Clone Name | rbaet95g07 |
---|---|
Clone Library Name | barley_pub |
>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10, complete sequence Length = 187034 Score = 389 bits (196), Expect = e-105 Identities = 211/216 (97%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 176408 cctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 176349 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 176348 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 176289 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 176288 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 176229 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 176228 tgaaggagttcatgatggacatggccttggaggaga 176193
>gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1268_B08, complete sequence Length = 119500 Score = 389 bits (196), Expect = e-105 Identities = 211/216 (97%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 27090 cctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 27031 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 27030 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 26971 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 26970 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 26911 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 26910 tgaaggagttcatgatggacatggccttggaggaga 26875
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 389 bits (196), Expect = e-105 Identities = 211/216 (97%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 28392166 cctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 28392107 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 28392106 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 28392047 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 28392046 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 28391987 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 28391986 tgaaggagttcatgatggacatggccttggaggaga 28391951 Score = 252 bits (127), Expect = 8e-64 Identities = 190/211 (90%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 22480467 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 22480408 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||||||| || || |||||||||||||||||||||||||| |||||||||||| Sbjct: 22480407 ccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttcttg 22480348 Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410 ||||| | || ||| | |||||||| ||||||||||||| |||||||||| |||| Sbjct: 22480347 ttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacgaag 22480288 Query: 411 gagttcatgatggacatggccttggaggaga 441 || |||||||||||||||||||||||||||| Sbjct: 22480287 gaattcatgatggacatggccttggaggaga 22480257 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 383 gagcttctcgaagatgtcgttgatgaa 409 ||||||||||||||||||||||||||| Sbjct: 3720743 gagcttctcgaagatgtcgttgatgaa 3720769 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 382 cgagcttctcgaagatgtcgttgatgaa 409 ||||||||||| |||||||||||||||| Sbjct: 29356934 cgagcttctcggagatgtcgttgatgaa 29356961 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 382 cgagcttctcgaagatgtcgttgatgaa 409 |||||||||||||||||||||| ||||| Sbjct: 18422090 cgagcttctcgaagatgtcgttaatgaa 18422063 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 384 agcttctcgaagatgtcgttgatgaa 409 ||||||||||||||||| |||||||| Sbjct: 6238958 agcttctcgaagatgtctttgatgaa 6238933 Score = 40.1 bits (20), Expect = 5.9 Identities = 35/40 (87%) Strand = Plus / Plus Query: 382 cgagcttctcgaagatgtcgttgatgaaggagttcatgat 421 ||||||||| |||||| ||| | | ||||||||||||||| Sbjct: 6889823 cgagcttcttgaagatatcgataaagaaggagttcatgat 6889862
>ref|XM_475912.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 459 Score = 387 bits (195), Expect = e-104 Identities = 210/215 (97%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 459 ctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 400 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 399 ctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 340 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 339 cttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgat 280 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 279 gaaggagttcatgatggacatggccttggaggaga 245
>dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8, complete cds Length = 592 Score = 379 bits (191), Expect = e-102 Identities = 209/215 (97%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 479 ctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 420 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 419 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 360 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 359 cttgttgtagcgggcgagcttggcggactcgccggcgagcttctcgaagatgtcgttgat 300 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 299 gaaggagttcatgatggacatggccttggaggaga 265
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 373 bits (188), Expect = e-100 Identities = 209/216 (96%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2673941 cctaagcggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcga 2673882 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2673881 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 2673822 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||| Sbjct: 2673821 tcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttga 2673762 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 2673761 tgaaggagttcatgatggacatggccttggaggaga 2673726 Score = 365 bits (184), Expect = 8e-98 Identities = 208/216 (96%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||||||||||||||| || |||||||||||||||||||||||||||||||| | Sbjct: 2871656 cctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaa 2871597 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2871596 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 2871537 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 2871536 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 2871477 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 2871476 tgaaggagttcatgatggacatggccttggaggaga 2871441 Score = 365 bits (184), Expect = 8e-98 Identities = 208/216 (96%) Strand = Plus / Plus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 2856597 cctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaa 2856656 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || ||||||||||||||||||| |||||||||||| ||||||||||||||||||| Sbjct: 2856657 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 2856716 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 2856717 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 2856776 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 2856777 tgaaggagttcatgatggacatggccttggaggaga 2856812 Score = 355 bits (179), Expect = 8e-95 Identities = 206/215 (95%) Strand = Plus / Plus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 2819235 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgag 2819294 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || |||||||||||||||||||||||||||||||| || ||||||||||||||||| Sbjct: 2819295 ctcgccggggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggctt 2819354 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| Sbjct: 2819355 cttgttgtagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgat 2819414 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 2819415 gaaggagttcatgatggacatggccttggaggaga 2819449 Score = 341 bits (172), Expect = 1e-90 Identities = 205/216 (94%) Strand = Plus / Plus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||| || ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 2843658 cctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcga 2843717 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||| ||||| ||||||||||||||||||| Sbjct: 2843718 gctcgccggggaggacgaggcggacggaggtctgaatctcccgggaggtgatggtgggct 2843777 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||| Sbjct: 2843778 tcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttga 2843837 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 2843838 tgaaggagttcatgatggacatggccttggaggaga 2843873 Score = 341 bits (172), Expect = 1e-90 Identities = 205/216 (94%) Strand = Plus / Plus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 2837045 cctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcga 2837104 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || ||||||||||||||||||| |||||||||||| ||||||||||||||||||| Sbjct: 2837105 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 2837164 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||||||||||||||||| ||| |||||||||||||||||||| || |||| Sbjct: 2837165 tcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattga 2837224 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 2837225 tgaaggagttcatgatggacatggccttggaggaga 2837260 Score = 341 bits (172), Expect = 1e-90 Identities = 205/216 (94%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||||||||| || |||||||||||||||||||| ||||||||||||||||||| Sbjct: 2686264 cctaagcggaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcga 2686205 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 2686204 gctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggct 2686145 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||| |||| Sbjct: 2686144 tcttgttgtagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattga 2686085 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 2686084 tgaaggagttcatgatggacatggccttggaggaga 2686049 Score = 297 bits (150), Expect = 2e-77 Identities = 192/206 (93%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||||||||||||||||||||||||||||||||||||||||||||||||||||| || || Sbjct: 17421734 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 17421793 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 ||||||||||||||||||||||| |||||||||||||||| | |||||||||||||||| Sbjct: 17421794 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 17421853 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 ||| ||||| | ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 17421854 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 17421913 Query: 416 catgatggacatggccttggaggaga 441 |||||| ||||||||||||||||||| Sbjct: 17421914 catgatcgacatggccttggaggaga 17421939 Score = 272 bits (137), Expect = 9e-70 Identities = 191/209 (91%) Strand = Plus / Plus Query: 228 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287 ||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 36007433 taagacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagc 36007492 Query: 288 tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347 || || |||||||||||||| || ||||||||||||||||||||||||||||| |||||| Sbjct: 36007493 tcgccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttc 36007552 Query: 348 ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407 ||||||||||| ||||| ||||||||| |||||||||||||||||| ||||||||| Sbjct: 36007553 ttgttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatg 36007612 Query: 408 aaggagttcatgatggacatggccttgga 436 || ||||||||||| |||||||||||||| Sbjct: 36007613 aacgagttcatgatcgacatggccttgga 36007641 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Plus Query: 384 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggcct 432 ||||||||||| | ||||||||||||||| |||||||| |||||||||| Sbjct: 30942127 agcttctcgaaaacgtcgttgatgaaggatttcatgatagacatggcct 30942175 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 387 ttctcgaagatgtcgttgatgaaggagtt 415 |||| |||||||||||||||||| ||||| Sbjct: 80259 ttcttgaagatgtcgttgatgaatgagtt 80287
>dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0434B04 Length = 167029 Score = 373 bits (188), Expect = e-100 Identities = 209/216 (96%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 123716 cctaagcggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcga 123657 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 123656 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 123597 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||| Sbjct: 123596 tcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttga 123537 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 123536 tgaaggagttcatgatggacatggccttggaggaga 123501 Score = 341 bits (172), Expect = 1e-90 Identities = 205/216 (94%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||||||||| || |||||||||||||||||||| ||||||||||||||||||| Sbjct: 136039 cctaagcggaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcga 135980 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 135979 gctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggct 135920 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||| |||| Sbjct: 135919 tcttgttgtagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattga 135860 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 135859 tgaaggagttcatgatggacatggccttggaggaga 135824
>ref|NM_184371.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 371 bits (187), Expect = 1e-99 Identities = 208/215 (96%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 462 ctaagcggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgag 403 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 402 ctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 343 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||| Sbjct: 342 cttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgat 283 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 282 gaaggagttcatgatggacatggccttggaggaga 248
>emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B Length = 712 Score = 371 bits (187), Expect = 1e-99 Identities = 205/211 (97%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 519 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 460 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| Sbjct: 459 ccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttg 400 Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410 ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 399 ttgtaccgcgccagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 340 Query: 411 gagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||| Sbjct: 339 gagttcatgatggacatggccttggaggaga 309
>gb|BT016429.1| Zea mays clone Contig262 mRNA sequence Length = 564 Score = 365 bits (184), Expect = 8e-98 Identities = 202/208 (97%) Strand = Plus / Minus Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 397 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccg 338 Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353 |||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 337 gggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtgggcttcttgttg 278 Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413 || ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 277 taccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 218 Query: 414 ttcatgatggacatggccttggaggaga 441 |||||||||||||||||||| ||||||| Sbjct: 217 ttcatgatggacatggccttagaggaga 190
>emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221) Length = 653 Score = 365 bits (184), Expect = 8e-98 Identities = 202/208 (97%) Strand = Plus / Minus Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 463 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccg 404 Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353 |||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 403 gggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtgggcttcttgttg 344 Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413 || ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 343 taccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 284 Query: 414 ttcatgatggacatggccttggaggaga 441 |||||||||||||||||||| ||||||| Sbjct: 283 ttcatgatggacatggccttagaggaga 256
>dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0030H07 Length = 168253 Score = 365 bits (184), Expect = 8e-98 Identities = 208/216 (96%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||||||||||||||| || |||||||||||||||||||||||||||||||| | Sbjct: 78654 cctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaa 78595 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 78594 gctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 78535 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 78534 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 78475 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 78474 tgaaggagttcatgatggacatggccttggaggaga 78439 Score = 365 bits (184), Expect = 8e-98 Identities = 208/216 (96%) Strand = Plus / Plus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 63595 cctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaa 63654 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || ||||||||||||||||||| |||||||||||| ||||||||||||||||||| Sbjct: 63655 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 63714 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 63715 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 63774 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 63775 tgaaggagttcatgatggacatggccttggaggaga 63810 Score = 355 bits (179), Expect = 8e-95 Identities = 206/215 (95%) Strand = Plus / Plus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 26233 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgag 26292 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || |||||||||||||||||||||||||||||||| || ||||||||||||||||| Sbjct: 26293 ctcgccggggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggctt 26352 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| Sbjct: 26353 cttgttgtagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgat 26412 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 26413 gaaggagttcatgatggacatggccttggaggaga 26447 Score = 341 bits (172), Expect = 1e-90 Identities = 205/216 (94%) Strand = Plus / Plus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||| || ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 50656 cctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcga 50715 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||| ||||| ||||||||||||||||||| Sbjct: 50716 gctcgccggggaggacgaggcggacggaggtctgaatctcccgggaggtgatggtgggct 50775 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||| Sbjct: 50776 tcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttga 50835 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 50836 tgaaggagttcatgatggacatggccttggaggaga 50871 Score = 341 bits (172), Expect = 1e-90 Identities = 205/216 (94%) Strand = Plus / Plus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 44043 cctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcga 44102 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || ||||||||||||||||||| |||||||||||| ||||||||||||||||||| Sbjct: 44103 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 44162 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||||||||||||||||| ||| |||||||||||||||||||| || |||| Sbjct: 44163 tcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattga 44222 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 44223 tgaaggagttcatgatggacatggccttggaggaga 44258
>dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0009G03 Length = 163526 Score = 365 bits (184), Expect = 8e-98 Identities = 208/216 (96%) Strand = Plus / Plus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 162274 cctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaa 162333 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || ||||||||||||||||||| |||||||||||| ||||||||||||||||||| Sbjct: 162334 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 162393 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 162394 tcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttga 162453 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 162454 tgaaggagttcatgatggacatggccttggaggaga 162489 Score = 355 bits (179), Expect = 8e-95 Identities = 206/215 (95%) Strand = Plus / Plus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 124912 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgag 124971 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || |||||||||||||||||||||||||||||||| || ||||||||||||||||| Sbjct: 124972 ctcgccggggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggctt 125031 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| Sbjct: 125032 cttgttgtagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgat 125091 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 125092 gaaggagttcatgatggacatggccttggaggaga 125126 Score = 341 bits (172), Expect = 1e-90 Identities = 205/216 (94%) Strand = Plus / Plus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||| || ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 149335 cctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcga 149394 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||| ||||| ||||||||||||||||||| Sbjct: 149395 gctcgccggggaggacgaggcggacggaggtctgaatctcccgggaggtgatggtgggct 149454 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||| Sbjct: 149455 tcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttga 149514 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 149515 tgaaggagttcatgatggacatggccttggaggaga 149550 Score = 341 bits (172), Expect = 1e-90 Identities = 205/216 (94%) Strand = Plus / Plus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 142722 cctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcga 142781 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || ||||||||||||||||||| |||||||||||| ||||||||||||||||||| Sbjct: 142782 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 142841 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||||||||||||||||| ||| |||||||||||||||||||| || |||| Sbjct: 142842 tcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattga 142901 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 142902 tgaaggagttcatgatggacatggccttggaggaga 142937
>ref|NM_184409.1| Oryza sativa (japonica cultivar-group), mRNA Length = 468 Score = 363 bits (183), Expect = 3e-97 Identities = 207/215 (96%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||| ||||||||||||||| || |||||||||||||||||||||||||||||||| || Sbjct: 468 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaag 409 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 408 ctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 349 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 348 cttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgat 289 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 288 gaaggagttcatgatggacatggccttggaggaga 254
>ref|NM_184407.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 363 bits (183), Expect = 3e-97 Identities = 207/215 (96%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 462 ctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaag 403 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || ||||||||||||||||||| |||||||||||| |||||||||||||||||||| Sbjct: 402 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 343 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 342 cttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgat 283 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 282 gaaggagttcatgatggacatggccttggaggaga 248
>ref|NM_184399.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 355 bits (179), Expect = 8e-95 Identities = 206/215 (95%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 462 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgag 403 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || |||||||||||||||||||||||||||||||| || ||||||||||||||||| Sbjct: 402 ctcgccggggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggctt 343 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| Sbjct: 342 cttgttgtagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgat 283 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 282 gaaggagttcatgatggacatggccttggaggaga 248
>gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full insert mRNA sequence Length = 764 Score = 355 bits (179), Expect = 8e-95 Identities = 206/215 (95%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 |||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||| Sbjct: 552 ctaagacgaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgag 493 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 492 ctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 433 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 ||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 432 cttgttgtaccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgat 373 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 372 gaaggagttcatgatggacatggccttggaggaga 338
>dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6, complete cds Length = 564 Score = 355 bits (179), Expect = 8e-95 Identities = 203/211 (96%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 410 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 351 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || |||||||||||||| |||| |||||||||||| |||||||||||||||||||||||| Sbjct: 350 ccggggaggacgaggcgcacggcggtctggatctcccgggaggtgatggtgggcttcttg 291 Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410 ||||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 290 ttgtagcgcgccagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaag 231 Query: 411 gagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||| Sbjct: 230 gagttcatgatggacatggccttggaggaga 200
>gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds Length = 678 Score = 355 bits (179), Expect = 8e-95 Identities = 206/215 (95%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 |||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||| Sbjct: 485 ctaagacgaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgag 426 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 425 ctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 366 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 ||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 365 cttgttgtaccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgat 306 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 305 gaaggagttcatgatggacatggccttggaggaga 271
>dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B153, complete cds Length = 3209 Score = 351 bits (177), Expect = 1e-93 Identities = 201/209 (96%) Strand = Plus / Minus Query: 233 ggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 292 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 1699 ggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 1640 Query: 293 agggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgtt 352 |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| Sbjct: 1639 tgggaggacgaggcggacggaggtctggatctcccgggatgtgatggtgggcttcttgtt 1580 Query: 353 gtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaagga 412 ||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 1579 gtaccgcgccagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaagga 1520 Query: 413 gttcatgatggacatggccttggaggaga 441 |||| |||||||||||||||||||||||| Sbjct: 1519 gttcgtgatggacatggccttggaggaga 1491
>gb|BT016519.1| Zea mays clone Contig352 mRNA sequence Length = 789 Score = 345 bits (174), Expect = 7e-92 Identities = 198/206 (96%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||||||||||||||||||||||| ||||||||||||||||| ||||||||||| || || Sbjct: 522 ggtgaacttggtgacggccttggttccctcggagacggcgtgtttggcgagctctcctgg 463 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 462 gaggacgaggcgcacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 402 ccgggcgagcttagcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 343 Query: 416 catgatggacatggccttggaggaga 441 |||||||||||||||||||||||||| Sbjct: 342 catgatggacatggccttggaggaga 317
>gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence Length = 574 Score = 341 bits (172), Expect = 1e-90 Identities = 199/208 (95%) Strand = Plus / Minus Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || Sbjct: 519 gaggtgaacttggtgacggccttggtgccctccgagacggcgtgcttggcgagctcgccg 460 Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353 || || |||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 459 ggtagaacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 400 Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413 ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||| Sbjct: 399 tagcgggcgagcttggccgcctcgccggcgagcttctcgaagatgtcgttgatgaatgag 340 Query: 414 ttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||| Sbjct: 339 ttcatgatggacatggccttggaggaga 312
>gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full insert mRNA sequence Length = 940 Score = 341 bits (172), Expect = 1e-90 Identities = 199/208 (95%) Strand = Plus / Minus Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || Sbjct: 772 gaggtgaacttggtgacggccttggtgccctctgagacggcgtgcttggcgagctcgccg 713 Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 712 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 653 Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413 ||||| ||||||||||||| ||| || ||||||||||||||||||||||||||||||||| Sbjct: 652 tagcgggcgagcttggcggactccccagcgagcttctcgaagatgtcgttgatgaaggag 593 Query: 414 ttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||| Sbjct: 592 ttcatgatggacatggccttggaggaga 565
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 341 bits (172), Expect = 1e-90 Identities = 205/216 (94%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 24254625 cctaagagctggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 24254566 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||||||||| | ||||||||||||||||| Sbjct: 24254565 gctcgccggggaggacgaggcggacggaggtctggatctccctggaggtgatggtgggct 24254506 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 24254505 tcttgttgtacctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 24254446 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||| ||||||||||| ||||||||||||||||||| Sbjct: 24254445 tgaacgagttcatgattgacatggccttggaggaga 24254410 Score = 188 bits (95), Expect = 1e-44 Identities = 140/155 (90%) Strand = Plus / Minus Query: 237 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccaggg 296 |||||||||||||||||||| | |||||||||||||| |||||||||||||| || || Sbjct: 24251113 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 24251054 Query: 297 aggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356 |||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||| Sbjct: 24251053 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 24250994 Query: 357 cgcgcgagcttggcggcctcgccggcgagcttctc 391 || ||||||||||||||||| ||| | |||||||| Sbjct: 24250993 cgggcgagcttggcggcctcaccgacaagcttctc 24250959 Score = 79.8 bits (40), Expect = 7e-12 Identities = 52/56 (92%) Strand = Plus / Minus Query: 384 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||| ||||||| ||||||||||||||||||| |||||||||||||| ||||| Sbjct: 21802131 agcttcttgaagatgccgttgatgaaggagttcataatggacatggccttagagga 21802076 Score = 67.9 bits (34), Expect = 3e-08 Identities = 46/50 (92%) Strand = Plus / Plus Query: 387 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttgga 436 ||||||| ||| || ||||||||||||||||||||||||||| ||||||| Sbjct: 11770130 ttctcgaggatttcattgatgaaggagttcatgatggacatgaccttgga 11770179 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Plus Query: 383 gagcttctcgaagatgtcgttgatgaaggagttcatg 419 ||||||||||||||||| | ||| ||||||||||||| Sbjct: 11729269 gagcttctcgaagatgttgatgaagaaggagttcatg 11729305 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 402 ttgatgaaggagttcatgatggac 425 |||||||||||||||||||||||| Sbjct: 17523219 ttgatgaaggagttcatgatggac 17523242 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 384 agcttctcgaagatgtcgttgatgaa 409 ||||||||||||||||| |||||||| Sbjct: 19095814 agcttctcgaagatgtctttgatgaa 19095839 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 387 ttctcgaagatgtcgttgatgaagga 412 |||||||||||||||||| ||||||| Sbjct: 15287651 ttctcgaagatgtcgttggtgaagga 15287626 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 380 ggcgagcttctcgaagatgtcgttgatga 408 ||||||||||| ||||||||| ||||||| Sbjct: 24608038 ggcgagcttcttgaagatgtctttgatga 24608066 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 386 cttctcgaagatgtcgttgatgaa 409 ||||||||||||||| |||||||| Sbjct: 13969661 cttctcgaagatgtcattgatgaa 13969684
>dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0605H02 Length = 175547 Score = 341 bits (172), Expect = 1e-90 Identities = 205/216 (94%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 120964 cctaagagctggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 120905 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||||||||| | ||||||||||||||||| Sbjct: 120904 gctcgccggggaggacgaggcggacggaggtctggatctccctggaggtgatggtgggct 120845 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 120844 tcttgttgtacctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 120785 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||| ||||||||||| ||||||||||||||||||| Sbjct: 120784 tgaacgagttcatgattgacatggccttggaggaga 120749 Score = 188 bits (95), Expect = 1e-44 Identities = 140/155 (90%) Strand = Plus / Minus Query: 237 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccaggg 296 |||||||||||||||||||| | |||||||||||||| |||||||||||||| || || Sbjct: 117452 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 117393 Query: 297 aggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356 |||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||| Sbjct: 117392 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 117333 Query: 357 cgcgcgagcttggcggcctcgccggcgagcttctc 391 || ||||||||||||||||| ||| | |||||||| Sbjct: 117332 cgggcgagcttggcggcctcaccgacaagcttctc 117298
>dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complete cds Length = 552 Score = 341 bits (172), Expect = 1e-90 Identities = 205/216 (94%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||||| ||| || ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 479 cctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcga 420 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || |||||||||||||||||||||||||| ||||| ||||||||||||||||||| Sbjct: 419 gctcgccggggaggacgaggcggacggaggtctgaatctcccgggaggtgatggtgggct 360 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 ||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||| Sbjct: 359 tcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttga 300 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||||||||| Sbjct: 299 tgaaggagttcatgatggacatggccttggaggaga 264
>ref|NM_184405.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 339 bits (171), Expect = 5e-90 Identities = 204/215 (94%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||| ||| || ||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 462 ctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcgag 403 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || |||||||||||||||||||||||||| ||||| |||||||||||||||||||| Sbjct: 402 ctcgccggggaggacgaggcggacggaggtctgaatctcccgggaggtgatggtgggctt 343 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||| Sbjct: 342 cttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgat 283 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 282 gaaggagttcatgatggacatggccttggaggaga 248
>ref|NM_184403.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 339 bits (171), Expect = 5e-90 Identities = 201/211 (95%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 458 gaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcg 399 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| Sbjct: 398 ccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttg 339 Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410 |||||||||||||||||||||| ||| |||||||||||||||||||| || ||||||||| Sbjct: 338 ttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgatgaag 279 Query: 411 gagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||| Sbjct: 278 gagttcatgatggacatggccttggaggaga 248
>ref|NM_184374.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 339 bits (171), Expect = 5e-90 Identities = 204/215 (94%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||| ||||||||| || |||||||||||||||||||| |||||||||||||||||||| Sbjct: 462 ctaagcggaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgag 403 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 402 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 343 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||| ||||||||||||| ||| ||||||||||||||||||||||| ||||| Sbjct: 342 cttgttgtagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgat 283 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||| Sbjct: 282 gaaggagttcatgatggacatggccttggaggaga 248
>ref|XM_483094.1| Oryza sativa (japonica cultivar-group), mRNA Length = 453 Score = 339 bits (171), Expect = 5e-90 Identities = 204/215 (94%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 453 ctaagagctggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 394 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || |||||||||||||||||||||||||||||||| | |||||||||||||||||| Sbjct: 393 ctcgccggggaggacgaggcggacggaggtctggatctccctggaggtgatggtgggctt 334 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 333 cttgttgtacctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 274 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 ||| ||||||||||| ||||||||||||||||||| Sbjct: 273 gaacgagttcatgattgacatggccttggaggaga 239
>emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214) Length = 580 Score = 333 bits (168), Expect = 3e-88 Identities = 204/216 (94%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 ||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||| Sbjct: 460 cctaagacgaggtgaacttcgtaacggccttagtgccctcggagacggcgtgcttggcga 401 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 ||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||| Sbjct: 400 gctccccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggct 341 Query: 346 tcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttga 405 |||||||||||||||| |||||||||| |||| | ||||||||||||||||||||||||| Sbjct: 340 tcttgttgtagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttga 281 Query: 406 tgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||| |||| Sbjct: 280 tgaaggagttcatgatggacatggccttggacgaga 245
>emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3) Length = 1728 Score = 321 bits (162), Expect = 1e-84 Identities = 201/214 (93%) Strand = Plus / Minus Query: 228 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 495 taagaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 436 Query: 288 tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347 || || |||||||||||||| || ||||||||||||||||||||||||| |||||||||| Sbjct: 435 tcgccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgacggtgggcttc 376 Query: 348 ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407 ||||| |||||||| |||||||||| |||| | ||||||||||||||||||||||||||| Sbjct: 375 ttgttatagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatg 316 Query: 408 aaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||| |||| Sbjct: 315 aaggagttcatgatggacatggccttggacgaga 282
>gb|BT016350.1| Zea mays clone Contig183 mRNA sequence Length = 706 Score = 317 bits (160), Expect = 2e-83 Identities = 196/208 (94%) Strand = Plus / Minus Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 507 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccg 448 Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353 || ||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 447 ggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtaggcttcttgtta 388 Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413 ||||||||||||||||||||||| | ||||||||||||||||| ||||| ||||||||| Sbjct: 387 tagcgcgcgagcttggcggcctcagcagcgagcttctcgaagatatcgttaatgaaggag 328 Query: 414 ttcatgatggacatggccttggaggaga 441 |||||||| ||||||||||||||||||| Sbjct: 327 ttcatgatcgacatggccttggaggaga 300
>gb|BT016478.1| Zea mays clone Contig311 mRNA sequence Length = 836 Score = 315 bits (159), Expect = 7e-83 Identities = 201/215 (93%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 |||||| || |||||||||||||| ||||| ||||| || |||||||||||||||||||| Sbjct: 552 ctaagacgaagtgaacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgag 493 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || || |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 492 ctcgccgggtaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 433 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 432 cttgttgtagcgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgat 373 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 |||||| ||||||||||||||||||||||| |||| Sbjct: 372 gaaggaattcatgatggacatggccttggacgaga 338
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 313 bits (158), Expect = 3e-82 Identities = 194/206 (94%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 ||||||||||||||| |||||||||||||||||||||||||||||||||||||| || || Sbjct: 9465324 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9465265 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9465264 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9465205 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 ||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 9465204 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9465145 Query: 416 catgatggacatggccttggaggaga 441 |||||| ||||||||||||||||||| Sbjct: 9465144 catgatcgacatggccttggaggaga 9465119 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Plus Query: 386 cttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||| |||||| ||||||||||||||||| ||||||| ||||||||| ||||| Sbjct: 11567062 cttcttgaagatatcgttgatgaaggagttgatgatggtcatggccttagagga 11567115 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 382 cgagcttctcgaagatgtcgttgatgaaggagttcatg 419 |||||||||||||||||||| |||||||||||||||| Sbjct: 25627557 cgagcttctcgaagatgtcgaggatgaaggagttcatg 25627594 Score = 44.1 bits (22), Expect = 0.38 Identities = 28/30 (93%) Strand = Plus / Minus Query: 380 ggcgagcttctcgaagatgtcgttgatgaa 409 |||||||||||| |||||||| |||||||| Sbjct: 23486139 ggcgagcttctcaaagatgtctttgatgaa 23486110
>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0002D01, from chromosome 3, complete sequence Length = 187589 Score = 313 bits (158), Expect = 3e-82 Identities = 194/206 (94%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 ||||||||||||||| |||||||||||||||||||||||||||||||||||||| || || Sbjct: 162724 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 162665 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 162664 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 162605 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 ||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 162604 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 162545 Query: 416 catgatggacatggccttggaggaga 441 |||||| ||||||||||||||||||| Sbjct: 162544 catgatcgacatggccttggaggaga 162519
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 313 bits (158), Expect = 3e-82 Identities = 194/206 (94%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 ||||||||||||||| |||||||||||||||||||||||||||||||||||||| || || Sbjct: 9463445 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9463386 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9463385 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9463326 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 ||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 9463325 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9463266 Query: 416 catgatggacatggccttggaggaga 441 |||||| ||||||||||||||||||| Sbjct: 9463265 catgatcgacatggccttggaggaga 9463240 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Plus Query: 386 cttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||| |||||| ||||||||||||||||| ||||||| ||||||||| ||||| Sbjct: 11563825 cttcttgaagatatcgttgatgaaggagttgatgatggtcatggccttagagga 11563878 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 382 cgagcttctcgaagatgtcgttgatgaaggagttcatg 419 |||||||||||||||||||| |||||||||||||||| Sbjct: 25718866 cgagcttctcgaagatgtcgaggatgaaggagttcatg 25718903 Score = 44.1 bits (22), Expect = 0.38 Identities = 28/30 (93%) Strand = Plus / Minus Query: 380 ggcgagcttctcgaagatgtcgttgatgaa 409 |||||||||||| |||||||| |||||||| Sbjct: 23479167 ggcgagcttctcaaagatgtctttgatgaa 23479138
>gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence Length = 574 Score = 309 bits (156), Expect = 4e-81 Identities = 195/208 (93%) Strand = Plus / Minus Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 299 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccg 240 Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353 || ||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 239 ggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtaggcttcttgtta 180 Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413 |||||||| |||||||||||||| | ||||||||||||||||| ||||| ||||||||| Sbjct: 179 tagcgcgccagcttggcggcctcagcagcgagcttctcgaagatatcgttaatgaaggag 120 Query: 414 ttcatgatggacatggccttggaggaga 441 |||||||| ||||||||||||||||||| Sbjct: 119 ttcatgatcgacatggccttggaggaga 92
>emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4) Length = 2361 Score = 307 bits (155), Expect = 2e-80 Identities = 200/215 (93%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 ||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1378 ctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 1319 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| ||||| ||||||||||| || || ||||||||||| |||||||| ||||||||||| Sbjct: 1318 ctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggctt 1259 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 |||||||||||| |||||||||||||||||| | || ||||||||||||||||||||||| Sbjct: 1258 cttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgat 1199 Query: 407 gaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||||||||||||||||| |||| Sbjct: 1198 gaaggagttcatgatggacatggccttggacgaga 1164
>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0507H06 Length = 136351 Score = 297 bits (150), Expect = 2e-77 Identities = 192/206 (93%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||||||||||||||||||||||||||||||||||||||||||||||||||||| || || Sbjct: 75126 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 75185 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 ||||||||||||||||||||||| |||||||||||||||| | |||||||||||||||| Sbjct: 75186 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 75245 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 ||| ||||| | ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 75246 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 75305 Query: 416 catgatggacatggccttggaggaga 441 |||||| ||||||||||||||||||| Sbjct: 75306 catgatcgacatggccttggaggaga 75331
>gb|BT016885.1| Zea mays clone Contig718 mRNA sequence Length = 568 Score = 289 bits (146), Expect = 4e-75 Identities = 191/206 (92%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||||||||||||||||| ||||||||||||||||||||||||||||||||||| || || Sbjct: 326 ggtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcgccggg 267 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 |||||||||||| ||||||||||||||||||||||| || ||||| |||||||||||||| Sbjct: 266 gaggacgaggcgaacggaggtctggatctcgcgggacgtaatggtaggcttcttgttgta 207 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 ||||| |||||||| ||||| | || |||||||||||||||||||||||||||||||| Sbjct: 206 ccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcgttgatgaaggagtt 147 Query: 416 catgatggacatggccttggaggaga 441 ||||||||||||||||||||| |||| Sbjct: 146 catgatggacatggccttggacgaga 121
>gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, partial cds Length = 427 Score = 281 bits (142), Expect = 9e-73 Identities = 190/206 (92%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 ||||||||||||||||||||| || ||||||||||||||||||||||||||||| || || Sbjct: 289 ggtgaacttggtgacggccttagttccctcggagacggcgtgcttggcgagctcgccggg 230 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 229 gaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 170 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 ||| ||||| ||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 169 gcgggcgaggcgtgcggcttcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 110 Query: 416 catgatggacatggccttggaggaga 441 |||||||||||||||||||||||||| Sbjct: 109 catgatggacatggccttggaggaga 84
>gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partial cds Length = 410 Score = 280 bits (141), Expect = 4e-72 Identities = 195/213 (91%) Strand = Plus / Minus Query: 227 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 286 |||||| || ||||||||||||||||||||||||||||| || ||||||||||||||||| Sbjct: 213 ctaagaagaagtgaacttggtgacggccttggtgccctcagacacggcgtgcttggcgag 154 Query: 287 ctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggctt 346 ||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 153 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 94 Query: 347 cttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 406 ||||||||| | ||||||||||||| ||| || || | ||||||||||||||| |||| Sbjct: 93 cttgttgtacctggcgagcttggcggactcaccagccaatttctcgaagatgtcgctgat 34 Query: 407 gaaggagttcatgatggacatggccttggagga 439 ||||||||||||||||||||||||| ||||||| Sbjct: 33 gaaggagttcatgatggacatggccctggagga 1
>ref|NM_190523.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 420 Score = 272 bits (137), Expect = 9e-70 Identities = 191/209 (91%) Strand = Plus / Minus Query: 228 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287 ||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 419 taagacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagc 360 Query: 288 tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347 || || |||||||||||||| || ||||||||||||||||||||||||||||| |||||| Sbjct: 359 tcgccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttc 300 Query: 348 ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407 ||||||||||| ||||| ||||||||| |||||||||||||||||| ||||||||| Sbjct: 299 ttgttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatg 240 Query: 408 aaggagttcatgatggacatggccttgga 436 || ||||||||||| |||||||||||||| Sbjct: 239 aacgagttcatgatcgacatggccttgga 211
>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0408C03 Length = 141273 Score = 272 bits (137), Expect = 9e-70 Identities = 191/209 (91%) Strand = Plus / Plus Query: 228 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287 ||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 20158 taagacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagc 20217 Query: 288 tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347 || || |||||||||||||| || ||||||||||||||||||||||||||||| |||||| Sbjct: 20218 tcgccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttc 20277 Query: 348 ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407 ||||||||||| ||||| ||||||||| |||||||||||||||||| ||||||||| Sbjct: 20278 ttgttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatg 20337 Query: 408 aaggagttcatgatggacatggccttgga 436 || ||||||||||| |||||||||||||| Sbjct: 20338 aacgagttcatgatcgacatggccttgga 20366
>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0031D11 Length = 138108 Score = 272 bits (137), Expect = 9e-70 Identities = 191/209 (91%) Strand = Plus / Plus Query: 228 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287 ||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 106111 taagacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagc 106170 Query: 288 tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347 || || |||||||||||||| || ||||||||||||||||||||||||||||| |||||| Sbjct: 106171 tcgccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttc 106230 Query: 348 ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407 ||||||||||| ||||| ||||||||| |||||||||||||||||| ||||||||| Sbjct: 106231 ttgttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatg 106290 Query: 408 aaggagttcatgatggacatggccttgga 436 || ||||||||||| |||||||||||||| Sbjct: 106291 aacgagttcatgatcgacatggccttgga 106319
>emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B Length = 492 Score = 258 bits (130), Expect = 1e-65 Identities = 172/186 (92%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 452 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccggg 393 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 392 gaggacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 333 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 ||| || || || |||||| ||| |||||||||||||||||||||||||| ||||| Sbjct: 332 gcgggccaggcgggaggcctcctgggccagcttctcgaagatgtcgttgatgaacgagtt 273 Query: 416 catgat 421 |||||| Sbjct: 272 catgat 267
>ref|XM_475367.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 375 Score = 252 bits (127), Expect = 8e-64 Identities = 190/211 (90%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 371 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 312 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||||||| || || |||||||||||||||||||||||||| |||||||||||| Sbjct: 311 ccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttcttg 252 Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410 ||||| | || ||| | |||||||| ||||||||||||| |||||||||| |||| Sbjct: 251 ttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacgaag 192 Query: 411 gagttcatgatggacatggccttggaggaga 441 || |||||||||||||||||||||||||||| Sbjct: 191 gaattcatgatggacatggccttggaggaga 161
>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05, complete sequence Length = 163130 Score = 252 bits (127), Expect = 8e-64 Identities = 190/211 (90%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 69874 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 69815 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||||||| || || |||||||||||||||||||||||||| |||||||||||| Sbjct: 69814 ccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttcttg 69755 Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410 ||||| | || ||| | |||||||| ||||||||||||| |||||||||| |||| Sbjct: 69754 ttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacgaag 69695 Query: 411 gagttcatgatggacatggccttggaggaga 441 || |||||||||||||||||||||||||||| Sbjct: 69694 gaattcatgatggacatggccttggaggaga 69664
>gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds Length = 627 Score = 228 bits (115), Expect = 1e-56 Identities = 178/199 (89%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||||||||||| |||||||||||||| |||||||||||||||||||||||||| || || Sbjct: 519 ggtgaacttggtcacggccttggtgccgtcggagacggcgtgcttggcgagctcgccggg 460 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 ||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 459 gagcacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 400 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 ||| || || | || ||| |||||||||||||||||||||||||||||||||||| Sbjct: 399 gcgggccaggcgagaggactcctgggcgagcttctcgaagatgtcgttgatgaaggagtt 340 Query: 416 catgatggacatggccttg 434 |||||| |||||||||| Sbjct: 339 catgatccccatggccttg 321
>dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B123, complete cds Length = 2901 Score = 210 bits (106), Expect = 3e-51 Identities = 175/198 (88%) Strand = Plus / Minus Query: 244 tggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacga 303 |||| ||||||||||| ||||||||||||||||||||||| ||||| || || | ||| | Sbjct: 1985 tggtaacggccttggttccctcggagacggcgtgcttggcaagctcgcctggaaagacaa 1926 Query: 304 ggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcga 363 |||| |||| ||||||||||| || ||||||||||||||||||||||||||||| |||| Sbjct: 1925 ggcgcacggcagtctggatctcccgagaggtgatggtgggcttcttgttgtagcgtgcga 1866 Query: 364 gcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatgg 423 |||| || | ||| ||||||||||||||||||||||||||||||| |||||| ||||||| Sbjct: 1865 gctttgccgactctccggcgagcttctcgaagatgtcgttgatgatggagttgatgatgg 1806 Query: 424 acatggccttggaggaga 441 |||| | |||||||||| Sbjct: 1805 acattgatttggaggaga 1788
>dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-D03, full insert sequence Length = 288 Score = 196 bits (99), Expect = 4e-47 Identities = 120/127 (94%) Strand = Plus / Minus Query: 226 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 285 |||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 135 cctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcga 76 Query: 286 gctccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggct 345 |||| || ||||||||||||||||||| |||||||||||| ||||||||||||||||||| Sbjct: 75 gctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggct 16 Query: 346 tcttgtt 352 ||||||| Sbjct: 15 tcttgtt 9
>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV), and histone H2B (ch2b-IV) genes, complete cds Length = 4502 Score = 192 bits (97), Expect = 7e-46 Identities = 175/201 (87%) Strand = Plus / Minus Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293 |||||||||||||| ||||||||||||||||| || || ||||||||||| ||||| || Sbjct: 4211 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 4152 Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353 || || || ||||| |||| ||||||||||||||||||||| | |||||||||||||||| Sbjct: 4151 ggcagcaccaggcgcacggcggtctggatctcgcgggaggtcacggtgggcttcttgttg 4092 Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413 ||||| ||||||| ||||||| ||| | |||||| |||||||||||||||||| | Sbjct: 4091 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 4032 Query: 414 ttcatgatggacatggccttg 434 ||||||||||||||||||||| Sbjct: 4031 ttcatgatggacatggccttg 4011
>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and histone H2A genes, complete cds Length = 4358 Score = 184 bits (93), Expect = 2e-43 Identities = 174/201 (86%) Strand = Plus / Plus Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293 |||||||||||||| ||||||||||||||||| || || ||||||||||| ||||| ||| Sbjct: 3040 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgcca 3099 Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353 || || || ||||| |||| |||||||||||| |||||||| | |||||||||||||||| Sbjct: 3100 ggcagcaccaggcgcacggcggtctggatctcacgggaggtcacggtgggcttcttgttg 3159 Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413 ||||| ||||||| ||||||| ||| | |||||| |||||||||||||||||| | Sbjct: 3160 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 3219 Query: 414 ttcatgatggacatggccttg 434 |||||||| |||||||||||| Sbjct: 3220 ttcatgatagacatggccttg 3240
>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III), histone H2B (ch2b-III) and histone H2A (ch2a-III) genes, complete cds Length = 4582 Score = 176 bits (89), Expect = 4e-41 Identities = 173/201 (86%) Strand = Plus / Plus Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293 |||||||||||||| ||||||||||||||||| || || ||||||||||| ||||| || Sbjct: 2338 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 2397 Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353 || || || ||||| || | ||||||||||||||||||||| | |||||||||||||||| Sbjct: 2398 ggcagcaccaggcgcaccgcggtctggatctcgcgggaggtcacggtgggcttcttgttg 2457 Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413 ||||| ||||||| |||||| ||| | |||||| |||||||||||||||||| | Sbjct: 2458 tagcggctcagcttggaggcctcagtggccaccttctcaaagatgtcgttgatgaagctg 2517 Query: 414 ttcatgatggacatggccttg 434 ||||||||||||||||||||| Sbjct: 2518 ttcatgatggacatggccttg 2538
>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II), histone H2B (ch2b-II) and histone H2A (ch2a-II) genes, complete cds Length = 3777 Score = 176 bits (89), Expect = 4e-41 Identities = 173/201 (86%) Strand = Plus / Plus Query: 234 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 293 |||||||||||||| ||||||||||||||||| || || |||||||| || ||||| || Sbjct: 2456 gaggtgaacttggtcacggccttggtgccctctgacaccgcgtgcttagccagctcaccg 2515 Query: 294 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 353 || || || ||||| |||| ||||||||||||||| ||||| | |||||||||||||||| Sbjct: 2516 ggcagcaccaggcgcacggcggtctggatctcgcgagaggtcacggtgggcttcttgttg 2575 Query: 354 tagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 413 ||||| ||||||| ||||||| ||| | |||||| |||||||||||||||||| | Sbjct: 2576 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 2635 Query: 414 ttcatgatggacatggccttg 434 ||||||||||||||||||||| Sbjct: 2636 ttcatgatggacatggccttg 2656
>ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B histone family, member F (LOC483173), mRNA Length = 2193 Score = 147 bits (74), Expect = 4e-32 Identities = 173/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| |||||||||||||||| ||||||||| Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 266 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 265 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 206 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 205 catgatgcccatggccttggacgaga 180
>ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC483164), mRNA Length = 659 Score = 147 bits (74), Expect = 4e-32 Identities = 173/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 333 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| |||||||||||||||| ||||||||| Sbjct: 332 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 273 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 272 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 213 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 212 catgatgcccatggccttggacgaga 187
>ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 1 (LOC483169), mRNA Length = 432 Score = 147 bits (74), Expect = 4e-32 Identities = 173/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 379 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 320 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| |||||||||||||||| ||||||||| Sbjct: 319 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 260 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 259 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 200 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 199 catgatgcccatggccttggacgaga 174
>ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 2 (LOC483169), mRNA Length = 516 Score = 147 bits (74), Expect = 4e-32 Identities = 173/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| |||||||||||||||| ||||||||| Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 298 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 297 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 238 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 237 catgatgcccatggccttggacgaga 212
>ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 5 (LOC483170), mRNA Length = 415 Score = 147 bits (74), Expect = 4e-32 Identities = 173/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| |||||||||||||||| ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 249 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 4 (LOC483170), mRNA Length = 597 Score = 147 bits (74), Expect = 4e-32 Identities = 173/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| |||||||||||||||| ||||||||| Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 298 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 297 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 238 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 237 catgatgcccatggccttggacgaga 212
>ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260), mRNA Length = 753 Score = 139 bits (70), Expect = 9e-30 Identities = 172/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 384 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 325 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| |||||||||||||||||||||||||||| ||||||||| Sbjct: 324 cagcagcaggcgcacggccgtctggatctcgcgggaggtgatggtggagcgcttgttgta 265 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 264 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 205 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 204 catgatgcccatggccttggacgaga 179
>ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG11626.1) partial mRNA Length = 414 Score = 139 bits (70), Expect = 9e-30 Identities = 160/190 (84%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 ||||||| ||||||||||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 394 acttggtaacggccttggtaccctcggagacggcgtgcttggcaagctcaccggggagga 335 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||||||| |||||||| ||||| ||||| | |||||||| ||||||||||||| | Sbjct: 334 tgaggcggacagaggtctgaatctctcgggaagagatggtggacttcttgttgtaggcgg 275 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | ||||||| ||||| |||| |||||| |||||||||| ||| ||||||| || Sbjct: 274 caagcttggaagcctcagaagcgacacgctcgaaaatgtcgttgacgaaagagttcagga 215 Query: 421 tggacatggc 430 |||||||||| Sbjct: 214 tggacatggc 205
>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds Length = 2132 Score = 137 bits (69), Expect = 3e-29 Identities = 165/197 (83%) Strand = Plus / Minus Query: 237 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccaggg 296 |||||||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 1583 gtgaacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgcccgga 1524 Query: 297 aggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356 || || ||||| || | ||||| || ||||| || || | ||||||||||||||||||| Sbjct: 1523 agaaccaggcgcacagcagtctgaatttcgcgcgacgtcacggtgggcttcttgttgtag 1464 Query: 357 cgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 416 || ||||||| ||||||| ||| | |||||| |||||||||||||||||| |||| Sbjct: 1463 cggctcagcttggaggcctcggtggcaaccttctcaaagatgtcgttgatgaagctgttc 1404 Query: 417 atgatggacatggcctt 433 || || ||||||||||| Sbjct: 1403 ataatcgacatggcctt 1387
>ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus similar to testis-specific histone 2b (LOC589998), mRNA Length = 372 Score = 135 bits (68), Expect = 1e-28 Identities = 170/204 (83%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 |||| |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| Sbjct: 365 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctct 306 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||| ||| ||||| | |||||||||||| ||| | ||||||||| ||||||| Sbjct: 305 ccggggaggaggagacggacagcggtctggatctctcggctgctgatggtggccttcttg 246 Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410 ||||||| || || || ||||| ||||||| |||||||| ||||||| |||| Sbjct: 245 ttgtagcctgcaaggcgggaagcctcaccggcgatacgctcgaagacatcgttgacgaag 186 Query: 411 gagttcatgatggacatggccttg 434 |||||||||||||||||||||| Sbjct: 185 ctgttcatgatggacatggccttg 162
>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3 and H4 Length = 8592 Score = 133 bits (67), Expect = 5e-28 Identities = 97/107 (90%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 2063 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 2004 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 | || |||||||| | |||||||||||| |||||||||||||||| Sbjct: 2003 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 1957 Score = 44.1 bits (22), Expect = 0.38 Identities = 31/34 (91%) Strand = Plus / Minus Query: 408 aaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||| |||||||||||| |||| Sbjct: 1891 aaggagttcatgatgctcatggccttggaagaga 1858
>gb|BC077399.1| Xenopus laevis histone H2B, mRNA (cDNA clone MGC:81709 IMAGE:6865010), complete cds Length = 1379 Score = 133 bits (67), Expect = 5e-28 Identities = 97/107 (90%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 333 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 | || |||||||| | |||||||||||| |||||||||||||||| Sbjct: 332 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 286 Score = 44.1 bits (22), Expect = 0.38 Identities = 31/34 (91%) Strand = Plus / Minus Query: 408 aaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||| |||||||||||| |||| Sbjct: 220 aaggagttcatgatgctcatggccttggaagaga 187
>gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial cds Length = 478 Score = 133 bits (67), Expect = 5e-28 Identities = 166/199 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 ||||||||| || ||||||||||| || || || || ||||||||||||||||| ||||| Sbjct: 274 ggtgaacttagtcacggccttggtcccttccgaaacagcgtgcttggcgagctcaccagg 215 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 ||| ||||| | |||||||||||||| || ||||| ||||| || || ||||||||||| Sbjct: 214 gagcacgagcctcacggaggtctggatttcccgggaagtgatcgtcggtttcttgttgta 155 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | ||||||| ||| | ||| ||||||||||||||| ||||||||||||||| ||| Sbjct: 154 cctcgcgagcctggacgactcctgggcgagcttctcgaaaatgtcgttgatgaagctgtt 95 Query: 416 catgatggacatggccttg 434 |||||| |||||||||| Sbjct: 94 catgattcccatggccttg 76
>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and histone H3 gene, 3' end, gene cluster X1h3 Length = 8608 Score = 133 bits (67), Expect = 5e-28 Identities = 97/107 (90%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 2073 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 2014 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 | || |||||||| | |||||||||||| |||||||||||||||| Sbjct: 2013 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 1967 Score = 44.1 bits (22), Expect = 0.38 Identities = 31/34 (91%) Strand = Plus / Minus Query: 408 aaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||| |||||||||||| |||| Sbjct: 1901 aaggagttcatgatgctcatggccttggaagaga 1868
>gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129733 IMAGE:40014260), complete cds Length = 459 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 311 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 310 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 251 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 250 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 191 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 190 catgatgcccatggccttggacgaga 165
>gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129734 IMAGE:40014264), complete cds Length = 459 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 311 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 310 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 251 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 250 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 191 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 190 catgatgcccatggccttggacgaga 165
>gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:78419 IMAGE:3936695), complete cds Length = 2224 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 393 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 334 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 333 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 274 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 273 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 214 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 213 catgatgcccatggccttggacgaga 188
>gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IMAGE:2989788), with apparent retained intron Length = 2210 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 381 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 322 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 321 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 262 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 261 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 202 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 201 catgatgcccatggccttggacgaga 176
>ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA Length = 2223 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 352 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 351 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 292 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 291 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 232 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 231 catgatgcccatggccttggacgaga 206
