |  |||||||||||||    ||||||||||||||||| ||||||||
Sbjct: 923  agtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaaggagt 864

                                       
Query: 415  tcatgatggacatggccttggaggaga 441
            ||||||||  |||||||||||| ||||
Sbjct: 863  tcatgatgcccatggccttggacgaga 837



to top

>gb|BC095697.1| Danio rerio zgc:112234, mRNA (cDNA clone MGC:112234 IMAGE:7223605),
           complete cds
          Length = 1265

 Score =  109 bits (55), Expect = 8e-21
 Identities = 163/199 (81%)
 Strand = Plus / Minus

                                                                       
Query: 243 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacg 302
           ||||||||||||||||| |||||||| |||||||| ||||| ||||| || || || |  
Sbjct: 388 ttggtgacggccttggtaccctcggacacggcgtgtttggccagctctccgggcagcagc 329

                                                                       
Query: 303 aggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcg 362
           || || |||| |||||||||||| | ||||||||||||||    |||||||||| | |||
Sbjct: 328 agccgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtgggcg 269

                                                                       
Query: 363 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 422
           ||    |  ||||| |||||||    ||||||||||||||||| ||| ||||||||||||
Sbjct: 268 agacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 209

                              
Query: 423 gacatggccttggaggaga 441
             |||||||||||||||||
Sbjct: 208 cccatggccttggaggaga 190



to top

>ref|NM_001024398.1| Danio rerio zgc:112234 (zgc:112234), mRNA
          Length = 1265

 Score =  109 bits (55), Expect = 8e-21
 Identities = 163/199 (81%)
 Strand = Plus / Minus

                                                                       
Query: 243 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacg 302
           ||||||||||||||||| |||||||| |||||||| ||||| ||||| || || || |  
Sbjct: 388 ttggtgacggccttggtaccctcggacacggcgtgtttggccagctctccgggcagcagc 329

                                                                       
Query: 303 aggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcg 362
           || || |||| |||||||||||| | ||||||||||||||    |||||||||| | |||
Sbjct: 328 agccgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtgggcg 269

                                                                       
Query: 363 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 422
           ||    |  ||||| |||||||    ||||||||||||||||| ||| ||||||||||||
Sbjct: 268 agacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 209

                              
Query: 423 gacatggccttggaggaga 441
             |||||||||||||||||
Sbjct: 208 cccatggccttggaggaga 190



to top

>gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partial cds
          Length = 397

 Score =  109 bits (55), Expect = 8e-21
 Identities = 55/55 (100%)
 Strand = Plus / Minus

                                                                  
Query: 387 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 327



to top

>gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partial cds
          Length = 402

 Score =  109 bits (55), Expect = 8e-21
 Identities = 55/55 (100%)
 Strand = Plus / Minus

                                                                  
Query: 387 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 386 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 332



to top

>gb|U93853.1|ECU93853 Euplotes crassus histone H2B (H2B(2)) gene, complete cds
          Length = 1522

 Score =  109 bits (55), Expect = 8e-21
 Identities = 160/195 (82%)
 Strand = Plus / Minus

                                                                        
Query: 228  taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287
            |||||||||||| |||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 1170 taagaggaggtgtacttggtgacagccttggttccctcagagacggcatgcttggcgagt 1111

                                                                        
Query: 288  tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347
            || || ||||| | ||| | ||||| |||||||| ||| | ||| | ||  ||| |||||
Sbjct: 1110 tctcctgggagtaagagtctgacggcggtctggacctctctggatgagagagtgtgcttc 1051

                                                                        
Query: 348  ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407
            |||||||| |   | |||||||  || ||    |||| |||||| |||||||||||||||
Sbjct: 1050 ttgttgtatctgacaagcttggaagcttccaaagcgatcttctcaaagatgtcgttgatg 991

                           
Query: 408  aaggagttcatgatg 422
            |||||||||||||||
Sbjct: 990  aaggagttcatgatg 976



to top

>ref|XM_525086.1| PREDICTED: Pan troglodytes similar to Histone H2B F (H2B 291A)
           (LOC469702), mRNA
          Length = 381

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||| |||| |||||| |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacagccttagtgcgctcggacacggcgtgcttggccagctcgccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||| || |||||||| ||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctgcatttcgcgggacgtgatggtggagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   || |||||||| |||||    |||||||||||| |||| |||||||||
Sbjct: 249 gtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>ref|NM_023422.2| Mus musculus histone 1, H2bc (Hist1h2bc), mRNA
          Length = 730

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 404 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 345

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 344 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 285

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 284 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 225

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 224 catgatgcccatggccttggaggaga 199



to top

>gb|AY656810.1| Homo sapiens H2B/t variant gene, complete cds
          Length = 1874

 Score =  107 bits (54), Expect = 3e-20
 Identities = 160/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 743 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 684

                                                                       
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
             ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||| |||
Sbjct: 683 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 625

                                                                       
Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
           | ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||||||||
Sbjct: 624 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 565

                         
Query: 421 tggacatggccttg 434
           ||  ||||||||||
Sbjct: 564 tgcccatggccttg 551



to top

>gb|AY648853.1| Homo sapiens histone H2B/s (HIST2H2BD) gene, complete cds
          Length = 1861

 Score =  107 bits (54), Expect = 3e-20
 Identities = 160/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 743 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 684

                                                                       
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
             ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||| |||
Sbjct: 683 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 625

                                                                       
Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
           | ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||||||||
Sbjct: 624 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 565

                         
Query: 421 tggacatggccttg 434
           ||  ||||||||||
Sbjct: 564 tgcccatggccttg 551



to top

>gb|BC082774.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone IMAGE:6529537)
          Length = 727

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 326

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 266

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 265 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 206

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 205 catgatgcccatggccttggaggaga 180



to top

>gb|BC071638.1| Homo sapiens cDNA clone IMAGE:4390105, containing frame-shift
           errors
          Length = 618

 Score =  107 bits (54), Expect = 3e-20
 Identities = 160/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 414 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 355

                                                                       
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
             ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||| |||
Sbjct: 354 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 296

                                                                       
Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
           | ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||||||||
Sbjct: 295 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 236

                         
Query: 421 tggacatggccttg 434
           ||  ||||||||||
Sbjct: 235 tgcccatggccttg 222



to top

>ref|NM_175055.2| Homo sapiens histone 3, H2bb (HIST3H2BB), mRNA
          Length = 452

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 392 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 333

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||| |  |||||||| ||||||||||    |||||||||
Sbjct: 332 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 273

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | | || ||   || |||||||| |||||    |||||||||||| |||| |||||||||
Sbjct: 272 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 213

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 212 catgatgcccatggccttggacgaga 187



to top

>ref|NM_003519.3| Homo sapiens histone 1, H2bl (HIST1H2BL), mRNA
          Length = 453

 Score =  107 bits (54), Expect = 3e-20
 Identities = 153/186 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 394 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 335

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| |||| |||||||||||| | |||||||||||| |    |||||||||
Sbjct: 334 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 275

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  |||||||  ||||    ||||||||||||||||| |||||||||
Sbjct: 274 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 215

                 
Query: 416 catgat 421
           ||||||
Sbjct: 214 catgat 209



to top

>gb|BC068044.1| Homo sapiens cDNA clone IMAGE:6380649, containing frame-shift
           errors
          Length = 687

 Score =  107 bits (54), Expect = 3e-20
 Identities = 160/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 428 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 369

                                                                       
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
             ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||| |||
Sbjct: 368 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 310