>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of IgG, high affinity Ia, receptor for (CD64), a novel gene similar to histone 2, H2be (HIST2H2BE), a novel gene similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for histone 2, H4, the HIST2H3C gene for histone 2, H3c, the HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene (HIST2H2BC), a novel gene similar to histone 2, H2aa (HIST2H2AA), a novel gene similar to histone 2, H3c (HIST2H3C), a novel gene similar to histone 1, H4 (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for histone 2, H2ab, a novel protein similar to histone 2, a novel gene, the SV2A gene for synaptic vesicle glycoprotein 2A, the 3' end of the SF3B4 gene for splicing factor 3b, subunit 4, 49kDa and five CpG islands, complete sequence Length = 188956 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 147982 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 148041 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 148042 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 148101 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 148102 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 148161 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 148162 catgatgcccatggccttggacgaga 148187 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 73670 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 73729 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 73730 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 73789 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 73790 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 73849 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 73850 catgatgcccatggccttggacgaga 73875 Score = 107 bits (54), Expect = 3e-20 Identities = 160/194 (82%), Gaps = 1/194 (0%) Strand = Plus / Plus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 112138 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 112197 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||| |||| ||||||||||| ||||| |||||||||| |||||||||| ||| Sbjct: 112198 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 112256 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | || || ||||| || |||| ||||||||||||||||| |||||||||||||| Sbjct: 112257 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 112316 Query: 421 tggacatggccttg 434 || |||||||||| Sbjct: 112317 tgcccatggccttg 112330 Score = 107 bits (54), Expect = 3e-20 Identities = 160/194 (82%), Gaps = 1/194 (0%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 105128 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 105069 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||| |||| ||||||||||| ||||| |||||||||| |||||||||| ||| Sbjct: 105068 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 105010 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | || || ||||| || |||| ||||||||||||||||| |||||||||||||| Sbjct: 105009 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 104950 Query: 421 tggacatggccttg 434 || |||||||||| Sbjct: 104949 tgcccatggccttg 104936
>emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A Length = 2964 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 869 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 810 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 809 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 750 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 749 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 690 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 689 catgatgcccatggccttggacgaga 664
>emb|CR541895.1| Homo sapiens full open reading frame cDNA clone RZPDo834A0933D for gene HIST2H2BE, histone 2, H2be; complete cds, incl. stopcodon Length = 381 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 249 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:116767 IMAGE:40002353), complete cds Length = 430 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 249 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, complete cds Length = 1137 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 749 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 690 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 689 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 630 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 629 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 570 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 569 catgatgcccatggccttggacgaga 544
>gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870.01X histone 2 H2be (HIST2H2BE) mRNA, complete cds Length = 381 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 249 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119804 IMAGE:40014249), complete cds Length = 456 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 249 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>gb|BC098112.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119802 IMAGE:40014245), complete cds Length = 458 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 249 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA Length = 1858 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 283 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 282 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 223 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 222 catgatgcccatggccttggacgaga 197
>gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MGC:131639 IMAGE:5224812), complete cds Length = 1858 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 283 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 282 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 223 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 222 catgatgcccatggccttggacgaga 197
>gb|M60756.1|HUMHISH2BA Human histone H2B.1 mRNA, 3' end Length = 2100 Score = 131 bits (66), Expect = 2e-27 Identities = 171/206 (83%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 294 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 235 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 234 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 175 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 174 gtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 115 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 114 catgatgcccatggccttggacgaga 89
>emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC DP26B06, DP34F04, DP16D11, DP09G08, DP35C12 of chromosome 5 of Podospora anserina Length = 322194 Score = 127 bits (64), Expect = 3e-26 Identities = 103/116 (88%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||||||||||||||| || || |||||||||||||| ||||| || || |||| Sbjct: 23470 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 23411 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356 |||||| ||||||||||||||||| ||||| | |||||||| ||||||||||||| Sbjct: 23410 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgtag 23355
>emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F04 of chromosome 5 of Podospora anserina Length = 103568 Score = 127 bits (64), Expect = 3e-26 Identities = 103/116 (88%) Strand = Plus / Plus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||||||||||||||| || || |||||||||||||| ||||| || || |||| Sbjct: 81641 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 81700 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356 |||||| ||||||||||||||||| ||||| | |||||||| ||||||||||||| Sbjct: 81701 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgtag 81756
>ref|XM_524860.1| PREDICTED: Pan troglodytes LOC469477 (LOC469477), mRNA Length = 1068 Score = 125 bits (63), Expect = 1e-25 Identities = 172/207 (83%), Gaps = 1/207 (0%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacg-gccttggtgccctcggagacggcgtgcttggcgagctccccag 294 |||| ||||||||||| ||||||||||||||||| |||||||||||||| ||||| || | Sbjct: 370 ggtgtacttggtgacgcgccttggtgccctcggacacggcgtgcttggccagctcgccgg 311 Query: 295 ggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgt 354 | || | ||||| |||| ||||||||||||||||| |||||||||| |||||||| Sbjct: 310 gcagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgt 251 Query: 355 agcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagt 414 || |||| || || ||||| || |||| ||||||||||||||||| |||||||| Sbjct: 250 agtgcgccaggcgggaagcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagt 191 Query: 415 tcatgatggacatggccttggaggaga 441 |||||||| |||||||||||| |||| Sbjct: 190 tcatgatgcccatggccttggacgaga 164
>dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone H2B, complete cds Length = 425 Score = 125 bits (63), Expect = 1e-25 Identities = 96/107 (89%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||| ||||||||||||||||||||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgacggctttggtgccctcggagacggcgtgcttggccagctctccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 || | |||||||||| |||||||||||| |||||||||||||||| Sbjct: 309 cagcagcaggcggacggcggtctggatctcccgggaggtgatggtgg 263 Score = 81.8 bits (41), Expect = 2e-12 Identities = 50/53 (94%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||| |||||||||||||||| ||||||||||||||||| Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgctcatggccttggaggaga 164
>emb|CR855675.2| Xenopus tropicalis finished cDNA, clone TGas058p09 Length = 484 Score = 125 bits (63), Expect = 1e-25 Identities = 96/107 (89%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 375 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctccccagg 316 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 || | |||||||| | |||||||||||| |||||||||||||||| Sbjct: 315 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 269 Score = 46.1 bits (23), Expect = 0.096 Identities = 38/43 (88%) Strand = Plus / Minus Query: 399 tcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||| ||||||||||||||| |||||||||||| |||| Sbjct: 212 tcgttgacaaaggagttcatgatgctcatggccttggaagaga 170
>ref|XM_518301.1| PREDICTED: Pan troglodytes similar to histone H2B (LOC462508), mRNA Length = 1026 Score = 123 bits (62), Expect = 5e-25 Identities = 170/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 461 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 402 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 ||| | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 401 gagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 342 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 341 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 282 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 281 catgatgcccatggccttggacgaga 256
>ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3, H2bb (LOC469701), mRNA Length = 399 Score = 123 bits (62), Expect = 5e-25 Identities = 170/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 387 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccagg 328 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||| | |||||||| |||||||||| ||||||||| Sbjct: 327 cagcagcaggcgcacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 268 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 267 gtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 208 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 207 catgatgcccatggccttggacgaga 182
>emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chromosome 1 Contains four novel genes, a novel gene (MGC57827), a ribosomal protein L22 (RPL22) pseudogene, a histone 2 H3c (HIST2H3C) pseudogene, the HIST2H2BB gene for histone 2 H2bb, the FCGR1B gene for Fc fragment of IgG high affinity Ib receptor for (CD64) and three CpG islands, complete sequence Length = 189539 Score = 123 bits (62), Expect = 5e-25 Identities = 170/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 159255 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 159196 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||||| ||||||||| Sbjct: 159195 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 159136 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 159135 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 159076 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 159075 catgatgcccatggccttggacgaga 159050
>emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N21 on chromosome 1 Contains a ubiquitin-conjugating enzyme HBUCE1 pseudogene, the FCGR1C gene for Fc fragment of IgG high affinity Ic receptor for (CD64), two novel genes, the HIST2H2BA gene for histone 2 H2ba, the gene for a novel protein similar to histone 2 H3c (HIST2H3C), a novel gene, a ribosomal protein L22 (RPL22) pseudogene, a novel gene and three CpG islands, complete sequence Length = 129426 Score = 123 bits (62), Expect = 5e-25 Identities = 170/206 (82%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 68592 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 68651 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 68652 cagcagcaggcgcacggccgtctggatctcgcgggacgtgatggtggagcgcttgttgta 68711 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 68712 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 68771 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||| |||||| |||| Sbjct: 68772 catgatgcccatggtcttggacgaga 68797
>ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudogene on chromosome 1 Length = 1137 Score = 123 bits (62), Expect = 5e-25 Identities = 170/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||||| ||||||||| Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 629 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 628 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 569 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 568 catgatgcccatggccttggacgaga 543
>ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudogene on chromosome 1 Length = 1137 Score = 123 bits (62), Expect = 5e-25 Identities = 170/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||||| ||||||||| Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 629 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 628 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 569 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 568 catgatgcccatggccttggacgaga 543
>gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, complete sequence Length = 1137 Score = 123 bits (62), Expect = 5e-25 Identities = 170/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||||| ||||||||| Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 629 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 628 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 569 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 568 catgatgcccatggccttggacgaga 543
>gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, complete sequence Length = 1137 Score = 123 bits (62), Expect = 5e-25 Identities = 170/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||||| ||||||||| Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 629 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 628 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 569 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 568 catgatgcccatggccttggacgaga 543
>gb|BC106916.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA clone MGC:126031 IMAGE:40032208), complete cds Length = 520 Score = 123 bits (62), Expect = 5e-25 Identities = 170/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 378 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 319 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||||| ||||||||| Sbjct: 318 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 259 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 258 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 199 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 198 catgatgcccatggccttggacgaga 173
>gb|BC073925.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA clone MGC:90432 IMAGE:5190019), complete cds Length = 2221 Score = 123 bits (62), Expect = 5e-25 Identities = 170/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 350 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 291 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 290 cagcagcaggcgcacggccgtctggatctcgcgggacgtgatggtggagcgcttgttgta 231 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||| || |||| ||||||||||||||||| ||||||||| Sbjct: 230 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 171 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||| |||||| |||| Sbjct: 170 catgatgcccatggtcttggacgaga 145
>gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes, complete cds Length = 1442 Score = 123 bits (62), Expect = 5e-25 Identities = 173/210 (82%) Strand = Plus / Minus Query: 228 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287 |||| ||| |||||||||||||| |||||||| |||||||| || ||||||||||| ||| Sbjct: 1273 taagcggacgtgaacttggtgacagccttggttccctcggacacagcgtgcttggccagc 1214 Query: 288 tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347 || || || ||||| ||||| |||| |||||||| ||||| || |||| ||| |||||| Sbjct: 1213 tcgcctggcaggacaaggcgcacggcagtctggatttcgcgagacgtgacggtcggcttc 1154 Query: 348 ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407 |||||||| || ||||| | |||||| ||||| |||||| || |||||||||||| Sbjct: 1153 ttgttgtaacggctaagctttgaagcctcggtggcgaccttctcaaatatgtcgttgatg 1094 Query: 408 aaggagttcatgatggacatggccttggag 437 ||| |||||||||| ||| ||||||||| Sbjct: 1093 aagctgttcatgatgctcatcgccttggag 1064
>gb|BC077692.1| Xenopus tropicalis histone 1, H2bk, mRNA (cDNA clone MGC:89948 IMAGE:7030528), complete cds Length = 540 Score = 117 bits (59), Expect = 3e-23 Identities = 95/107 (88%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||| || ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 409 ggtgtacttggtaacagccttggtgccctcggacacggcgtgcttggccagctccccagg 350 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 || | |||||||| | |||||||||||| |||||||||||||||| Sbjct: 349 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 303 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 399 tcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||| ||||||||||||||| ||||||||||||||||| Sbjct: 246 tcgttgacaaaggagttcatgatgctcatggccttggaggaga 204
>ref|NM_001006890.1| Xenopus tropicalis histone 1, H2bk (hist1h2bk), mRNA Length = 540 Score = 117 bits (59), Expect = 3e-23 Identities = 95/107 (88%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||| || ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 409 ggtgtacttggtaacagccttggtgccctcggacacggcgtgcttggccagctccccagg 350 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 || | |||||||| | |||||||||||| |||||||||||||||| Sbjct: 349 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 303 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 399 tcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||| ||||||||||||||| ||||||||||||||||| Sbjct: 246 tcgttgacaaaggagttcatgatgctcatggccttggaggaga 204
>ref|XM_527280.1| PREDICTED: Pan troglodytes similar to ribosomal protein L24-like; homolog of yeast ribosomal like protein 24; 60S ribosomal protein L30 isolog; my024 protein (LOC471902), mRNA Length = 1131 Score = 115 bits (58), Expect = 1e-22 Identities = 154/186 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| |||||||||||| | |||||||||||| | ||||||||| Sbjct: 309 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||||| ||||| ||||||||||||||||| ||||||||| Sbjct: 249 gtgcgccaggcgggaagcctcgcttgcgaggcgctcgaagatgtcgttgacgaaggagtt 190 Query: 416 catgat 421 |||||| Sbjct: 189 catgat 184
>gb|BC101411.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125414 IMAGE:40021691), complete cds Length = 432 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>gb|BC101413.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125416 IMAGE:40021695), complete cds Length = 431 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>gb|BC101412.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125415 IMAGE:40021693), complete cds Length = 431 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6 Length = 269712 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| || Sbjct: 183927 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 183868 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||||| ||||||||| Sbjct: 183867 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 183808 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||| ||||||| ||||||||| Sbjct: 183807 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 183748 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 183747 catgatgcccatggccttggatgaga 183722 Score = 99.6 bits (50), Expect = 7e-18 Identities = 152/186 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| || Sbjct: 142538 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 142479 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 142478 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 142419 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||||| |||||| || Sbjct: 142418 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 142359 Query: 416 catgat 421 |||||| Sbjct: 142358 catgat 142353 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||| ||||||||||| |||||||||||||| || |||||||| Sbjct: 236019 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 235960 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340 || | ||||| |||| ||||||||||| | |||||||||||| Sbjct: 235959 cagcagcaggcgcacggctgtctggatctccctggaggtgatggt 235915 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || || Sbjct: 107478 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 107537 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340 || | ||||| |||| ||||||||||| | |||||||||||| Sbjct: 107538 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 107582 Score = 83.8 bits (42), Expect = 4e-13 Identities = 150/186 (80%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||| ||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 168164 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 168105 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 168104 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 168045 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| ||||||||||||||||| ||||| || Sbjct: 168044 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 167985 Query: 416 catgat 421 |||||| Sbjct: 167984 catgat 167979 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 292 |||| |||||||||| |||||||||||||| || || ||||| ||||| |||||||| Sbjct: 257344 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctcccc 257288 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||| |||||| |||||||| |||||||||||| |||| Sbjct: 27384 ctcgaagatgtcgttgacgaaggaattcatgatccccatggccttggatgaga 27436 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Plus Query: 390 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||| | |||||| ||||||||| |||||||||||| |||| Sbjct: 200429 tcgaagatgtcgttaacgaaggaattcatgatgcccatggccttggatgaga 200480 Score = 56.0 bits (28), Expect = 1e-04 Identities = 82/100 (82%) Strand = Plus / Plus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| |||||||| || ||||| || ||||||||||| ||||| || || || | Sbjct: 200280 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagca 200339 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggt 340 || || |||| |||||||||||| | |||||| ||||| Sbjct: 200340 gcagacgcacggcggtctggatctccctggaggtaatggt 200379 Score = 48.1 bits (24), Expect = 0.024 Identities = 81/100 (81%) Strand = Plus / Plus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 ||||||| || ||||| ||||||||||| || || ||||| || ||||||||||| || | Sbjct: 27236 acttggtaactgccttagtgccctcggacacagcatgcttagccagctccccaggcagca 27295 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggt 340 ||||| || | ||||| ||||| | |||||||||||| Sbjct: 27296 gcaggcgcacagccgtctgaatctccctggaggtgatggt 27335 Score = 44.1 bits (22), Expect = 0.38 Identities = 28/30 (93%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcat 418 |||||| |||||||||| |||||||||||| Sbjct: 257191 ctcgaaaatgtcgttgacgaaggagttcat 257162
>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6 Length = 91567 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 55422 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 55481 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 55482 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 55541 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 55542 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 55601 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 55602 catgatgcccatggccttggacgaga 55627 Score = 107 bits (54), Expect = 3e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 86914 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 86855 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| |||||||||||| | |||||||||||| | ||||||||| Sbjct: 86854 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 86795 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||||| |||| ||||||||||||||||| ||||||||| Sbjct: 86794 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 86735 Query: 416 catgat 421 |||||| Sbjct: 86734 catgat 86729 Score = 99.6 bits (50), Expect = 7e-18 Identities = 161/198 (81%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| || Sbjct: 621 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 680 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 681 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 740 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||| |||||||| |||| ||||||||| Sbjct: 741 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 800 Query: 416 catgatggacatggcctt 433 ||||||| ||||||||| Sbjct: 801 catgatgcccatggcctt 818 Score = 77.8 bits (39), Expect = 3e-11 Identities = 42/43 (97%) Strand = Plus / Plus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggc 283 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 79045 acttggtgacggccttggtgccctcggacacggcgtgcttggc 79087 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 393 aagatgtcgttgatgaaggagttcatgat 421 ||||||||||||| ||||||||||||||| Sbjct: 79197 aagatgtcgttgacgaaggagttcatgat 79225
>ref|NM_003522.3| Homo sapiens histone 1, H2bf (HIST1H2BF), mRNA Length = 430 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| || Sbjct: 369 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||||| ||||||||| Sbjct: 309 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||| ||||||| ||||||||| Sbjct: 249 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggatgaga 164
>ref|NM_003520.3| Homo sapiens histone 1, H2bn (HIST1H2BN), mRNA Length = 449 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>gb|BC011372.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone IMAGE:3871305), with apparent retained intron Length = 2200 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 430 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 371 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 370 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 311 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 310 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 251 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 250 catgatgcccatggccttggacgaga 225
>gb|AF531297.1| Homo sapiens histone H2B (HIST1H2BN) gene, complete cds Length = 1137 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 749 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 690 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 689 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 630 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 629 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 570 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 569 catgatgcccatggccttggacgaga 544
>gb|AF531289.1| Homo sapiens histone H2B (HIST1H2BF) gene, complete cds Length = 1137 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| || Sbjct: 749 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 690 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||||| ||||||||| Sbjct: 689 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 630 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||| ||||||| ||||||||| Sbjct: 629 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 570 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 569 catgatgcccatggccttggatgaga 544
>gb|BC009783.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:13513 IMAGE:4132165), complete cds Length = 744 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 491 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 432 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 431 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 372 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 371 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 312 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 311 catgatgcccatggccttggacgaga 286
>gb|BC056264.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IMAGE:6668499), partial cds Length = 1219 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| || Sbjct: 412 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 353 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||||| ||||||||| Sbjct: 352 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 293 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||| ||||||| ||||||||| Sbjct: 292 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 233 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 232 catgatgcccatggccttggatgaga 207
>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3 Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ, H2AFN, and H2BFN histone genes, the OR2B2 gene for olfactory receptor 2B2, histone H2B family member I pseudogene H2BFIP, a hypothetical protein pseudogene, ESTs, STSs, GSSs and CpG islands, complete sequence Length = 100374 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 2771 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 2712 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 2711 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 2652 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 2651 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 2592 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 2591 catgatgcccatggccttggacgaga 2566 Score = 99.6 bits (50), Expect = 7e-18 Identities = 161/198 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| || Sbjct: 57572 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 57513 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 57512 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 57453 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||| |||||||| |||| ||||||||| Sbjct: 57452 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 57393 Query: 416 catgatggacatggcctt 433 ||||||| ||||||||| Sbjct: 57392 catgatgcccatggcctt 57375
>emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 on chromosome 6p21.31-22.2 Contains seventeen histone (pseudo)genes and gene RPS10P1 (40S Ribosomal protein S10 pseudogene 1), three CpG islands, ESTs, STSs and GSSs, complete sequence Length = 89301 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| || Sbjct: 5309 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 5250 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||||| ||||||||| Sbjct: 5249 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 5190 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||| ||||||| ||||||||| Sbjct: 5189 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 5130 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 5129 catgatgcccatggccttggatgaga 5104 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||| ||||||||||| |||||||||||||| || |||||||| Sbjct: 57401 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 57342 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340 || | ||||| |||| ||||||||||| | |||||||||||| Sbjct: 57341 cagcagcaggcgcacggctgtctggatctccctggaggtgatggt 57297 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 292 |||| |||||||||| |||||||||||||| || || ||||| ||||| |||||||| Sbjct: 78726 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctcccc 78670 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Plus Query: 390 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||| | |||||| ||||||||| |||||||||||| |||| Sbjct: 21811 tcgaagatgtcgttaacgaaggaattcatgatgcccatggccttggatgaga 21862 Score = 56.0 bits (28), Expect = 1e-04 Identities = 82/100 (82%) Strand = Plus / Plus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| |||||||| || ||||| || ||||||||||| ||||| || || || | Sbjct: 21662 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagca 21721 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggt 340 || || |||| |||||||||||| | |||||| ||||| Sbjct: 21722 gcagacgcacggcggtctggatctccctggaggtaatggt 21761 Score = 44.1 bits (22), Expect = 0.38 Identities = 28/30 (93%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcat 418 |||||| |||||||||| |||||||||||| Sbjct: 78573 ctcgaaaatgtcgttgacgaaggagttcat 78544
>emb|Z83336.1|HSZ83336 H.sapiens hH2B/d gene Length = 701 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 599 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 540 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 539 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 480 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 479 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 420 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 419 catgatgcccatggccttggacgaga 394
>gb|BC096123.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MGC:116769 IMAGE:40002357), complete cds Length = 430 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| || Sbjct: 369 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||||| ||||||||| Sbjct: 309 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||| ||||||| ||||||||| Sbjct: 249 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggatgaga 164
>gb|BC096120.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MGC:116766 IMAGE:40002352), complete cds Length = 430 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| || Sbjct: 369 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||||| ||||||||| Sbjct: 309 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||| ||||||| ||||||||| Sbjct: 249 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggatgaga 164
>dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501 Length = 1723 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 1271 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 1212 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 1211 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 1152 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 1151 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 1092 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 1091 catgatgcccatggccttggacgaga 1066
>emb|Z80779.1|HSH2BG H.sapiens H2B/g gene Length = 1020 Score = 115 bits (58), Expect = 1e-22 Identities = 169/206 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| || Sbjct: 566 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 507 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||||| ||||||||| Sbjct: 506 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 447 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||| ||||||| ||||||||| Sbjct: 446 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 387 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 386 catgatgcccatggccttggatgaga 361
>ref|XM_782648.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B (LOC582704), mRNA Length = 372 Score = 113 bits (57), Expect = 5e-22 Identities = 108/125 (86%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 |||| |||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| Sbjct: 365 gaggtggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctct 306 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||| ||| ||||| | |||||||||||| ||| | ||||||||| ||||||| Sbjct: 305 ccggggaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttg 246 Query: 351 ttgta 355 ||||| Sbjct: 245 ttgta 241 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 434 |||||||| ||||||| |||| |||||||||||||||||||||| Sbjct: 207 ctcgaagacatcgttgacgaagctgttcatgatggacatggccttg 162
>ref|XM_785670.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B (LOC585864), mRNA Length = 372 Score = 113 bits (57), Expect = 5e-22 Identities = 108/125 (86%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 |||| |||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| Sbjct: 365 gaggtggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctct 306 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||| ||| ||||| | |||||||||||| ||| | ||||||||| ||||||| Sbjct: 305 ccggggaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttg 246 Query: 351 ttgta 355 ||||| Sbjct: 245 ttgta 241 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 434 |||||||| ||||||| |||| |||||||||||||||||||||| Sbjct: 207 ctcgaagacatcgttgacgaagctgttcatgatggacatggccttg 162
>ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B (LOC587419), mRNA Length = 372 Score = 111 bits (56), Expect = 2e-21 Identities = 155/188 (82%) Strand = Plus / Minus Query: 243 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacg 302 ||||||||||||||||||||||| ||||||||||||||||| ||||| || ||||||| | Sbjct: 353 ttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggggaggagg 294 Query: 303 aggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcg 362 || | ||| | |||||||| ||| ||| ||||||||| | ||||||||||||| | || Sbjct: 293 agtctgacagcggtctggacctcacggctggtgatggtagacttcttgttgtagtgggca 234 Query: 363 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 422 || || |||||| |||||| |||||||| ||||||| |||| |||||||||| Sbjct: 233 agacgggaagcctcggcggcgatgcgctcgaagacatcgttgacgaagctgttcatgatg 174 Query: 423 gacatggc 430 |||||||| Sbjct: 173 gacatggc 166
>gb|M14142.1|SUPH2B1 P.miliaris histone H2B-2.1 gene, complete cds Length = 375 Score = 111 bits (56), Expect = 2e-21 Identities = 164/200 (82%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 |||| |||| ||||||||||||||||||||||||| |||||||||||||||||||| || Sbjct: 368 gaggtggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggcgagttca 309 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||| || | ||| | |||||||| ||| ||| | ||||||||| ||||||| Sbjct: 308 ccggggaggagaagtctgacagcggtctggacctcacggctgctgatggtggacttcttg 249 Query: 351 ttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 410 |||||| | || || || ||||| ||||||| |||||||| ||||||| |||| Sbjct: 248 ttgtagtgggcaagacgggaagcctcaccggcgatgcgctcgaagacatcgttgacgaag 189 Query: 411 gagttcatgatggacatggc 430 |||||||||||||||||| Sbjct: 188 ctgttcatgatggacatggc 169
>emb|X14731.1|CMHIST2B Duck H2B histone gene Length = 1179 Score = 109 bits (55), Expect = 8e-21 Identities = 171/207 (82%), Gaps = 2/207 (0%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||||||||||||||||||||| ||||| || || Sbjct: 1042 ggtgtacttggtgaccgccttggtgccctcggagacggcgtgcttggccagctcgccggg 983 Query: 296 gagga-cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgt 354 || | ||| || |||| ||||||||||| || ||||||||||| | |||||||| Sbjct: 982 cagcagcga-ccgcacggccgtctggatctcccgcgaggtgatggtcgagcgcttgttgt 924 Query: 355 agcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagt 414 || |||| || | ||||||||||||| ||||||||||||||||| |||||||| Sbjct: 923 agtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaaggagt 864 Query: 415 tcatgatggacatggccttggaggaga 441 |||||||| |||||||||||| |||| Sbjct: 863 tcatgatgcccatggccttggacgaga 837
>gb|BC095697.1| Danio rerio zgc:112234, mRNA (cDNA clone MGC:112234 IMAGE:7223605), complete cds Length = 1265 Score = 109 bits (55), Expect = 8e-21 Identities = 163/199 (81%) Strand = Plus / Minus Query: 243 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacg 302 ||||||||||||||||| |||||||| |||||||| ||||| ||||| || || || | Sbjct: 388 ttggtgacggccttggtaccctcggacacggcgtgtttggccagctctccgggcagcagc 329 Query: 303 aggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcg 362 || || |||| |||||||||||| | |||||||||||||| |||||||||| | ||| Sbjct: 328 agccgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtgggcg 269 Query: 363 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 422 || | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 268 agacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 209 Query: 423 gacatggccttggaggaga 441 ||||||||||||||||| Sbjct: 208 cccatggccttggaggaga 190
>ref|NM_001024398.1| Danio rerio zgc:112234 (zgc:112234), mRNA Length = 1265 Score = 109 bits (55), Expect = 8e-21 Identities = 163/199 (81%) Strand = Plus / Minus Query: 243 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacg 302 ||||||||||||||||| |||||||| |||||||| ||||| ||||| || || || | Sbjct: 388 ttggtgacggccttggtaccctcggacacggcgtgtttggccagctctccgggcagcagc 329 Query: 303 aggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcg 362 || || |||| |||||||||||| | |||||||||||||| |||||||||| | ||| Sbjct: 328 agccgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtgggcg 269 Query: 363 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 422 || | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 268 agacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 209 Query: 423 gacatggccttggaggaga 441 ||||||||||||||||| Sbjct: 208 cccatggccttggaggaga 190
>gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partial cds Length = 397 Score = 109 bits (55), Expect = 8e-21 Identities = 55/55 (100%) Strand = Plus / Minus Query: 387 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 381 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 327
>gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partial cds Length = 402 Score = 109 bits (55), Expect = 8e-21 Identities = 55/55 (100%) Strand = Plus / Minus Query: 387 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 386 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 332
>gb|U93853.1|ECU93853 Euplotes crassus histone H2B (H2B(2)) gene, complete cds Length = 1522 Score = 109 bits (55), Expect = 8e-21 Identities = 160/195 (82%) Strand = Plus / Minus Query: 228 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 287 |||||||||||| |||||||||| |||||||| ||||| |||||||| ||||||||||| Sbjct: 1170 taagaggaggtgtacttggtgacagccttggttccctcagagacggcatgcttggcgagt 1111 Query: 288 tccccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttc 347 || || ||||| | ||| | ||||| |||||||| ||| | ||| | || ||| ||||| Sbjct: 1110 tctcctgggagtaagagtctgacggcggtctggacctctctggatgagagagtgtgcttc 1051 Query: 348 ttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 407 |||||||| | | ||||||| || || |||| |||||| ||||||||||||||| Sbjct: 1050 ttgttgtatctgacaagcttggaagcttccaaagcgatcttctcaaagatgtcgttgatg 991 Query: 408 aaggagttcatgatg 422 ||||||||||||||| Sbjct: 990 aaggagttcatgatg 976
>ref|XM_525086.1| PREDICTED: Pan troglodytes similar to Histone H2B F (H2B 291A) (LOC469702), mRNA Length = 381 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||| |||| |||||| |||||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgacagccttagtgcgctcggacacggcgtgcttggccagctcgccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||| || |||||||| |||||||||| ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctgcatttcgcgggacgtgatggtggagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 249 gtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>ref|NM_023422.2| Mus musculus histone 1, H2bc (Hist1h2bc), mRNA Length = 730 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 404 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 345 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 344 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 285 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 284 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 225 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 224 catgatgcccatggccttggaggaga 199
>gb|AY656810.1| Homo sapiens H2B/t variant gene, complete cds Length = 1874 Score = 107 bits (54), Expect = 3e-20 Identities = 160/194 (82%), Gaps = 1/194 (0%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 743 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 684 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||| |||| ||||||||||| ||||| |||||||||| |||||||||| ||| Sbjct: 683 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 625 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | || || ||||| || |||| ||||||||||||||||| |||||||||||||| Sbjct: 624 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 565 Query: 421 tggacatggccttg 434 || |||||||||| Sbjct: 564 tgcccatggccttg 551
>gb|AY648853.1| Homo sapiens histone H2B/s (HIST2H2BD) gene, complete cds Length = 1861 Score = 107 bits (54), Expect = 3e-20 Identities = 160/194 (82%), Gaps = 1/194 (0%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 743 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 684 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||| |||| ||||||||||| ||||| |||||||||| |||||||||| ||| Sbjct: 683 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 625 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | || || ||||| || |||| ||||||||||||||||| |||||||||||||| Sbjct: 624 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 565 Query: 421 tggacatggccttg 434 || |||||||||| Sbjct: 564 tgcccatggccttg 551
>gb|BC082774.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone IMAGE:6529537) Length = 727 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 385 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 326 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 266 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 265 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 206 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 205 catgatgcccatggccttggaggaga 180
>gb|BC071638.1| Homo sapiens cDNA clone IMAGE:4390105, containing frame-shift errors Length = 618 Score = 107 bits (54), Expect = 3e-20 Identities = 160/194 (82%), Gaps = 1/194 (0%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 414 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 355 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||| |||| ||||||||||| ||||| |||||||||| |||||||||| ||| Sbjct: 354 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 296 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | || || ||||| || |||| ||||||||||||||||| |||||||||||||| Sbjct: 295 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 236 Query: 421 tggacatggccttg 434 || |||||||||| Sbjct: 235 tgcccatggccttg 222
>ref|NM_175055.2| Homo sapiens histone 3, H2bb (HIST3H2BB), mRNA Length = 452 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 392 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 333 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||| | |||||||| |||||||||| ||||||||| Sbjct: 332 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 273 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | | || || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 272 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 213 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 212 catgatgcccatggccttggacgaga 187
>ref|NM_003519.3| Homo sapiens histone 1, H2bl (HIST1H2BL), mRNA Length = 453 Score = 107 bits (54), Expect = 3e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 394 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 335 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| |||||||||||| | |||||||||||| | ||||||||| Sbjct: 334 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 275 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||||| |||| ||||||||||||||||| ||||||||| Sbjct: 274 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 215 Query: 416 catgat 421 |||||| Sbjct: 214 catgat 209
>gb|BC068044.1| Homo sapiens cDNA clone IMAGE:6380649, containing frame-shift errors Length = 687 Score = 107 bits (54), Expect = 3e-20 Identities = 160/194 (82%), Gaps = 1/194 (0%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 428 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 369 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||| |||| ||||||||||| ||||| |||||||||| |||||||||| ||| Sbjct: 368 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 310 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | || || ||||| || |||| ||||||||||||||||| |||||||||||||| Sbjct: 309 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 250 Query: 421 tggacatggccttg 434 || |||||||||| Sbjct: 249 tgcccatggccttg 236
>gb|AF531295.1| Homo sapiens histone H2B (HIST1H2BL) gene, complete cds Length = 1137 Score = 107 bits (54), Expect = 3e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 748 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 689 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| |||||||||||| | |||||||||||| | ||||||||| Sbjct: 688 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 629 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||||| |||| ||||||||||||||||| ||||||||| Sbjct: 628 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 569 Query: 416 catgat 421 |||||| Sbjct: 568 catgat 563
>gb|BC100857.1| Homo sapiens cDNA clone IMAGE:40002416, partial cds Length = 435 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 391 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 332 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||| | |||||||| |||||||||| ||||||||| Sbjct: 331 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 272 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | | || || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 271 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 212 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 211 catgatgcccatggccttggacgaga 186