                                                                       
Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
           | ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||||||||
Sbjct: 309 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 250

                         
Query: 421 tggacatggccttg 434
           ||  ||||||||||
Sbjct: 249 tgcccatggccttg 236



to top

>gb|AF531295.1| Homo sapiens histone H2B (HIST1H2BL) gene, complete cds
          Length = 1137

 Score =  107 bits (54), Expect = 3e-20
 Identities = 153/186 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 748 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 689

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| |||| |||||||||||| | |||||||||||| |    |||||||||
Sbjct: 688 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 629

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  |||||||  ||||    ||||||||||||||||| |||||||||
Sbjct: 628 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 569

                 
Query: 416 catgat 421
           ||||||
Sbjct: 568 catgat 563



to top

>gb|BC100857.1| Homo sapiens cDNA clone IMAGE:40002416, partial cds
          Length = 435

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 391 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 332

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||| |  |||||||| ||||||||||    |||||||||
Sbjct: 331 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 272

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | | || ||   || |||||||| |||||    |||||||||||| |||| |||||||||
Sbjct: 271 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 212

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 211 catgatgcccatggccttggacgaga 186



to top

>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Plus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 99867  ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 99926

                                                                          
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
               || |  ||||| ||||  ||||| |  |||||||| ||||||||||    |||||||||
Sbjct: 99927  cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 99986

                                                                          
Query: 356    gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
              | | || ||   || |||||||| |||||    |||||||||||| |||| |||||||||
Sbjct: 99987  gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 100046

                                        
Query: 416    catgatggacatggccttggaggaga 441
              |||||||  |||||||||||| ||||
Sbjct: 100047 catgatgcccatggccttggacgaga 100072



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 168/207 (81%), Gaps = 1/207 (0%)
 Strand = Plus / Minus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||||||||| ||||| ||||||||||| |||||||||||||| ||||| || ||
Sbjct: 94140 ggtgtacttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 94081

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg-ttgt 354
              || |  ||||| ||||  ||||| |  |||||||| ||||||||||    |||| ||||
Sbjct: 94080 cagcagcaggcgcacggccgtctgcacttcgcgggacgtgatggtggagcgcttgtttgt 94021

                                                                         
Query: 355   agcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagt 414
             || |||| ||   || |||||||| |||||    |||||||||||| |||| ||||||||
Sbjct: 94020 agtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagt 93961

                                        
Query: 415   tcatgatggacatggccttggaggaga 441
             ||||||||  |||||||||||| ||||
Sbjct: 93960 tcatgatgcccatggccttggacgaga 93934



to top

>emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 on chromosome 6p21.3-22.2
              Contains a novel pseudogene, a 60S Ribosomal protein L30
              (RPL30) pseudogene, H4 histone family member F pseudogene
              H4FFP and histone genes H2BFC, H2AFC, H3FK. Contains ESTs,
              STSs, GSSs and two CpG islands, complete sequence
          Length = 139904

 Score =  107 bits (54), Expect = 3e-20
 Identities = 153/186 (82%)
 Strand = Plus / Plus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 135689 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 135748

                                                                          
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
               || |  ||||| |||| |||||||||||| | |||||||||||| |    |||||||||
Sbjct: 135749 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 135808

                                                                          
Query: 356    gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
              | |||| ||   ||  |||||||  ||||    ||||||||||||||||| |||||||||
Sbjct: 135809 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 135868

                    
Query: 416    catgat 421
              ||||||
Sbjct: 135869 catgat 135874



to top

>emb|Z83740.1|HSZ83740 H.sapiens hH2B/c gene
          Length = 740

 Score =  107 bits (54), Expect = 3e-20
 Identities = 153/186 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 584 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 525

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| |||| |||||||||||| | |||||||||||| |    |||||||||
Sbjct: 524 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 465

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  |||||||  ||||    ||||||||||||||||| |||||||||
Sbjct: 464 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 405

                 
Query: 416 catgat 421
           ||||||
Sbjct: 404 catgat 399



to top

>emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone gene L1 H2b
          Length = 1497

 Score =  107 bits (54), Expect = 3e-20
 Identities = 108/126 (85%)
 Strand = Plus / Minus

                                                                        
Query: 231  gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
            |||| |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 1357 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctct 1298

                                                                        
Query: 291  ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
            || ||||||| ||| | ||||  |||||||| ||| ||   ||||||||||| |||||||
Sbjct: 1297 ccggggaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttcttg 1238

                  
Query: 351  ttgtag 356
            ||||||
Sbjct: 1237 ttgtag 1232



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
              novel gene, the genes for three H1, four H2a, five H2b,
              four H3 and four H4 histone family members, the 3' end of a
              variant of the Hfe gene for hemochromatosis protein (Mr2)
              and ten CpG islands, complete sequence
          Length = 184730

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 165015 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 164956

                                                                          
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
               || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 164955 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 164896

                                                                          
Query: 356    gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
                |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 164895 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 164836

                                        
Query: 416    catgatggacatggccttggaggaga 441
              |||||||  |||||||||||||||||
Sbjct: 164835 catgatgcccatggccttggaggaga 164810



 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Plus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 66003 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 66062

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 66063 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 66122

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
               |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 66123 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 66182

                                       
Query: 416   catgatggacatggccttggaggaga 441
             |||||||  |||||||||||||||||
Sbjct: 66183 catgatgcccatggccttggaggaga 66208



 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||| ||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 52407 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 52348

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 52347 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 52288

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
               |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 52287 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 52228

                                       
Query: 416   catgatggacatggccttggaggaga 441
             |||||||  |||||||||||||||||
Sbjct: 52227 catgatgcccatggccttggaggaga 52202



 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Plus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 23586 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 23645

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 23646 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 23705

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
               |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 23706 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 23765

                                       
Query: 416   catgatggacatggccttggaggaga 441
             |||||||  |||||| ||||||||||
Sbjct: 23766 catgatgcccatggctttggaggaga 23791



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 54428 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 54487

                                                          
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340
              || |  ||||| ||||  ||||||||||| ||||| ||||||||
Sbjct: 54488 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 54532



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 389   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
             ||||||||||||||| |  || ||||||||||||  |||||||||||||||||
Sbjct: 54581 ctcgaagatgtcgttcacaaacgagttcatgatgcccatggccttggaggaga 54633



to top

>dbj|AK091220.1| Homo sapiens cDNA FLJ33901 fis, clone CTONG2008321, highly similar
           to HISTONE H2B F
          Length = 2359

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 392 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 333

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||| |  |||||||| ||||||||||    |||||||||
Sbjct: 332 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 273

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | | || ||   || |||||||| |||||    |||||||||||| |||| |||||||||
Sbjct: 272 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 213

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 212 catgatgcccatggccttggacgaga 187



to top

>ref|XM_936779.1| PREDICTED: Homo sapiens similar to H2B histone family, member F
           (LOC647719), mRNA
          Length = 703

 Score =  107 bits (54), Expect = 3e-20
 Identities = 160/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 484 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 425

                                                                       
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
             ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||| |||
Sbjct: 424 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 366

                                                                       
Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
           | ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||||||||
Sbjct: 365 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 306

                         
Query: 421 tggacatggccttg 434
           ||  ||||||||||
Sbjct: 305 tgcccatggccttg 292



to top

>dbj|AB168579.1| Macaca fascicularis testis cDNA clone: QtsA-13175, similar to human
           histone 1, H2bd (HIST1H2BD), transcript variant 2,mRNA,
           RefSeq: NM_138720.1
          Length = 760