>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3, complete sequence Length = 151563 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 99867 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 99926 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||| | |||||||| |||||||||| ||||||||| Sbjct: 99927 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 99986 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | | || || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 99987 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 100046 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 100047 catgatgcccatggccttggacgaga 100072 Score = 93.7 bits (47), Expect = 5e-16 Identities = 168/207 (81%), Gaps = 1/207 (0%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||| ||||||||||| |||||||||||||| ||||| || || Sbjct: 94140 ggtgtacttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 94081 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg-ttgt 354 || | ||||| |||| ||||| | |||||||| |||||||||| |||| |||| Sbjct: 94080 cagcagcaggcgcacggccgtctgcacttcgcgggacgtgatggtggagcgcttgtttgt 94021 Query: 355 agcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagt 414 || |||| || || |||||||| ||||| |||||||||||| |||| |||||||| Sbjct: 94020 agtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagt 93961 Query: 415 tcatgatggacatggccttggaggaga 441 |||||||| |||||||||||| |||| Sbjct: 93960 tcatgatgcccatggccttggacgaga 93934
>emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 on chromosome 6p21.3-22.2 Contains a novel pseudogene, a 60S Ribosomal protein L30 (RPL30) pseudogene, H4 histone family member F pseudogene H4FFP and histone genes H2BFC, H2AFC, H3FK. Contains ESTs, STSs, GSSs and two CpG islands, complete sequence Length = 139904 Score = 107 bits (54), Expect = 3e-20 Identities = 153/186 (82%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 135689 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 135748 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| |||||||||||| | |||||||||||| | ||||||||| Sbjct: 135749 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 135808 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||||| |||| ||||||||||||||||| ||||||||| Sbjct: 135809 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 135868 Query: 416 catgat 421 |||||| Sbjct: 135869 catgat 135874
>emb|Z83740.1|HSZ83740 H.sapiens hH2B/c gene Length = 740 Score = 107 bits (54), Expect = 3e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 584 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 525 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| |||||||||||| | |||||||||||| | ||||||||| Sbjct: 524 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 465 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||||| |||| ||||||||||||||||| ||||||||| Sbjct: 464 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 405 Query: 416 catgat 421 |||||| Sbjct: 404 catgat 399
>emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone gene L1 H2b Length = 1497 Score = 107 bits (54), Expect = 3e-20 Identities = 108/126 (85%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 |||| |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| Sbjct: 1357 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctct 1298 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||| ||| | |||| |||||||| ||| || ||||||||||| ||||||| Sbjct: 1297 ccggggaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttcttg 1238 Query: 351 ttgtag 356 |||||| Sbjct: 1237 ttgtag 1232
>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a novel gene, the genes for three H1, four H2a, five H2b, four H3 and four H4 histone family members, the 3' end of a variant of the Hfe gene for hemochromatosis protein (Mr2) and ten CpG islands, complete sequence Length = 184730 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 165015 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 164956 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 164955 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 164896 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 164895 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 164836 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 164835 catgatgcccatggccttggaggaga 164810 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 66003 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 66062 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 66063 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 66122 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 66123 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 66182 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 66183 catgatgcccatggccttggaggaga 66208 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||| ||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 52407 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 52348 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 52347 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 52288 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 52287 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 52228 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 52227 catgatgcccatggccttggaggaga 52202 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 23586 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 23645 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 23646 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 23705 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 23706 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 23765 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||| |||||||||| Sbjct: 23766 catgatgcccatggctttggaggaga 23791 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 54428 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 54487 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340 || | ||||| |||| ||||||||||| ||||| |||||||| Sbjct: 54488 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 54532 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||| | || |||||||||||| ||||||||||||||||| Sbjct: 54581 ctcgaagatgtcgttcacaaacgagttcatgatgcccatggccttggaggaga 54633
>dbj|AK091220.1| Homo sapiens cDNA FLJ33901 fis, clone CTONG2008321, highly similar to HISTONE H2B F Length = 2359 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 392 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 333 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||| | |||||||| |||||||||| ||||||||| Sbjct: 332 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 273 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | | || || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 272 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 213 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 212 catgatgcccatggccttggacgaga 187
>ref|XM_936779.1| PREDICTED: Homo sapiens similar to H2B histone family, member F (LOC647719), mRNA Length = 703 Score = 107 bits (54), Expect = 3e-20 Identities = 160/194 (82%), Gaps = 1/194 (0%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 484 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 425 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||| |||| ||||||||||| ||||| |||||||||| |||||||||| ||| Sbjct: 424 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 366 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | || || ||||| || |||| ||||||||||||||||| |||||||||||||| Sbjct: 365 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 306 Query: 421 tggacatggccttg 434 || |||||||||| Sbjct: 305 tgcccatggccttg 292
>dbj|AB168579.1| Macaca fascicularis testis cDNA clone: QtsA-13175, similar to human histone 1, H2bd (HIST1H2BD), transcript variant 2,mRNA, RefSeq: NM_138720.1 Length = 760 Score = 107 bits (54), Expect = 3e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| || Sbjct: 415 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 356 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | ||| |||||||| | ||||||||| Sbjct: 355 aagcagcaggcgcacggccgtctggatctccctggaagtgatggtcgagcgcttgttgta 296 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||||||||||| ||||||||||||||||| |||||| || Sbjct: 295 gtgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacgaaggaatt 236 Query: 416 catgat 421 |||||| Sbjct: 235 catgat 230
>dbj|AK005191.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500010J12 product:histone 1, H2bc, full insert sequence Length = 724 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 398 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 339 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 338 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 279 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 278 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 219 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 218 catgatgcccatggccttggaggaga 193
>dbj|AK005407.1| Mus musculus adult female placenta cDNA, RIKEN full-length enriched library, clone:1600009N02 product:H2B histone family, member S, full insert sequence Length = 723 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 397 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 338 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 337 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 278 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 277 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 218 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 217 catgatgcccatggccttggaggaga 192
>ref|NG_002619.1| Homo sapiens histone 2, H2bc (HIST2H2BC) pseudogene on chromosome 1 Length = 1134 Score = 107 bits (54), Expect = 3e-20 Identities = 160/194 (82%), Gaps = 1/194 (0%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 742 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 683 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||| |||| ||||||||||| ||||| |||||||||| |||||||||| ||| Sbjct: 682 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 624 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | || || ||||| || |||| ||||||||||||||||| |||||||||||||| Sbjct: 623 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 564 Query: 421 tggacatggccttg 434 || |||||||||| Sbjct: 563 tgcccatggccttg 550
>ref|NG_002620.1| Homo sapiens histone 2, H2bd (HIST2H2BD) pseudogene on chromosome 1 Length = 1134 Score = 107 bits (54), Expect = 3e-20 Identities = 160/194 (82%), Gaps = 1/194 (0%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 741 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 682 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||| |||| ||||||||||| ||||| |||||||||| |||||||||| ||| Sbjct: 681 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 623 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | || || ||||| || |||| ||||||||||||||||| |||||||||||||| Sbjct: 622 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 563 Query: 421 tggacatggccttg 434 || |||||||||| Sbjct: 562 tgcccatggccttg 549
>dbj|AK011516.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610022J01 product:H2B histone family, member S, full insert sequence Length = 730 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 404 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 345 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 344 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 285 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 284 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 225 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 224 catgatgcccatggccttggaggaga 199
>gb|BC093761.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MGC:120796 IMAGE:7939606), complete cds Length = 554 Score = 107 bits (54), Expect = 3e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 450 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 391 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| |||||||||||| | |||||||||||| | ||||||||| Sbjct: 390 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 331 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||||| |||| ||||||||||||||||| ||||||||| Sbjct: 330 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 271 Query: 416 catgat 421 |||||| Sbjct: 270 catgat 265
>gb|BC093759.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MGC:120794 IMAGE:7939604), complete cds Length = 555 Score = 107 bits (54), Expect = 3e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 451 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 392 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| |||||||||||| | |||||||||||| | ||||||||| Sbjct: 391 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 332 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || || ||||||| |||| ||||||||||||||||| ||||||||| Sbjct: 331 gtgcgccaggcgggaagcctcgcttgcgatgcgctcgaagatgtcgttgacgaaggagtt 272 Query: 416 catgat 421 |||||| Sbjct: 271 catgat 266
>gb|AY131977.1| Homo sapiens histone H2B (HIST2H2BC) pseudogene, complete sequence Length = 1134 Score = 107 bits (54), Expect = 3e-20 Identities = 160/194 (82%), Gaps = 1/194 (0%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 742 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 683 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||| |||| ||||||||||| ||||| |||||||||| |||||||||| ||| Sbjct: 682 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 624 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | || || ||||| || |||| ||||||||||||||||| |||||||||||||| Sbjct: 623 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 564 Query: 421 tggacatggccttg 434 || |||||||||| Sbjct: 563 tgcccatggccttg 550
>gb|AY131978.1| Homo sapiens histone H2B (HIST2H2BD) pseudogene, complete sequence Length = 1134 Score = 107 bits (54), Expect = 3e-20 Identities = 160/194 (82%), Gaps = 1/194 (0%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 741 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 682 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||| |||| ||||||||||| ||||| |||||||||| |||||||||| ||| Sbjct: 681 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 623 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | || || ||||| || |||| ||||||||||||||||| |||||||||||||| Sbjct: 622 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 563 Query: 421 tggacatggccttg 434 || |||||||||| Sbjct: 562 tgcccatggccttg 549
>gb|AY131981.1| Homo sapiens histone H2B (HIST3H2BB) gene, complete cds Length = 1137 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 748 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 689 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||| | |||||||| |||||||||| ||||||||| Sbjct: 688 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 629 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | | || || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 628 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 569 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 568 catgatgcccatggccttggacgaga 543
>gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, complete cds Length = 1401 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 952 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 893 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 892 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 833 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 832 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 773 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 772 catgatgcccatggccttggaggaga 747
>gb|AY158907.1| Mus musculus histone protein Hist1h1e gene, complete cds Length = 1381 Score = 107 bits (54), Expect = 3e-20 Identities = 168/206 (81%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 515 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 574 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 575 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 634 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 635 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 694 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 695 catgatgcccatggccttggaggaga 720
>ref|NM_214552.1| Strongylocentrotus purpuratus late histone L1 H2b (LOC373347), mRNA Length = 372 Score = 107 bits (54), Expect = 3e-20 Identities = 108/126 (85%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 |||| |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| Sbjct: 365 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctct 306 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||| ||| | |||| |||||||| ||| || ||||||||||| ||||||| Sbjct: 305 ccggggaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttcttg 246 Query: 351 ttgtag 356 |||||| Sbjct: 245 ttgtag 240
>ref|XM_786200.1| PREDICTED: Strongylocentrotus purpuratus similar to H2B histone family, member F (LOC586416), mRNA Length = 471 Score = 105 bits (53), Expect = 1e-19 Identities = 107/125 (85%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 |||| |||| |||||||||| |||||||||||||| |||||||||||||||||||| || Sbjct: 368 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttct 309 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||| ||| | ||| | |||||||| ||| ||| | ||||||||| ||||||| Sbjct: 308 ccggggaggaggagtctgacagcggtctggacctcacggctgctgatggtggacttcttg 249 Query: 351 ttgta 355 ||||| Sbjct: 248 ttgta 244 Score = 44.1 bits (22), Expect = 0.38 Identities = 37/42 (88%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggc 430 |||||||| ||||||| |||| |||||||||||||||||| Sbjct: 210 ctcgaagacatcgttgacgaagctgttcatgatggacatggc 169
>ref|XM_786178.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B 291B (LOC586394), mRNA Length = 375 Score = 105 bits (53), Expect = 1e-19 Identities = 107/125 (85%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 |||| |||| |||||||||| |||||||||||||| |||||||||||||||||||| || Sbjct: 368 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttct 309 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||| ||| | ||| | |||||||| ||| ||| | ||||||||| ||||||| Sbjct: 308 ccggggaggaggagtctgacagcggtctggacctcacggctgctgatggtggacttcttg 249 Query: 351 ttgta 355 ||||| Sbjct: 248 ttgta 244 Score = 44.1 bits (22), Expect = 0.38 Identities = 37/42 (88%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggc 430 |||||||| ||||||| |||| |||||||||||||||||| Sbjct: 210 ctcgaagacatcgttgacgaagctgttcatgatggacatggc 169
>ref|XM_781061.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B (LOC581037), mRNA Length = 468 Score = 105 bits (53), Expect = 1e-19 Identities = 107/125 (85%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 |||| |||| |||||||||| |||||||||||||| |||||||| |||||||| | ||| Sbjct: 461 gaggtggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccaactct 402 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||| ||| ||||| | |||||||||||| ||| | ||||||||| ||||||| Sbjct: 401 ccggggaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttg 342 Query: 351 ttgta 355 ||||| Sbjct: 341 ttgta 337 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 399 tcgttgatgaaggagttcatgatggacatggccttg 434 ||||||| |||| |||||||||||||||||||||| Sbjct: 293 tcgttgacgaagctgttcatgatggacatggccttg 258
>emb|X06643.1|SPH2BL4 Strongylocentrotus purpuratus late histone gene fragment L4 H2b Length = 627 Score = 105 bits (53), Expect = 1e-19 Identities = 107/125 (85%) Strand = Plus / Minus Query: 231 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 290 |||| |||| |||||||||| |||||||||||||| |||||||||||||||||||| || Sbjct: 319 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttct 260 Query: 291 ccagggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 350 || ||||||| ||| | ||| | |||||||| ||| ||| | ||||||||| ||||||| Sbjct: 259 ccggggaggaggagcctgacagcggtctggacctcacggctgctgatggtggacttcttg 200 Query: 351 ttgta 355 ||||| Sbjct: 199 ttgta 195 Score = 44.1 bits (22), Expect = 0.38 Identities = 37/42 (88%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggc 430 |||||||| ||||||| |||| |||||||||||||||||| Sbjct: 161 ctcgaagacatcgttgacgaagctgttcatgatggacatggc 120
>ref|XM_954347.1| Neurospora crassa OR74A hypothetical protein (NCU02435.1) partial mRNA Length = 414 Score = 103 bits (52), Expect = 5e-19 Identities = 100/116 (86%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 ||||||| |||||||| ||||| || || || ||||||||||| ||||| || ||||||| Sbjct: 394 acttggtaacggccttagtgccttccgatacagcgtgcttggcaagctcgccggggagga 335 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356 |||||| || |||||||||||||| || |||| |||||||| ||||||||||||| Sbjct: 334 tgaggcgaacagaggtctggatctcacgagaggagatggtggacttcttgttgtag 279
>ref|XM_331210.1| Neurospora crassa OR74A hypothetical protein (NCU02435.1) partial mRNA Length = 414 Score = 103 bits (52), Expect = 5e-19 Identities = 100/116 (86%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 ||||||| |||||||| ||||| || || || ||||||||||| ||||| || ||||||| Sbjct: 394 acttggtaacggccttagtgccttccgatacagcgtgcttggcaagctcgccggggagga 335 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 356 |||||| || |||||||||||||| || |||| |||||||| ||||||||||||| Sbjct: 334 tgaggcgaacagaggtctggatctcacgagaggagatggtggacttcttgttgtag 279
>emb|X03017.1|XLHISH1 Xenopus laevis histone gene cluster Xlh1 with genes H3, H4, H2B, H2A and H1B Length = 14942 Score = 103 bits (52), Expect = 5e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 243 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacg 302 |||||||| ||||||||||||||||| |||||||| ||||| || |||||||| || | Sbjct: 3481 ttggtgacagccttggtgccctcggacacggcgtgtttggccagttccccaggcagcagc 3422 Query: 303 aggcggacggaggtctggatctcgcgggaggtgatggtgg 342 |||||||| | |||||||||||| |||||||||||||||| Sbjct: 3421 aggcggaccgcggtctggatctcccgggaggtgatggtgg 3382
>ref|XM_686839.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC573293), mRNA Length = 501 Score = 103 bits (52), Expect = 5e-19 Identities = 160/196 (81%) Strand = Plus / Minus Query: 246 gtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacgagg 305 |||||||||||||| |||||||| |||||||| ||||| ||||| || || || | || Sbjct: 353 gtgacggccttggtaccctcggacacggcgtgtttggccagctctccgggcagcagcagc 294 Query: 306 cggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcgagc 365 || |||| |||||||||||| | |||||||||||||| |||||||||| | ||||| Sbjct: 293 cgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtgggcgaga 234 Query: 366 ttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggac 425 | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| | Sbjct: 233 cgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgccc 174 Query: 426 atggccttggaggaga 441 |||||||||||||||| Sbjct: 173 atggccttggaggaga 158
>ref|XM_693375.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC573776), mRNA Length = 405 Score = 103 bits (52), Expect = 5e-19 Identities = 160/196 (81%) Strand = Plus / Minus Query: 246 gtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacgagg 305 ||||||||||| ||||||||||| |||||||| ||||| ||||| || || || | || Sbjct: 353 gtgacggccttagtgccctcggacacggcgtgtttggccagctctccgggcagcagcagc 294 Query: 306 cggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcgagc 365 || |||| |||||||||||| | |||||||||||||| |||||||||| | ||||| Sbjct: 293 cgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtgggcgaga 234 Query: 366 ttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggac 425 | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| | Sbjct: 233 cgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgccc 174 Query: 426 atggccttggaggaga 441 |||||||||||||||| Sbjct: 173 atggccttggaggaga 158
>gb|M21286.1|XELHX1H1 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and histone H3 gene, 3' end, gene cluster Xlhl Length = 14949 Score = 103 bits (52), Expect = 5e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 243 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacg 302 |||||||| ||||||||||||||||| |||||||| ||||| || |||||||| || | Sbjct: 3488 ttggtgacagccttggtgccctcggacacggcgtgtttggccagttccccaggcagcagc 3429 Query: 303 aggcggacggaggtctggatctcgcgggaggtgatggtgg 342 |||||||| | |||||||||||| |||||||||||||||| Sbjct: 3428 aggcggaccgcggtctggatctcccgggaggtgatggtgg 3389
>ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken (LOC429558), mRNA Length = 381 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 || | ||||| |||| ||||||||||| || ||||||||||||| Sbjct: 309 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 263 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 393 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||| |||||||||||||||| ||||||||||||||||| Sbjct: 212 aagatgtcgttgacgaaggagttcatgatgcccatggccttggaggaga 164
>ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken (LOC429457), partial mRNA Length = 628 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| || || Sbjct: 616 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 557 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 || | ||||| |||| ||||||||||| || ||||||||||||| Sbjct: 556 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 510 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 393 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||| |||||||||||||||| ||||||||||||||||| Sbjct: 459 aagatgtcgttgacgaaggagttcatgatgcccatggccttggaggaga 411
>emb|CR669650.2|CNS0FFO8 Tetraodon nigroviridis full-length cDNA Length = 617 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||| |||||||||||||||||||| |||||||||||||| |||||||| || Sbjct: 410 ggtgtacttggtcacggccttggtgccctcggacacggcgtgcttggccagctcccccgg 351 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 || | || | |||| |||||||||||| |||||||||||||||| Sbjct: 350 cagcagcagcctcacggcggtctggatctcccgggaggtgatggtgg 304 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 396 atgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 |||||||||| |||||||||||||||| ||||||||||||||||| Sbjct: 250 atgtcgttgacgaaggagttcatgatgctcatggccttggaggaga 205
>ref|XM_504425.1| Yarrowia lipolytica CLIB122, YALI0E26455g predicted mRNA Length = 420 Score = 101 bits (51), Expect = 2e-18 Identities = 132/159 (83%) Strand = Plus / Minus Query: 272 ggcgtgcttggcgagctccccagggaggacgaggcggacggaggtctggatctcgcggga 331 |||||||||||||||||| || ||||| | ||| ||||| | |||||||||||| || || Sbjct: 369 ggcgtgcttggcgagctcaccggggagaatgagtcggacagcggtctggatctctcgaga 310 Query: 332 ggtgatggtgggcttcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctc 391 |||||||||| ||||||| ||||| || ||||||| ||||||| ||||| ||| Sbjct: 309 agtgatggtggacttcttggtgtaggtggccagcttggaggcctcggtggcgactcgctc 250 Query: 392 gaagatgtcgttgatgaaggagttcatgatggacatggc 430 ||||||||||||| |||||||||||||| |||||||| Sbjct: 249 aaagatgtcgttgacaaaggagttcatgatagacatggc 211
>emb|BX072512.1|CNS09S44 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 621 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 466 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 407 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 406 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 360 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 313 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 263
>emb|BX072414.1|CNS09S1E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 718 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 267 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 327 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 373 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Plus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 420 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 470
>emb|BX051496.1|CNS09BWC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 247 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 306 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 307 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 353 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Plus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 400 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 450
>emb|BX051495.1|CNS09BWB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 758 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 463 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 404 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 403 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 357 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 310 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 260
>emb|BX047440.1|CNS098RO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21CG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 735 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 444 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 385 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 384 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 338 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 291 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 241
>emb|BX038423.1|CNS091T7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2DC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 721 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 478 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 419 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 418 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 372 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 325 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 275
>emb|BX032827.1|CNS08XHR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 670 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 461 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 402 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 401 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 355 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 308 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 258
>emb|BX031663.1|CNS08WLF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 770 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 236 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 295 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 296 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 342 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Plus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 389 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 439
>emb|BX021771.1|CNS08OYN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA32BB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 544 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 245 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 304 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 305 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 351
>emb|BX013307.1|CNS08IFJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA20AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 758 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 452 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 393 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 392 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 346 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 299 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 249
>emb|BX012776.1|CNS08I0S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA2AH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 780 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 470 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 411 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 410 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 364 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 317 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 267
>emb|BX012380.1|CNS08HPS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA19CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 758 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 248 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 307 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 308 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 354
>emb|BX009211.1|CNS08F9R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA15AA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 750 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 452 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 393 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 392 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 346 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 299 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 249
>emb|X98185.1|AGH2B A.gambiae mRNA for histone H2B Length = 698 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 423 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 364 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 363 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 317 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 273 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 223
>emb|AJ556871.1|XLA556871 Expression vector pET3-H2B H2B gene for Xenopus laevis-like histone H2B Length = 482 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||| ||||| | ||||||||| Sbjct: 400 ggtgtacttggtgacagccttggtgccctcggacacggcgtgtttggccaactccccagg 341 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 || | || ||||| | |||||||||||| |||||||||||||||| Sbjct: 340 cagcagcagtcggaccgcggtctggatctcccgggaggtgatggtgg 294 Score = 46.1 bits (23), Expect = 0.096 Identities = 38/43 (88%) Strand = Plus / Minus Query: 399 tcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||| ||||||||||||||| |||||||||||| |||| Sbjct: 237 tcgttgacaaaggagttcatgatgctcatggccttggacgaga 195
>emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from clone DKFZp469C0528) Length = 2237 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 352 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 || | ||||| |||| ||||||||||||||||| |||||||||| Sbjct: 351 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 305 Score = 73.8 bits (37), Expect = 4e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||| |||||||||||||||| |||||||||||| |||| Sbjct: 258 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgaga 206
>gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partial cds Length = 375 Score = 101 bits (51), Expect = 2e-18 Identities = 54/55 (98%) Strand = Plus / Minus Query: 387 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 359 ttctcgaagatgtcgttgatgaaggagctcatgatggacatggccttggaggaga 305
>ref|XM_558160.1| Anopheles gambiae str. PEST ENSANGP00000027582 (ENSANGG00000022768), partial mRNA Length = 513 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 46 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 105 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 106 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 152 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Plus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 199 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 249
>ref|XM_320334.2| Anopheles gambiae str. PEST ENSANGP00000014097 (ENSANGG00000011608), mRNA Length = 671 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 420 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 361 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 360 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 314 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 267 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 217
>ref|XM_320329.2| Anopheles gambiae str. PEST ENSANGP00000014080 (ENSANGG00000011591), mRNA Length = 695 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 464 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 405 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 404 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 358 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 311 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 261
>ref|XM_314450.2| Anopheles gambiae str. PEST ENSANGP00000000674 (ENSANGG00000000607), partial mRNA Length = 363 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 351 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 292 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 291 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 245 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 198 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 148
>ref|XM_314448.2| Anopheles gambiae str. PEST ENSANGP00000016043 (ENSANGG00000013554), mRNA Length = 704 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 470 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 411 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 410 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 364 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 317 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 267
>ref|XM_306853.2| Anopheles gambiae str. PEST ENSANGP00000000106 (ENSANGG00000000104), partial mRNA Length = 321 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 309 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 250 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 249 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 203 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 156 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 106
>ref|XM_306255.2| Anopheles gambiae str. PEST ENSANGP00000000003 (ENSANGG00000000003), partial mRNA Length = 375 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 363 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 304 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 ||| | || || || | ||||||||||||||||| |||||||||| Sbjct: 303 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 257 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 210 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 160
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 101 bits (51), Expect = 2e-18 Identities = 132/159 (83%) Strand = Plus / Plus Query: 272 ggcgtgcttggcgagctccccagggaggacgaggcggacggaggtctggatctcgcggga 331 |||||||||||||||||| || ||||| | ||| ||||| | |||||||||||| || || Sbjct: 3141902 ggcgtgcttggcgagctcaccggggagaatgagtcggacagcggtctggatctctcgaga 3141961 Query: 332 ggtgatggtgggcttcttgttgtagcgcgcgagcttggcggcctcgccggcgagcttctc 391 |||||||||| ||||||| ||||| || ||||||| ||||||| ||||| ||| Sbjct: 3141962 agtgatggtggacttcttggtgtaggtggccagcttggaggcctcggtggcgactcgctc 3142021 Query: 392 gaagatgtcgttgatgaaggagttcatgatggacatggc 430 ||||||||||||| |||||||||||||| |||||||| Sbjct: 3142022 aaagatgtcgttgacaaaggagttcatgatagacatggc 3142060
>gb|J00981.1|XELHIS2BL xenopus laevis h2b histone gene & flanks Length = 593 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| ||||||||||||||||| |||||||| ||||| | ||||||||| Sbjct: 504 ggtgtacttggtgacagccttggtgccctcggacacggcgtgtttggccaactccccagg 445 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 || | || ||||| | |||||||||||| |||||||||||||||| Sbjct: 444 cagcagcagtcggaccgcggtctggatctcccgggaggtgatggtgg 398 Score = 46.1 bits (23), Expect = 0.096 Identities = 38/43 (88%) Strand = Plus / Minus Query: 399 tcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||| ||||||||||||||| |||||||||||| |||| Sbjct: 341 tcgttgacaaaggagttcatgatgctcatggccttggacgaga 299
>ref|XM_518302.1| PREDICTED: Pan troglodytes similar to H2B histone family, member F (LOC462509), mRNA Length = 843 Score = 99.6 bits (50), Expect = 7e-18 Identities = 161/198 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| || Sbjct: 369 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||| |||||||| |||| ||||||||| Sbjct: 249 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 190 Query: 416 catgatggacatggcctt 433 ||||||| ||||||||| Sbjct: 189 catgatgcccatggcctt 172
>ref|XM_518287.1| PREDICTED: Pan troglodytes similar to Histone H2B 291B (LOC462491), mRNA Length = 643 Score = 99.6 bits (50), Expect = 7e-18 Identities = 152/186 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| || Sbjct: 419 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 360 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 359 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 300 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||||| |||||| || Sbjct: 299 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 240 Query: 416 catgat 421 |||||| Sbjct: 239 catgat 234
>gb|BC106720.1| Homo sapiens histone 1, H2bo, mRNA (cDNA clone MGC:119806 IMAGE:40014271), complete cds Length = 441 Score = 99.6 bits (50), Expect = 7e-18 Identities = 161/198 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| || Sbjct: 390 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 331 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 330 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 271 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||| |||||||| |||| ||||||||| Sbjct: 270 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 211 Query: 416 catgatggacatggcctt 433 ||||||| ||||||||| Sbjct: 210 catgatgcccatggcctt 193
>ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261), mRNA Length = 789 Score = 99.6 bits (50), Expect = 7e-18 Identities = 150/182 (82%), Gaps = 1/182 (0%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 186 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 127 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcg 360 ||||| |||| ||||||||||| ||||| |||||||||| |||||||||| ||| Sbjct: 126 gcaggcgcacggccgtctggatctc-cgggacgtgatggtggagcgcttgttgtagtgcg 68 Query: 361 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 420 | || || ||||| || |||| ||||||||||||||||| |||||||||||||| Sbjct: 67 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 8 Query: 421 tg 422 || Sbjct: 7 tg 6 Score = 77.8 bits (39), Expect = 3e-11 Identities = 89/103 (86%), Gaps = 2/103 (1%) Strand = Plus / Plus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||| ||||||||||||||||| |||||||||||||| ||||| || || || | Sbjct: 293 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 352 Query: 301 cgaggcggacggaggtctggatctcgcgggag-gtgatggtgg 342 ||||| |||| ||||||||||| |||||| |||||||||| Sbjct: 353 gcaggcgcacggccgtctggatctc-cgggagcgtgatggtgg 394
>ref|NM_178194.2| Mus musculus histone 1, H2be (Hist1h2be), mRNA Length = 2436 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 590 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 531 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 530 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 471 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 470 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 411 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 410 catgatgcccatggccttggaggaga 385
>ref|NM_003527.4| Homo sapiens histone 1, H2bo (HIST1H2BO), mRNA Length = 467 Score = 99.6 bits (50), Expect = 7e-18 Identities = 161/198 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| || Sbjct: 407 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 348 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 347 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 288 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||| |||||||| |||| ||||||||| Sbjct: 287 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 228 Query: 416 catgatggacatggcctt 433 ||||||| ||||||||| Sbjct: 227 catgatgcccatggcctt 210
>ref|XM_425468.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC427894), mRNA Length = 381 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | || || |||| ||||||||||| || || |||||||| | ||||||||| Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>ref|XM_425462.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC427888), mRNA Length = 381 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | || || |||| ||||||||||| || || |||||||| | ||||||||| Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>ref|XM_425457.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC427883), mRNA Length = 381 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | || || |||| ||||||||||| || || |||||||| | ||||||||| Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 189 catgatgcccatggccttggacgaga 164
>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA Length = 1220 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| || || Sbjct: 267 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 326 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | || || |||| ||||||||||| || || |||||||| | ||||||||| Sbjct: 327 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 386 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 387 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 446 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 447 catgatgcccatggccttggacgaga 472
>gb|BC060304.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone MGC:70229 IMAGE:4217587), complete cds Length = 661 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||| ||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 429 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 370 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 369 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 310 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 309 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 250 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 249 catgatgcccatggccttggaggaga 224
>ref|NM_021063.2| Homo sapiens histone 1, H2bd (HIST1H2BD), transcript variant 1, mRNA Length = 523 Score = 99.6 bits (50), Expect = 7e-18 Identities = 152/186 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| || Sbjct: 418 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 359 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 358 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 299 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||||| |||||| || Sbjct: 298 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 239 Query: 416 catgat 421 |||||| Sbjct: 238 catgat 233
>ref|NM_138720.1| Homo sapiens histone 1, H2bd (HIST1H2BD), transcript variant 2, mRNA Length = 829 Score = 99.6 bits (50), Expect = 7e-18 Identities = 152/186 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| || Sbjct: 418 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 359 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 358 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 299 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||||| |||||| || Sbjct: 298 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 239 Query: 416 catgat 421 |||||| Sbjct: 238 catgat 233
>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence Length = 209720 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 92394 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 92335 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 92334 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 92275 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 92274 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 92215 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||| |||||||||| Sbjct: 92214 catgatgcccatggctttggaggaga 92189 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||| ||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 63577 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 63636 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 63637 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 63696 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 63697 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 63756 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 63757 catgatgcccatggccttggaggaga 63782 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 49790 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 49731 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 49730 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 49671 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 49670 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 49611 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 49610 catgatgcccatggccttggaggaga 49585 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 61556 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 61497 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340 || | ||||| |||| ||||||||||| ||||| |||||||| Sbjct: 61496 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 61452 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||| | || |||||||||||| ||||||||||||||||| Sbjct: 61403 ctcgaagatgtcgttcacaaacgagttcatgatgcccatggccttggaggaga 61351
>ref|XM_539321.2| PREDICTED: Canis familiaris similar to histone 3, H2ba (LOC482202), mRNA Length = 459 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| || ||||||||||| ||||| || || Sbjct: 384 ggtgtacttggtgacggccttggtgccctcggacaccgcgtgcttggccagctcgccggg 325 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||| | ||||||||| |||||||| | ||||||||| Sbjct: 324 cagcagcaggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 265 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| ||||| ||| ||||||||||||| ||| ||||| Sbjct: 264 atgcgccaggcgggaggcctcgctggcgatgcgctcaaagatgtcgttgacgaacgagtt 205 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 204 catgatgcccatggccttggacgaga 179