 Score =  107 bits (54), Expect = 3e-20
 Identities = 153/186 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 415 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 356

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | ||| |||||||| |    |||||||||
Sbjct: 355 aagcagcaggcgcacggccgtctggatctccctggaagtgatggtcgagcgcttgttgta 296

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  |||||||||||||    ||||||||||||||||| |||||| ||
Sbjct: 295 gtgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacgaaggaatt 236

                 
Query: 416 catgat 421
           ||||||
Sbjct: 235 catgat 230



to top

>dbj|AK005191.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
           library, clone:1500010J12 product:histone 1, H2bc, full
           insert sequence
          Length = 724

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 398 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 339

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 338 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 279

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 278 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 219

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 218 catgatgcccatggccttggaggaga 193



to top

>dbj|AK005407.1| Mus musculus adult female placenta cDNA, RIKEN full-length enriched
           library, clone:1600009N02 product:H2B histone family,
           member S, full insert sequence
          Length = 723

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 397 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 338

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 337 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 278

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 277 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 218

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 217 catgatgcccatggccttggaggaga 192



to top

>ref|NG_002619.1| Homo sapiens histone 2, H2bc (HIST2H2BC) pseudogene on chromosome 1
          Length = 1134

 Score =  107 bits (54), Expect = 3e-20
 Identities = 160/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 742 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 683

                                                                       
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
             ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||| |||
Sbjct: 682 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 624

                                                                       
Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
           | ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||||||||
Sbjct: 623 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 564

                         
Query: 421 tggacatggccttg 434
           ||  ||||||||||
Sbjct: 563 tgcccatggccttg 550



to top

>ref|NG_002620.1| Homo sapiens histone 2, H2bd (HIST2H2BD) pseudogene on chromosome 1
          Length = 1134

 Score =  107 bits (54), Expect = 3e-20
 Identities = 160/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 741 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 682

                                                                       
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
             ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||| |||
Sbjct: 681 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 623

                                                                       
Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
           | ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||||||||
Sbjct: 622 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 563

                         
Query: 421 tggacatggccttg 434
           ||  ||||||||||
Sbjct: 562 tgcccatggccttg 549



to top

>dbj|AK011516.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610022J01 product:H2B histone
           family, member S, full insert sequence
          Length = 730

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 404 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 345

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 344 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 285

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 284 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 225

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 224 catgatgcccatggccttggaggaga 199



to top

>gb|BC093761.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MGC:120796
           IMAGE:7939606), complete cds
          Length = 554

 Score =  107 bits (54), Expect = 3e-20
 Identities = 153/186 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 450 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 391

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| |||| |||||||||||| | |||||||||||| |    |||||||||
Sbjct: 390 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 331

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  |||||||  ||||    ||||||||||||||||| |||||||||
Sbjct: 330 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 271

                 
Query: 416 catgat 421
           ||||||
Sbjct: 270 catgat 265



to top

>gb|BC093759.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MGC:120794
           IMAGE:7939604), complete cds
          Length = 555

 Score =  107 bits (54), Expect = 3e-20
 Identities = 153/186 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 451 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 392

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| |||| |||||||||||| | |||||||||||| |    |||||||||
Sbjct: 391 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 332

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||   ||  |||||||  ||||    ||||||||||||||||| |||||||||
Sbjct: 331 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 272

                 
Query: 416 catgat 421
           ||||||
Sbjct: 271 catgat 266



to top

>gb|AY131977.1| Homo sapiens histone H2B (HIST2H2BC) pseudogene, complete sequence
          Length = 1134

 Score =  107 bits (54), Expect = 3e-20
 Identities = 160/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 742 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 683

                                                                       
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
             ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||| |||
Sbjct: 682 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 624

                                                                       
Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
           | ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||||||||
Sbjct: 623 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 564

                         
Query: 421 tggacatggccttg 434
           ||  ||||||||||
Sbjct: 563 tgcccatggccttg 550



to top

>gb|AY131978.1| Homo sapiens histone H2B (HIST2H2BD) pseudogene, complete sequence
          Length = 1134

 Score =  107 bits (54), Expect = 3e-20
 Identities = 160/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 741 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 682

                                                                       
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
             ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||| |||
Sbjct: 681 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 623

                                                                       
Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
           | ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||||||||
Sbjct: 622 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 563

                         
Query: 421 tggacatggccttg 434
           ||  ||||||||||
Sbjct: 562 tgcccatggccttg 549



to top

>gb|AY131981.1| Homo sapiens histone H2B (HIST3H2BB) gene, complete cds
          Length = 1137

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 748 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||| |  |||||||| ||||||||||    |||||||||
Sbjct: 688 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 629

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | | || ||   || |||||||| |||||    |||||||||||| |||| |||||||||
Sbjct: 628 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 569

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 568 catgatgcccatggccttggacgaga 543



to top

>gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, complete cds
          Length = 1401

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 952 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 893

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 892 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 833

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 832 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 773

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 772 catgatgcccatggccttggaggaga 747



to top

>gb|AY158907.1| Mus musculus histone protein Hist1h1e gene, complete cds
          Length = 1381

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 515 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 574

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 575 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 634

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 635 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 694

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 695 catgatgcccatggccttggaggaga 720



to top

>ref|NM_214552.1| Strongylocentrotus purpuratus late histone L1 H2b (LOC373347), mRNA
          Length = 372

 Score =  107 bits (54), Expect = 3e-20
 Identities = 108/126 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           |||| |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 365 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctct 306

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || ||||||| ||| | ||||  |||||||| ||| ||   ||||||||||| |||||||
Sbjct: 305 ccggggaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttcttg 246

                 
Query: 351 ttgtag 356
           ||||||
Sbjct: 245 ttgtag 240



to top

>ref|XM_786200.1| PREDICTED: Strongylocentrotus purpuratus similar to H2B histone
           family, member F (LOC586416), mRNA
          Length = 471

 Score =  105 bits (53), Expect = 1e-19
 Identities = 107/125 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           |||| |||| |||||||||| |||||||||||||| |||||||||||||||||||| || 
Sbjct: 368 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttct 309

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || ||||||| ||| | ||| | |||||||| ||| |||  | ||||||||| |||||||
Sbjct: 308 ccggggaggaggagtctgacagcggtctggacctcacggctgctgatggtggacttcttg 249

                
Query: 351 ttgta 355
           |||||
Sbjct: 248 ttgta 244



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggc 430
           ||||||||  ||||||| ||||  ||||||||||||||||||
Sbjct: 210 ctcgaagacatcgttgacgaagctgttcatgatggacatggc 169



to top

>ref|XM_786178.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           291B (LOC586394), mRNA
          Length = 375

 Score =  105 bits (53), Expect = 1e-19
 Identities = 107/125 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           |||| |||| |||||||||| |||||||||||||| |||||||||||||||||||| || 
Sbjct: 368 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttct 309

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || ||||||| ||| | ||| | |||||||| ||| |||  | ||||||||| |||||||
Sbjct: 308 ccggggaggaggagtctgacagcggtctggacctcacggctgctgatggtggacttcttg 249

                
Query: 351 ttgta 355
           |||||
Sbjct: 248 ttgta 244



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggc 430
           ||||||||  ||||||| ||||  ||||||||||||||||||
Sbjct: 210 ctcgaagacatcgttgacgaagctgttcatgatggacatggc 169



to top

>ref|XM_781061.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC581037), mRNA
          Length = 468

 Score =  105 bits (53), Expect = 1e-19
 Identities = 107/125 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           |||| |||| |||||||||| |||||||||||||| |||||||| |||||||| | ||| 
Sbjct: 461 gaggtggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccaactct 402

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || ||||||| ||| ||||| | |||||||||||| |||  | ||||||||| |||||||
Sbjct: 401 ccggggaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttg 342

                
Query: 351 ttgta 355
           |||||
Sbjct: 341 ttgta 337



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 399 tcgttgatgaaggagttcatgatggacatggccttg 434
           ||||||| ||||  ||||||||||||||||||||||
Sbjct: 293 tcgttgacgaagctgttcatgatggacatggccttg 258



to top

>emb|X06643.1|SPH2BL4 Strongylocentrotus purpuratus late histone gene fragment L4 H2b
          Length = 627

 Score =  105 bits (53), Expect = 1e-19
 Identities = 107/125 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290
           |||| |||| |||||||||| |||||||||||||| |||||||||||||||||||| || 
Sbjct: 319 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttct 260

                                                                       
Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350
           || ||||||| ||| | ||| | |||||||| ||| |||  | ||||||||| |||||||
Sbjct: 259 ccggggaggaggagcctgacagcggtctggacctcacggctgctgatggtggacttcttg 200

                
Query: 351 ttgta 355
           |||||
Sbjct: 199 ttgta 195



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggc 430
           ||||||||  ||||||| ||||  ||||||||||||||||||
Sbjct: 161 ctcgaagacatcgttgacgaagctgttcatgatggacatggc 120



to top

>ref|XM_954347.1| Neurospora crassa OR74A hypothetical protein (NCU02435.1) partial
           mRNA
          Length = 414

 Score =  103 bits (52), Expect = 5e-19
 Identities = 100/116 (86%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           ||||||| |||||||| ||||| || || || ||||||||||| ||||| || |||||||
Sbjct: 394 acttggtaacggccttagtgccttccgatacagcgtgcttggcaagctcgccggggagga 335

                                                                   
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356
            |||||| || |||||||||||||| || |||| |||||||| |||||||||||||
Sbjct: 334 tgaggcgaacagaggtctggatctcacgagaggagatggtggacttcttgttgtag 279



to top

>ref|XM_331210.1| Neurospora crassa OR74A hypothetical protein (NCU02435.1) partial
           mRNA
          Length = 414

 Score =  103 bits (52), Expect = 5e-19
 Identities = 100/116 (86%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           ||||||| |||||||| ||||| || || || ||||||||||| ||||| || |||||||
Sbjct: 394 acttggtaacggccttagtgccttccgatacagcgtgcttggcaagctcgccggggagga 335

                                                                   
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356
            |||||| || |||||||||||||| || |||| |||||||| |||||||||||||
Sbjct: 334 tgaggcgaacagaggtctggatctcacgagaggagatggtggacttcttgttgtag 279



to top

>emb|X03017.1|XLHISH1 Xenopus laevis histone gene cluster Xlh1 with genes H3, H4, H2B, H2A
            and H1B
          Length = 14942

 Score =  103 bits (52), Expect = 5e-19
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                        
Query: 243  ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacg 302
            |||||||| ||||||||||||||||| |||||||| ||||| || |||||||| || |  
Sbjct: 3481 ttggtgacagccttggtgccctcggacacggcgtgtttggccagttccccaggcagcagc 3422

                                                    
Query: 303  aggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            |||||||| | |||||||||||| ||||||||||||||||
Sbjct: 3421 aggcggaccgcggtctggatctcccgggaggtgatggtgg 3382



to top

>ref|XM_686839.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC573293),
           mRNA
          Length = 501

 Score =  103 bits (52), Expect = 5e-19
 Identities = 160/196 (81%)
 Strand = Plus / Minus

                                                                       
Query: 246 gtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacgagg 305
           |||||||||||||| |||||||| |||||||| ||||| ||||| || || || |  || 
Sbjct: 353 gtgacggccttggtaccctcggacacggcgtgtttggccagctctccgggcagcagcagc 294

                                                                       
Query: 306 cggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcgagc 365
           || |||| |||||||||||| | ||||||||||||||    |||||||||| | ||||| 
Sbjct: 293 cgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtgggcgaga 234

                                                                       
Query: 366 ttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggac 425
              |  ||||| |||||||    ||||||||||||||||| ||| ||||||||||||  |
Sbjct: 233 cgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgccc 174

                           
Query: 426 atggccttggaggaga 441
           ||||||||||||||||
Sbjct: 173 atggccttggaggaga 158



to top

>ref|XM_693375.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC573776),
           mRNA
          Length = 405

 Score =  103 bits (52), Expect = 5e-19
 Identities = 160/196 (81%)
 Strand = Plus / Minus

                                                                       
Query: 246 gtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacgagg 305
           ||||||||||| ||||||||||| |||||||| ||||| ||||| || || || |  || 
Sbjct: 353 gtgacggccttagtgccctcggacacggcgtgtttggccagctctccgggcagcagcagc 294

                                                                       
Query: 306 cggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcgagc 365
           || |||| |||||||||||| | ||||||||||||||    |||||||||| | ||||| 
Sbjct: 293 cgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtgggcgaga 234

                                                                       
Query: 366 ttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggac 425
              |  ||||| |||||||    ||||||||||||||||| ||| ||||||||||||  |
Sbjct: 233 cgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgccc 174

                           
Query: 426 atggccttggaggaga 441
           ||||||||||||||||
Sbjct: 173 atggccttggaggaga 158



to top

>gb|M21286.1|XELHX1H1 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster Xlhl
          Length = 14949

 Score =  103 bits (52), Expect = 5e-19
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                        
Query: 243  ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacg 302
            |||||||| ||||||||||||||||| |||||||| ||||| || |||||||| || |  
Sbjct: 3488 ttggtgacagccttggtgccctcggacacggcgtgtttggccagttccccaggcagcagc 3429

                                                    
Query: 303  aggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            |||||||| | |||||||||||| ||||||||||||||||
Sbjct: 3428 aggcggaccgcggtctggatctcccgggaggtgatggtgg 3389



to top

>ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken
           (LOC429558), mRNA
          Length = 381

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 310

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            || |  ||||| ||||  ||||||||||| || |||||||||||||
Sbjct: 309 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 263



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 393 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           ||||||||||||| ||||||||||||||||  |||||||||||||||||
Sbjct: 212 aagatgtcgttgacgaaggagttcatgatgcccatggccttggaggaga 164



to top

>ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken
           (LOC429457), partial mRNA
          Length = 628

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| || ||
Sbjct: 616 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 557

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            || |  ||||| ||||  ||||||||||| || |||||||||||||
Sbjct: 556 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 510



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 393 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           ||||||||||||| ||||||||||||||||  |||||||||||||||||
Sbjct: 459 aagatgtcgttgacgaaggagttcatgatgcccatggccttggaggaga 411



to top

>emb|CR669650.2|CNS0FFO8 Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||| |||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 410 ggtgtacttggtcacggccttggtgccctcggacacggcgtgcttggccagctcccccgg 351

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            || |  || |  |||| |||||||||||| ||||||||||||||||
Sbjct: 350 cagcagcagcctcacggcggtctggatctcccgggaggtgatggtgg 304