>gb|AF531298.1| Homo sapiens histone H2B (HIST1H2BO) gene, complete cds Length = 1137 Score = 99.6 bits (50), Expect = 7e-18 Identities = 161/198 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| || Sbjct: 749 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 690 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 689 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 630 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||| |||||||| |||| ||||||||| Sbjct: 629 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 570 Query: 416 catgatggacatggcctt 433 ||||||| ||||||||| Sbjct: 569 catgatgcccatggcctt 552
>gb|AF531287.1| Homo sapiens histone H2B (HIST1H2BD) gene, complete cds Length = 1137 Score = 99.6 bits (50), Expect = 7e-18 Identities = 152/186 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| || Sbjct: 749 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 690 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 689 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 630 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||||| |||||| || Sbjct: 629 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 570 Query: 416 catgat 421 |||||| Sbjct: 569 catgat 564
>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the 3' part of the HFE gene for haemochromatosis protein, two genes for novel histone 4 family members, two genes for novel histone 1 family members, three genes for novel histone 2B family members, a gene for a novel histone 2A family member, a novel pseudogene, STSs, GSSs, ESTs and CpG islands, complete sequence Length = 101099 Score = 99.6 bits (50), Expect = 7e-18 Identities = 152/186 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| || Sbjct: 64919 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 64860 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 64859 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 64800 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||||| |||||| || Sbjct: 64799 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 64740 Query: 416 catgat 421 |||||| Sbjct: 64739 catgat 64734 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || || Sbjct: 29859 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 29918 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340 || | ||||| |||| ||||||||||| | |||||||||||| Sbjct: 29919 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 29963 Score = 83.8 bits (42), Expect = 4e-13 Identities = 150/186 (80%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||| ||||||||||||||||| || || ||||||||||| |||||||| || Sbjct: 90545 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 90486 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 90485 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 90426 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || ||||||||||||| ||||||||||||||||| ||||| || Sbjct: 90425 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 90366 Query: 416 catgat 421 |||||| Sbjct: 90365 catgat 90360
>emb|BX008531.1|CNS08EQV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA14AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 499 Score = 99.6 bits (50), Expect = 7e-18 Identities = 89/102 (87%) Strand = Plus / Minus Query: 241 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggagga 300 |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||||| | Sbjct: 445 acttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggggagca 386 Query: 301 cgaggcggacggaggtctggatctcgcgggaggtgatggtgg 342 || || || | ||||||||||||||||| |||||||||| Sbjct: 385 acagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 344 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggagga 439 ||||||||||||||| | |||| |||||||||| ||| ||||||||||| Sbjct: 297 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggagga 247
>emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2A and H2B Length = 1661 Score = 99.6 bits (50), Expect = 7e-18 Identities = 161/198 (81%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| || Sbjct: 410 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 469 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 470 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 529 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||| |||||||| |||| ||||||||| Sbjct: 530 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 589 Query: 416 catgatggacatggcctt 433 ||||||| ||||||||| Sbjct: 590 catgatgcccatggcctt 607
>emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B sequence Length = 1113 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| || || Sbjct: 990 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 931 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | || || |||| ||||||||||| || || |||||||| | ||||||||| Sbjct: 930 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 871 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 870 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 811 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 810 catgatgcccatggccttggacgaga 785
>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) Length = 1826 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 301 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 360 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 361 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 420 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 421 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttcacgaacgagtt 480 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 481 catgatgcccatggccttggaggaga 506
>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five genes for olfactory receptors, a novel gene, the H1f5 gene for H1 histone family member 5, three genes and one pseudogene for H2a histone family members, four genes for H2b, two genes for H4, and two genes for H3 histone family members and seven CpG islands, complete sequence Length = 222823 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 143456 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 143397 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 143396 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 143337 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 143336 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttcacgaacgagtt 143277 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 143276 catgatgcccatggccttggaggaga 143251 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 175481 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 175422 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340 || | ||||| |||| ||||||||||| ||||| |||||||| Sbjct: 175421 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 175377 Score = 81.8 bits (41), Expect = 2e-12 Identities = 89/105 (84%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 208873 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 208814 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340 || | ||||| |||| ||||||||||| ||||| |||||||| Sbjct: 208813 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 208769 Score = 81.8 bits (41), Expect = 2e-12 Identities = 89/105 (84%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 136765 ggtgtacttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccggg 136824 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340 || | ||||| |||| ||||||||||| ||||| |||||||| Sbjct: 136825 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 136869 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||| | ||| |||||||||||| ||||||||||||||||| Sbjct: 208720 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggaga 208668 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||| | ||| |||||||||||| ||||||||||||||||| Sbjct: 175328 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggaga 175276 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Plus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 ||||||||||||||| | ||| |||||||||||| ||||||||||||||||| Sbjct: 136918 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggaga 136970
>emb|AJ223353.1|HSAJ3353 Homo sapiens mRNA for histone H2B, clone pJG4-5-15 Length = 808 Score = 99.6 bits (50), Expect = 7e-18 Identities = 152/186 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| || Sbjct: 397 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 338 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 337 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 278 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||||| |||||| || Sbjct: 277 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 218 Query: 416 catgat 421 |||||| Sbjct: 217 catgat 212
>gb|BC069889.1| Mus musculus histone 1, H2be, mRNA (cDNA clone MGC:78105 IMAGE:4217814), complete cds Length = 657 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 376 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 317 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 316 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 257 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 256 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 197 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 196 catgatgcccatggccttggaggaga 171
>gb|BC019673.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MGC:30336 IMAGE:3993954), complete cds Length = 740 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 385 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 326 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 266 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 265 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 206 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 205 catgatgcccatggccttggaggaga 180
>gb|BC096122.1| Homo sapiens histone 1, H2bd, transcript variant 1, mRNA (cDNA clone MGC:116768 IMAGE:40002354), complete cds Length = 438 Score = 99.6 bits (50), Expect = 7e-18 Identities = 152/186 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| || Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 309 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||||| |||||| || Sbjct: 249 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 190 Query: 416 catgat 421 |||||| Sbjct: 189 catgat 184
>gb|BC002842.2| Homo sapiens histone 1, H2bd, transcript variant 2, mRNA (cDNA clone MGC:3802 IMAGE:3659807), complete cds Length = 814 Score = 99.6 bits (50), Expect = 7e-18 Identities = 152/186 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| || Sbjct: 394 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 335 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 334 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 275 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||||| |||||| || Sbjct: 274 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 215 Query: 416 catgat 421 |||||| Sbjct: 214 catgat 209
>ref|XM_683203.1| PREDICTED: Danio rerio similar to histone 1, H2bg (LOC559827), mRNA Length = 516 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||| ||||| ||||| || || Sbjct: 504 ggtgtacttggtgacggccttggtgccctcagacacggcgtgtttggccagctcaccggg 445 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | || || |||| |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 444 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 385 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 384 gtgagcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 325 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||| ||||||||||||| Sbjct: 324 catgatgcccatcgccttggaggaga 299
>dbj|AK049948.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched library, clone:C630013P15 product:H2B histone family, member S, full insert sequence Length = 2410 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 563 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 504 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 503 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 444 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 443 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 384 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 383 catgatgcccatggccttggaggaga 358
>dbj|AK030546.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330429M17 product:H2B histone family, member S, full insert sequence Length = 2436 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 590 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 531 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 530 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 471 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 470 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 411 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 410 catgatgcccatggccttggaggaga 385
>gb|BC092138.1| Mus musculus histone 1, H2bh, mRNA (cDNA clone MGC:106612 IMAGE:30613720), complete cds Length = 457 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 376 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 317 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 316 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 257 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 256 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 197 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||| |||||||||| Sbjct: 196 catgatgcccatggctttggaggaga 171
>ref|NM_178196.2| Mus musculus histone 1, H2bg (Hist1h2bg), mRNA Length = 661 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||| ||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 429 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 370 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 369 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 310 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 309 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 250 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 249 catgatgcccatggccttggaggaga 224
>ref|NM_178200.1| Mus musculus histone 1, H2bm (Hist1h2bm), mRNA Length = 381 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 369 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 249 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttcacgaacgagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 189 catgatgcccatggccttggaggaga 164
>gb|AY158936.1| Mus musculus histone protein Hist1h2be gene, complete cds Length = 1375 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 866 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 807 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 747 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 746 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 687 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 686 catgatgcccatggccttggaggaga 661
>gb|AY158934.1| Mus musculus histone protein Hist1h2bg gene, complete cds Length = 1375 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||| ||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 866 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 807 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 747 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 746 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 687 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 686 catgatgcccatggccttggaggaga 661
>gb|AY158933.1| Mus musculus histone protein Hist1h2bh gene, complete cds Length = 1201 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 792 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 733 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 732 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 673 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 672 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 613 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||| |||||||||| Sbjct: 612 catgatgcccatggctttggaggaga 587
>gb|AY158928.1| Mus musculus histone protein Hist1h2bm gene, complete cds Length = 1375 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || || ||||||||||| |||||||| || Sbjct: 866 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 807 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 747 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 746 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttcacgaacgagtt 687 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||||||||||||||||| Sbjct: 686 catgatgcccatggccttggaggaga 661
>emb|BX647290.1|HSM807434 Homo sapiens mRNA; cDNA DKFZp781B2436 (from clone DKFZp781B2436) Length = 1890 Score = 99.6 bits (50), Expect = 7e-18 Identities = 161/198 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| || Sbjct: 407 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 348 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 347 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 288 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||| |||||||| |||| ||||||||| Sbjct: 287 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 228 Query: 416 catgatggacatggcctt 433 ||||||| ||||||||| Sbjct: 227 catgatgcccatggcctt 210
>ref|NM_178197.1| Mus musculus histone 1, H2bh (Hist1h2bh), mRNA Length = 381 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||| || |||||||||||||| |||||||| || Sbjct: 369 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 310 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| ||||| |||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 250 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||| | ||| ||||| Sbjct: 249 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 190 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||| |||||||||| Sbjct: 189 catgatgcccatggctttggaggaga 164
>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25, complete sequence Length = 167326 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||| ||||| ||||| || || Sbjct: 107388 ggtgtacttggtgacggccttggtgccctcagacacggcgtgtttggccagctcaccggg 107447 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | || || |||| |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 107448 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 107507 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 107508 gtgagcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 107567 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||| ||||||||||||| Sbjct: 107568 catgatgcccatcgccttggaggaga 107593 Score = 91.7 bits (46), Expect = 2e-15 Identities = 166/206 (80%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||| |||||||| || |||||||| ||||| ||||| || || Sbjct: 94898 ggtgtacttggtgacggcctttgtgccctcagacacggcgtgtttggccagctcaccggg 94957 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | || || |||| |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 94958 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 95017 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 95018 gtgagcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 95077 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||| ||||||||||||| Sbjct: 95078 catgatgcccatcgccttggaggaga 95103 Score = 83.8 bits (42), Expect = 4e-13 Identities = 165/206 (80%) Strand = Plus / Plus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||| || |||||||||||||| || |||||||| ||||| ||||| || || Sbjct: 81765 ggtgtacttggtcacagccttggtgccctcagacacggcgtgtttggccagctcaccggg 81824 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | || || |||| |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 81825 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 81884 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 81885 gtgagcgagacgtgaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 81944 Query: 416 catgatggacatggccttggaggaga 441 ||||||| ||| ||||||||||||| Sbjct: 81945 catgatgcccatcgccttggaggaga 81970 Score = 79.8 bits (40), Expect = 7e-12 Identities = 157/196 (80%) Strand = Plus / Minus Query: 246 gtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacgagg 305 ||||| |||||||||||||| || |||||||| ||||| ||||| || || || | || Sbjct: 67908 gtgacagccttggtgccctcagacacggcgtgtttggccagctcaccgggcagcagcaga 67849 Query: 306 cggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgcgcgagc 365 || |||| |||||||||||| | ||| |||||||||| |||||||||| | ||||| Sbjct: 67848 cgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgtagtgagcgaga 67789 Query: 366 ttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggac 425 | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| | Sbjct: 67788 cgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgccc 67729 Query: 426 atggccttggaggaga 441 || ||||||||||||| Sbjct: 67728 atcgccttggaggaga 67713 Score = 56.0 bits (28), Expect = 1e-04 Identities = 82/100 (82%) Strand = Plus / Minus Query: 243 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagggaggacg 302 ||||| || |||||||||||||| || |||||||| ||||| ||||| || || || | Sbjct: 59316 ttggtcacagccttggtgccctcagacacggcgtgtttggccagctcaccgggcagcagc 59257 Query: 303 aggcggacggaggtctggatctcgcgggaggtgatggtgg 342 || || |||| |||||||||||| | ||| |||||||||| Sbjct: 59256 agacgcacggcggtctggatctctctggaagtgatggtgg 59217 Score = 50.1 bits (25), Expect = 0.006 Identities = 46/53 (86%) Strand = Plus / Minus Query: 389 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||| |||| ||| |||||||||||| ||| || |||||||||| Sbjct: 59170 ctcgaagatgtcattgacgaacgagttcatgatgcccatcgctttggaggaga 59118
>gb|M60751.1|HUMHISAF Human histone H2B.1 (H2B) gene, complete cds Length = 1520 Score = 99.6 bits (50), Expect = 7e-18 Identities = 152/186 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| || Sbjct: 901 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 842 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | ||||| |||| ||||||||||| | |||||||||||| | ||||||||| Sbjct: 841 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 782 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 |||| || || |||||||| |||| ||||||||||||||||| |||||| || Sbjct: 781 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 722 Query: 416 catgat 421 |||||| Sbjct: 721 catgat 716
>gb|M57901.1|CHKH2BB Chicken histone H2B gene, complete cds Length = 1298 Score = 99.6 bits (50), Expect = 7e-18 Identities = 167/206 (81%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| || || Sbjct: 791 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 732 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 355 || | || || |||| ||||||||||| || || |||||||| | ||||||||| Sbjct: 731 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 672 Query: 356 gcgcgcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 415 | |||| || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 671 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 612 Query: 416 catgatggacatggccttggaggaga 441 ||||||| |||||||||||| |||| Sbjct: 611 catgatgcccatggccttggacgaga 586
>gb|BC051872.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:60248 IMAGE:6526835), complete cds Length = 844 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 236 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccagg 295 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| || Sbjct: 409 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 350 Query: 296 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggt 340 || | ||||| |||| ||||||||||| | |||||||||||| Sbjct: 349 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 305 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 390 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 441 |||||||||||||||| ||||||||||||||| ||||||||| ||||||| Sbjct: 255 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggaga 204 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,918,406 Number of Sequences: 3902068 Number of extensions: 2918406 Number of successful extensions: 64784 Number of sequences better than 10.0: 888 Number of HSP's better than 10.0 without gapping: 898 Number of HSP's successfully gapped in prelim test: 21 Number of HSP's that attempted gapping in prelim test: 60534 Number of HSP's gapped (non-prelim): 4150 length of query: 441 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 419 effective length of database: 17,147,199,772 effective search space: 7184676704468 effective search space used: 7184676704468 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)