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 396 atgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           |||||||||| ||||||||||||||||  |||||||||||||||||
Sbjct: 250 atgtcgttgacgaaggagttcatgatgctcatggccttggaggaga 205



to top

>ref|XM_504425.1| Yarrowia lipolytica CLIB122, YALI0E26455g predicted mRNA
          Length = 420

 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Minus

                                                                       
Query: 272 ggcgtgcttggcgagctccccagggaggacgaggcggacggaggtctggatctcgcggga 331
           |||||||||||||||||| || ||||| | ||| ||||| | |||||||||||| || ||
Sbjct: 369 ggcgtgcttggcgagctcaccggggagaatgagtcggacagcggtctggatctctcgaga 310

                                                                       
Query: 332 ggtgatggtgggcttcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctc 391
            |||||||||| ||||||| |||||   || ||||||| |||||||  |||||    |||
Sbjct: 309 agtgatggtggacttcttggtgtaggtggccagcttggaggcctcggtggcgactcgctc 250

                                                  
Query: 392 gaagatgtcgttgatgaaggagttcatgatggacatggc 430
            |||||||||||||  |||||||||||||| ||||||||
Sbjct: 249 aaagatgtcgttgacaaaggagttcatgatagacatggc 211



to top

>emb|BX072512.1|CNS09S44 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 621

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 466 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 407

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 406 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 360



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 313 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 263



to top

>emb|BX072414.1|CNS09S1E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 718

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 267 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 327 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 373



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 420 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 470



to top

>emb|BX051496.1|CNS09BWC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 247 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 306

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 307 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 353



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 400 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 450



to top

>emb|BX051495.1|CNS09BWB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 463 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 404

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 403 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 357



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 310 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 260



to top

>emb|BX047440.1|CNS098RO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 444 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 385

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 384 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 338



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 291 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 241



to top

>emb|BX038423.1|CNS091T7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 478 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 419

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 418 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 372



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 325 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 275



to top

>emb|BX032827.1|CNS08XHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 670

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 461 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 402

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 401 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 355



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 308 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 258



to top

>emb|BX031663.1|CNS08WLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 770

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 236 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 295

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 296 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 342



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 389 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 439



to top

>emb|BX021771.1|CNS08OYN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 544

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 245 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 304

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 305 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 351



to top

>emb|BX013307.1|CNS08IFJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 452 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 393

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 392 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 346



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 299 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 249



to top

>emb|BX012776.1|CNS08I0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 470 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 411

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 410 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 364



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 317 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 267



to top

>emb|BX012380.1|CNS08HPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 248 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 307

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 308 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 354



to top

>emb|BX009211.1|CNS08F9R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 750

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 452 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 393

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 392 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 346



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 299 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 249



to top

>emb|X98185.1|AGH2B A.gambiae mRNA for histone H2B
          Length = 698

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 423 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 364

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 363 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 317



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 273 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 223



to top

>emb|AJ556871.1|XLA556871 Expression vector pET3-H2B H2B gene for Xenopus laevis-like histone
           H2B
          Length = 482

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||| ||||| | |||||||||
Sbjct: 400 ggtgtacttggtgacagccttggtgccctcggacacggcgtgtttggccaactccccagg 341

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            || |  || ||||| | |||||||||||| ||||||||||||||||
Sbjct: 340 cagcagcagtcggaccgcggtctggatctcccgggaggtgatggtgg 294



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 399 tcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||  |||||||||||| ||||
Sbjct: 237 tcgttgacaaaggagttcatgatgctcatggccttggacgaga 195



to top

>emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from clone DKFZp469C0528)
          Length = 2237

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 352

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            || |  ||||| ||||  ||||||||||||||||| ||||||||||
Sbjct: 351 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 305



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||
Sbjct: 258 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgaga 206



to top

>gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partial cds
          Length = 375

 Score =  101 bits (51), Expect = 2e-18
 Identities = 54/55 (98%)
 Strand = Plus / Minus

                                                                  
Query: 387 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           ||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 359 ttctcgaagatgtcgttgatgaaggagctcatgatggacatggccttggaggaga 305



to top

>ref|XM_558160.1| Anopheles gambiae str. PEST ENSANGP00000027582
           (ENSANGG00000022768), partial mRNA
          Length = 513

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 46  ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 105

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 106 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 152



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 199 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 249



to top

>ref|XM_320334.2| Anopheles gambiae str. PEST ENSANGP00000014097
           (ENSANGG00000011608), mRNA
          Length = 671

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 420 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 361

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 360 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 314



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 267 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 217



to top

>ref|XM_320329.2| Anopheles gambiae str. PEST ENSANGP00000014080
           (ENSANGG00000011591), mRNA
          Length = 695

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 464 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 405

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 404 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 358



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 311 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 261



to top

>ref|XM_314450.2| Anopheles gambiae str. PEST ENSANGP00000000674
           (ENSANGG00000000607), partial mRNA
          Length = 363

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 351 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 292

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 291 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 245



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 198 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 148



to top

>ref|XM_314448.2| Anopheles gambiae str. PEST ENSANGP00000016043
           (ENSANGG00000013554), mRNA
          Length = 704

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 470 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 411

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 410 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 364



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 317 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 267



to top

>ref|XM_306853.2| Anopheles gambiae str. PEST ENSANGP00000000106
           (ENSANGG00000000104), partial mRNA
          Length = 321

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 309 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 250

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 249 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 203



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 156 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 106



to top

>ref|XM_306255.2| Anopheles gambiae str. PEST ENSANGP00000000003
           (ENSANGG00000000003), partial mRNA
          Length = 375

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 363 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 304

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
           ||| |  || || || |  ||||||||||||||||| ||||||||||
Sbjct: 303 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 257



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 210 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 160



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Plus

                                                                           
Query: 272     ggcgtgcttggcgagctccccagggaggacgaggcggacggaggtctggatctcgcggga 331
               |||||||||||||||||| || ||||| | ||| ||||| | |||||||||||| || ||
Sbjct: 3141902 ggcgtgcttggcgagctcaccggggagaatgagtcggacagcggtctggatctctcgaga 3141961

                                                                           
Query: 332     ggtgatggtgggcttcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctc 391
                |||||||||| ||||||| |||||   || ||||||| |||||||  |||||    |||
Sbjct: 3141962 agtgatggtggacttcttggtgtaggtggccagcttggaggcctcggtggcgactcgctc 3142021

                                                      
Query: 392     gaagatgtcgttgatgaaggagttcatgatggacatggc 430
                |||||||||||||  |||||||||||||| ||||||||
Sbjct: 3142022 aaagatgtcgttgacaaaggagttcatgatagacatggc 3142060



to top

>gb|J00981.1|XELHIS2BL xenopus laevis h2b histone gene & flanks
          Length = 593

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| ||||||||||||||||| |||||||| ||||| | |||||||||
Sbjct: 504 ggtgtacttggtgacagccttggtgccctcggacacggcgtgtttggccaactccccagg 445

                                                          
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
            || |  || ||||| | |||||||||||| ||||||||||||||||
Sbjct: 444 cagcagcagtcggaccgcggtctggatctcccgggaggtgatggtgg 398



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 399 tcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||  |||||||||||| ||||
Sbjct: 341 tcgttgacaaaggagttcatgatgctcatggccttggacgaga 299



to top

>ref|XM_518302.1| PREDICTED: Pan troglodytes similar to H2B histone family, member F
           (LOC462509), mRNA
          Length = 843

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 161/198 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||| |||||||| |||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 190

                             
Query: 416 catgatggacatggcctt 433
           |||||||  |||||||||
Sbjct: 189 catgatgcccatggcctt 172



to top

>ref|XM_518287.1| PREDICTED: Pan troglodytes similar to Histone H2B 291B (LOC462491),
           mRNA
          Length = 643

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 419 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 360

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 359 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 300

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||||| |||||| ||
Sbjct: 299 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 240

                 
Query: 416 catgat 421
           ||||||
Sbjct: 239 catgat 234



to top

>gb|BC106720.1| Homo sapiens histone 1, H2bo, mRNA (cDNA clone MGC:119806
           IMAGE:40014271), complete cds
          Length = 441

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 161/198 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| ||
Sbjct: 390 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 331

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 330 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 271

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||| |||||||| |||| |||||||||
Sbjct: 270 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 211

                             
Query: 416 catgatggacatggcctt 433
           |||||||  |||||||||
Sbjct: 210 catgatgcccatggcctt 193



to top

>ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261), mRNA
          Length = 789

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 150/182 (82%), Gaps = 1/182 (0%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 186 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 127

                                                                       
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360
             ||||| ||||  ||||||||||| ||||| ||||||||||    |||||||||| |||
Sbjct: 126 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 68

                                                                       
Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420
           | ||   ||  ||||| || ||||    ||||||||||||||||| ||||||||||||||
Sbjct: 67  ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 8

             
Query: 421 tg 422
           ||
Sbjct: 7   tg 6



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 89/103 (86%), Gaps = 2/103 (1%)
 Strand = Plus / Plus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || |
Sbjct: 293 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 352

                                                      
Query: 301 cgaggcggacggaggtctggatctcgcgggag-gtgatggtgg 342
             ||||| ||||  ||||||||||| |||||| ||||||||||
Sbjct: 353 gcaggcgcacggccgtctggatctc-cgggagcgtgatggtgg 394



to top

>ref|NM_178194.2| Mus musculus histone 1, H2be (Hist1h2be), mRNA
          Length = 2436

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 590 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 531

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 530 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 471

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 470 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 411

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 410 catgatgcccatggccttggaggaga 385



to top

>ref|NM_003527.4| Homo sapiens histone 1, H2bo (HIST1H2BO), mRNA
          Length = 467

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 161/198 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| ||
Sbjct: 407 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 348

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 347 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 288

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||| |||||||| |||| |||||||||
Sbjct: 287 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 228

                             
Query: 416 catgatggacatggcctt 433
           |||||||  |||||||||
Sbjct: 227 catgatgcccatggcctt 210



to top

>ref|XM_425468.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC427894), mRNA
          Length = 381

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  || || ||||  ||||||||||| || || |||||||| |    |||||||||
Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||    |  |||||||||||||    ||||||||||||||||| ||| |||||
Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>ref|XM_425462.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC427888), mRNA
          Length = 381

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  || || ||||  ||||||||||| || || |||||||| |    |||||||||
Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||    |  |||||||||||||    ||||||||||||||||| ||| |||||
Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>ref|XM_425457.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC427883), mRNA
          Length = 381

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  || || ||||  ||||||||||| || || |||||||| |    |||||||||
Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||    |  |||||||||||||    ||||||||||||||||| ||| |||||
Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 189 catgatgcccatggccttggacgaga 164



to top

>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955),
           mRNA
          Length = 1220

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| || ||
Sbjct: 267 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 326

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  || || ||||  ||||||||||| || || |||||||| |    |||||||||
Sbjct: 327 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 386

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||    |  |||||||||||||    ||||||||||||||||| ||| |||||
Sbjct: 387 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 446

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 447 catgatgcccatggccttggacgaga 472



to top

>gb|BC060304.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone MGC:70229
           IMAGE:4217587), complete cds
          Length = 661

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||| ||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 429 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 370

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 369 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 310

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 309 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 250

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 249 catgatgcccatggccttggaggaga 224



to top

>ref|NM_021063.2| Homo sapiens histone 1, H2bd (HIST1H2BD), transcript variant 1,
           mRNA
          Length = 523

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 418 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 359

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 358 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 299

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||||| |||||| ||
Sbjct: 298 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 239

                 
Query: 416 catgat 421
           ||||||
Sbjct: 238 catgat 233



to top

>ref|NM_138720.1| Homo sapiens histone 1, H2bd (HIST1H2BD), transcript variant 2,
           mRNA
          Length = 829

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 418 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 359

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 358 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 299

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||||| |||||| ||
Sbjct: 298 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 239

                 
Query: 416 catgat 421
           ||||||
Sbjct: 238 catgat 233



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 92394 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 92335

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 92334 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 92275

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
               |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 92274 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 92215

                                       
Query: 416   catgatggacatggccttggaggaga 441
             |||||||  |||||| ||||||||||
Sbjct: 92214 catgatgcccatggctttggaggaga 92189



 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Plus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||| ||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 63577 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 63636

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 63637 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 63696

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
               |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 63697 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 63756

                                       
Query: 416   catgatggacatggccttggaggaga 441
             |||||||  |||||||||||||||||
Sbjct: 63757 catgatgcccatggccttggaggaga 63782



 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 49790 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 49731

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 49730 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 49671

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
               |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 49670 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 49611

                                       
Query: 416   catgatggacatggccttggaggaga 441
             |||||||  |||||||||||||||||
Sbjct: 49610 catgatgcccatggccttggaggaga 49585



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 61556 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 61497

                                                          
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340
              || |  ||||| ||||  ||||||||||| ||||| ||||||||
Sbjct: 61496 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 61452



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                  
Query: 389   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
             ||||||||||||||| |  || ||||||||||||  |||||||||||||||||
Sbjct: 61403 ctcgaagatgtcgttcacaaacgagttcatgatgcccatggccttggaggaga 61351



to top

>ref|XM_539321.2| PREDICTED: Canis familiaris similar to histone 3, H2ba (LOC482202),
           mRNA
          Length = 459

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| || ||||||||||| ||||| || ||
Sbjct: 384 ggtgtacttggtgacggccttggtgccctcggacaccgcgtgcttggccagctcgccggg 325

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||| | ||||||||| |||||||| |    |||||||||
Sbjct: 324 cagcagcaggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 265

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   || |||||||| |||||    ||| ||||||||||||| ||| |||||
Sbjct: 264 atgcgccaggcgggaggcctcgctggcgatgcgctcaaagatgtcgttgacgaacgagtt 205

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 204 catgatgcccatggccttggacgaga 179



to top

>gb|AF531298.1| Homo sapiens histone H2B (HIST1H2BO) gene, complete cds
          Length = 1137

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 161/198 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| ||
Sbjct: 749 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 690

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 689 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 630

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||| |||||||| |||| |||||||||
Sbjct: 629 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 570

                             
Query: 416 catgatggacatggcctt 433
           |||||||  |||||||||
Sbjct: 569 catgatgcccatggcctt 552



to top

>gb|AF531287.1| Homo sapiens histone H2B (HIST1H2BD) gene, complete cds
          Length = 1137

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 749 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 690

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 689 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 630

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||||| |||||| ||
Sbjct: 629 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 570

                 
Query: 416 catgat 421
           ||||||
Sbjct: 569 catgat 564



to top

>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the
             3' part of the HFE gene for haemochromatosis protein, two
             genes for novel histone 4 family members, two genes for
             novel histone 1 family members, three genes for novel
             histone 2B family members, a gene for a novel histone 2A
             family member, a novel pseudogene, STSs, GSSs, ESTs and
             CpG islands, complete sequence
          Length = 101099

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 64919 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 64860

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 64859 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 64800

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
               |||| ||   ||  |||||||| ||||    ||||||||||||||||| |||||| ||
Sbjct: 64799 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 64740

                   
Query: 416   catgat 421
             ||||||
Sbjct: 64739 catgat 64734



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 29859 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 29918

                                                          
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340
              || |  ||||| ||||  ||||||||||| | ||||||||||||
Sbjct: 29919 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 29963



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 150/186 (80%)
 Strand = Plus / Minus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| ||||||| ||||||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 90545 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 90486

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 90485 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 90426

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
               |||| ||   ||  |||||||||||||    |||||||||||||||||  ||||| ||
Sbjct: 90425 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 90366

                   
Query: 416   catgat 421
             ||||||
Sbjct: 90365 catgat 90360



to top

>emb|BX008531.1|CNS08EQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300
           |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||||| |
Sbjct: 445 acttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggggagca 386

                                                     
Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342
             || || || |  ||||||||||||||||| ||||||||||
Sbjct: 385 acagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 344



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439
           ||||||||||||||| | ||||  ||||||||||  ||| |||||||||||
Sbjct: 297 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 247



to top

>emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2A and H2B
          Length = 1661

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 161/198 (81%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| ||
Sbjct: 410 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 469

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 470 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 529

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||| |||||||| |||| |||||||||
Sbjct: 530 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 589

                             
Query: 416 catgatggacatggcctt 433
           |||||||  |||||||||
Sbjct: 590 catgatgcccatggcctt 607



to top

>emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B sequence
          Length = 1113

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| || ||
Sbjct: 990 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 931

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  || || ||||  ||||||||||| || || |||||||| |    |||||||||
Sbjct: 930 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 871

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||    |  |||||||||||||    ||||||||||||||||| ||| |||||
Sbjct: 870 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 811

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 810 catgatgcccatggccttggacgaga 785



to top

>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)
          Length = 1826

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 301 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 360

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 361 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 420

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 421 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttcacgaacgagtt 480

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 481 catgatgcccatggccttggaggaga 506



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 143456 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 143397

                                                                          
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
               || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 143396 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 143337

                                                                          
Query: 356    gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
                |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 143336 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttcacgaacgagtt 143277

                                        
Query: 416    catgatggacatggccttggaggaga 441
              |||||||  |||||||||||||||||
Sbjct: 143276 catgatgcccatggccttggaggaga 143251



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 175481 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 175422

                                                           
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340
               || |  ||||| ||||  ||||||||||| ||||| ||||||||
Sbjct: 175421 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 175377



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Minus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 208873 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 208814

                                                           
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340
               || |  ||||| ||||  ||||||||||| ||||| ||||||||
Sbjct: 208813 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 208769



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 136765 ggtgtacttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccggg 136824

                                                           
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340
               || |  ||||| ||||  ||||||||||| ||||| ||||||||
Sbjct: 136825 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 136869



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 389    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
              ||||||||||||||| | ||| ||||||||||||  |||||||||||||||||
Sbjct: 208720 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggaga 208668



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 389    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
              ||||||||||||||| | ||| ||||||||||||  |||||||||||||||||
Sbjct: 175328 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggaga 175276



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                   
Query: 389    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
              ||||||||||||||| | ||| ||||||||||||  |||||||||||||||||
Sbjct: 136918 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggaga 136970



to top

>emb|AJ223353.1|HSAJ3353 Homo sapiens mRNA for histone H2B, clone pJG4-5-15
          Length = 808

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 397 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 338

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 337 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 278

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||||| |||||| ||
Sbjct: 277 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 218

                 
Query: 416 catgat 421
           ||||||
Sbjct: 217 catgat 212



to top

>gb|BC069889.1| Mus musculus histone 1, H2be, mRNA (cDNA clone MGC:78105
           IMAGE:4217814), complete cds
          Length = 657

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 376 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 317

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 257

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 256 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 197

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 196 catgatgcccatggccttggaggaga 171



to top

>gb|BC019673.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MGC:30336
           IMAGE:3993954), complete cds
          Length = 740

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 385 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 326

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 266

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 265 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 206

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 205 catgatgcccatggccttggaggaga 180



to top

>gb|BC096122.1| Homo sapiens histone 1, H2bd, transcript variant 1, mRNA (cDNA
           clone MGC:116768 IMAGE:40002354), complete cds
          Length = 438

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 309 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||||| |||||| ||
Sbjct: 249 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 190

                 
Query: 416 catgat 421
           ||||||
Sbjct: 189 catgat 184



to top

>gb|BC002842.2| Homo sapiens histone 1, H2bd, transcript variant 2, mRNA (cDNA
           clone MGC:3802 IMAGE:3659807), complete cds
          Length = 814

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 394 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 335

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 334 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 275

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||||| |||||| ||
Sbjct: 274 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 215

                 
Query: 416 catgat 421
           ||||||
Sbjct: 214 catgat 209



to top

>ref|XM_683203.1| PREDICTED: Danio rerio similar to histone 1, H2bg (LOC559827), mRNA
          Length = 516

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || |||||||| ||||| ||||| || ||
Sbjct: 504 ggtgtacttggtgacggccttggtgccctcagacacggcgtgtttggccagctcaccggg 445

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  || || |||| |||||||||||| | ||| ||||||||||    |||||||||
Sbjct: 444 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 385

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | | |||||    |  ||||| |||||||    ||||||||||||||||| ||| |||||
Sbjct: 384 gtgagcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 325

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  ||| |||||||||||||
Sbjct: 324 catgatgcccatcgccttggaggaga 299



to top

>dbj|AK049948.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length
           enriched library, clone:C630013P15 product:H2B histone
           family, member S, full insert sequence
          Length = 2410

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 563 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 504

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 503 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 444

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 443 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 384

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 383 catgatgcccatggccttggaggaga 358



to top

>dbj|AK030546.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length
           enriched library, clone:5330429M17 product:H2B histone
           family, member S, full insert sequence
          Length = 2436

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 590 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 531

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 530 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 471

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 470 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 411

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 410 catgatgcccatggccttggaggaga 385



to top

>gb|BC092138.1| Mus musculus histone 1, H2bh, mRNA (cDNA clone MGC:106612
           IMAGE:30613720), complete cds
          Length = 457

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 376 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 317

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 257

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 256 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 197

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||| ||||||||||
Sbjct: 196 catgatgcccatggctttggaggaga 171



to top

>ref|NM_178196.2| Mus musculus histone 1, H2bg (Hist1h2bg), mRNA
          Length = 661

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||| ||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 429 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 370

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 369 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 310

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 309 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 250

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 249 catgatgcccatggccttggaggaga 224



to top

>ref|NM_178200.1| Mus musculus histone 1, H2bm (Hist1h2bm), mRNA
          Length = 381

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 249 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttcacgaacgagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 189 catgatgcccatggccttggaggaga 164



to top

>gb|AY158936.1| Mus musculus histone protein Hist1h2be gene, complete cds
          Length = 1375

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 866 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 807

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 747

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 746 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 687

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 686 catgatgcccatggccttggaggaga 661



to top

>gb|AY158934.1| Mus musculus histone protein Hist1h2bg gene, complete cds
          Length = 1375

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||| ||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 866 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 807

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 747

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 746 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 687

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 686 catgatgcccatggccttggaggaga 661



to top

>gb|AY158933.1| Mus musculus histone protein Hist1h2bh gene, complete cds
          Length = 1201

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 792 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 733

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 732 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 673

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 672 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 613

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||| ||||||||||
Sbjct: 612 catgatgcccatggctttggaggaga 587



to top

>gb|AY158928.1| Mus musculus histone protein Hist1h2bm gene, complete cds
          Length = 1375

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 866 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 807

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 747

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 746 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttcacgaacgagtt 687

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||||||||
Sbjct: 686 catgatgcccatggccttggaggaga 661



to top

>emb|BX647290.1|HSM807434 Homo sapiens mRNA; cDNA DKFZp781B2436 (from clone DKFZp781B2436)
          Length = 1890

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 161/198 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| ||
Sbjct: 407 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 348

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 347 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 288

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||| |||||||| |||| |||||||||
Sbjct: 287 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 228

                             
Query: 416 catgatggacatggcctt 433
           |||||||  |||||||||
Sbjct: 227 catgatgcccatggcctt 210



to top

>ref|NM_178197.1| Mus musculus histone 1, H2bh (Hist1h2bh), mRNA
          Length = 381

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 310

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| ||||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||| | ||| |||||
Sbjct: 249 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 190

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||| ||||||||||
Sbjct: 189 catgatgcccatggctttggaggaga 164



to top

>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25,
              complete sequence
          Length = 167326

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Plus

                                                                          
Query: 236    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
              |||| ||||||||||||||||||||||||| || |||||||| ||||| ||||| || ||
Sbjct: 107388 ggtgtacttggtgacggccttggtgccctcagacacggcgtgtttggccagctcaccggg 107447

                                                                          
Query: 296    gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
               || |  || || |||| |||||||||||| | ||| ||||||||||    |||||||||
Sbjct: 107448 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 107507

                                                                          
Query: 356    gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
              | | |||||    |  ||||| |||||||    ||||||||||||||||| ||| |||||
Sbjct: 107508 gtgagcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 107567

                                        
Query: 416    catgatggacatggccttggaggaga 441
              |||||||  ||| |||||||||||||
Sbjct: 107568 catgatgcccatcgccttggaggaga 107593



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 166/206 (80%)
 Strand = Plus / Plus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| |||||||||||||||| |||||||| || |||||||| ||||| ||||| || ||
Sbjct: 94898 ggtgtacttggtgacggcctttgtgccctcagacacggcgtgtttggccagctcaccggg 94957

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  || || |||| |||||||||||| | ||| ||||||||||    |||||||||
Sbjct: 94958 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 95017

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             | | |||||    |  ||||| |||||||    ||||||||||||||||| ||| |||||
Sbjct: 95018 gtgagcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 95077

                                       
Query: 416   catgatggacatggccttggaggaga 441
             |||||||  ||| |||||||||||||
Sbjct: 95078 catgatgcccatcgccttggaggaga 95103



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 165/206 (80%)
 Strand = Plus / Plus

                                                                         
Query: 236   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
             |||| ||||||| || |||||||||||||| || |||||||| ||||| ||||| || ||
Sbjct: 81765 ggtgtacttggtcacagccttggtgccctcagacacggcgtgtttggccagctcaccggg 81824

                                                                         
Query: 296   gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
              || |  || || |||| |||||||||||| | ||| ||||||||||    |||||||||
Sbjct: 81825 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 81884

                                                                         
Query: 356   gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             | | |||||    |  ||||| |||||||    ||||||||||||||||| ||| |||||
Sbjct: 81885 gtgagcgagacgtgaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 81944

                                       
Query: 416   catgatggacatggccttggaggaga 441
             |||||||  ||| |||||||||||||
Sbjct: 81945 catgatgcccatcgccttggaggaga 81970



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 157/196 (80%)
 Strand = Plus / Minus

                                                                         
Query: 246   gtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacgagg 305
             ||||| |||||||||||||| || |||||||| ||||| ||||| || || || |  || 
Sbjct: 67908 gtgacagccttggtgccctcagacacggcgtgtttggccagctcaccgggcagcagcaga 67849

                                                                         
Query: 306   cggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcgagc 365
             || |||| |||||||||||| | ||| ||||||||||    |||||||||| | ||||| 
Sbjct: 67848 cgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgtagtgagcgaga 67789

                                                                         
Query: 366   ttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggac 425
                |  ||||| |||||||    ||||||||||||||||| ||| ||||||||||||  |
Sbjct: 67788 cgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgccc 67729

                             
Query: 426   atggccttggaggaga 441
             || |||||||||||||
Sbjct: 67728 atcgccttggaggaga 67713



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 82/100 (82%)
 Strand = Plus / Minus

                                                                         
Query: 243   ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacg 302
             ||||| || |||||||||||||| || |||||||| ||||| ||||| || || || |  
Sbjct: 59316 ttggtcacagccttggtgccctcagacacggcgtgtttggccagctcaccgggcagcagc 59257

                                                     
Query: 303   aggcggacggaggtctggatctcgcgggaggtgatggtgg 342
             || || |||| |||||||||||| | ||| ||||||||||
Sbjct: 59256 agacgcacggcggtctggatctctctggaagtgatggtgg 59217



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                  
Query: 389   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
             |||||||||||| |||| ||| ||||||||||||  ||| || ||||||||||
Sbjct: 59170 ctcgaagatgtcattgacgaacgagttcatgatgcccatcgctttggaggaga 59118



to top

>gb|M60751.1|HUMHISAF Human histone H2B.1 (H2B) gene, complete cds
          Length = 1520

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| ||
Sbjct: 901 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 842

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  ||||| ||||  ||||||||||| | |||||||||||| |    |||||||||
Sbjct: 841 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 782

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
             |||| ||   ||  |||||||| ||||    ||||||||||||||||| |||||| ||
Sbjct: 781 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 722

                 
Query: 416 catgat 421
           ||||||
Sbjct: 721 catgat 716



to top

>gb|M57901.1|CHKH2BB Chicken histone H2B gene, complete cds
          Length = 1298

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 167/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| || ||
Sbjct: 791 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 732

                                                                       
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355
            || |  || || ||||  ||||||||||| || || |||||||| |    |||||||||
Sbjct: 731 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 672

                                                                       
Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415
           | |||| ||    |  |||||||||||||    ||||||||||||||||| ||| |||||
Sbjct: 671 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 612

                                     
Query: 416 catgatggacatggccttggaggaga 441
           |||||||  |||||||||||| ||||
Sbjct: 611 catgatgcccatggccttggacgaga 586



to top

>gb|BC051872.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:60248
           IMAGE:6526835), complete cds
          Length = 844

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295
           |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| ||
Sbjct: 409 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 350

                                                        
Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340
            || |  ||||| ||||  ||||||||||| | ||||||||||||
Sbjct: 349 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 305



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 390 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||
Sbjct: 255 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggaga 204


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,918,406
Number of Sequences: 3902068
Number of extensions: 2918406
Number of successful extensions: 64784
Number of sequences better than 10.0: 888
Number of HSP's better than 10.0 without gapping: 898
Number of HSP's successfully gapped in prelim test: 21
Number of HSP's that attempted gapping in prelim test: 60534
Number of HSP's gapped (non-prelim): 4150
length of query: 441
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 419
effective length of database: 17,147,199,772
effective search space: 7184676704468
effective search space used: 7184676704468
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top