ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet95f07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_197798.1| Oryza sativa (japonica cultivar-group) putative... 182 6e-43
2gb|AY110237.1| Zea mays CL7048_1 mRNA sequence 117 3e-23
3gb|AC087599.14| Oryza sativa chromosome 10 BAC OSJNBa0057L21 gen... 64 4e-07
4dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
5gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 64 4e-07
6gb|BT012852.1| Lycopersicon esculentum clone 113931R, mRNA sequence 52 0.001
7emb|CT573077.2| Medicago truncatula chromosome 5 clone mth2-43j1... 44 0.35
8emb|CT573215.2| Medicago truncatula chromosome 5 clone mth2-51h2... 44 0.35
9gb|AC106169.5| Rattus norvegicus x BAC CH230-105D14 (Children's ... 42 1.4
10gb|DP000017.1| Sus scrofa target 1 genomic scaffold 40 5.4
11gb|AC092478.2| Sus scrofa clone RP44-360A14, complete sequence 40 5.4
12gb|AC127313.3| Mus musculus BAC clone RP23-311A21 from 5, comple... 40 5.4
13gb|AC016885.16| Homo sapiens chromosome 8, clone RP11-388K12, co... 40 5.4
14gb|AC022825.9| Homo sapiens chromosome 8, clone RP11-88J22, comp... 40 5.4
15gb|AC106747.2| Homo sapiens chromosome 5 clone RP11-152C23, comp... 40 5.4
16gb|AC106822.3| Homo sapiens chromosome 5 clone RP11-772C9, compl... 40 5.4
17gb|AC096755.2| Homo sapiens BAC clone RP11-519M16 from 4, comple... 40 5.4
18dbj|AK018236.1| Mus musculus adult male medulla oblongata cDNA, ... 40 5.4
19gb|AC019196.10| Homo sapiens BAC clone RP11-356G6 from 2, comple... 40 5.4
20gb|AC007595.9| Homo sapiens chromosome 16 clone RP11-109M19, com... 40 5.4
21gb|AC007024.4|AC007024 Homo sapiens PAC clone RP4-664A21 from 7p... 40 5.4
22gb|AC105046.10| Homo sapiens chromosome 8, clone CTD-3247F14, co... 40 5.4
23gb|AC002073.1|AC002073 Human PAC clone RP3-515N1 from 22q11.2-q2... 40 5.4

>ref|NM_197798.1| Oryza sativa (japonica cultivar-group) putative chloroplast
           chaperonin (OSJNBa0057L21.3), mRNA
          Length = 683

 Score =  182 bits (92), Expect = 6e-43
 Identities = 137/152 (90%)
 Strand = Plus / Minus

                                                                       
Query: 253 agatccgactctctgcagaagcagtgcttctcttctgttcccaggtccacctcataagcg 312
           ||||| ||||| | |||||||||||||||||| || || |||||||||||||||||||| 
Sbjct: 482 agatcagactcacggcagaagcagtgcttctcatcggtacccaggtccacctcataagca 423

                                                                       
Query: 313 tttatgtccgagaagagaaccttctttccagcttcaacttcactaacatcaacaccgacc 372
           |||||||| ||||||||||||||||||||||||||||||||| |||||||| |||| || 
Sbjct: 422 tttatgtcagagaagagaaccttctttccagcttcaacttcattaacatcagcaccaaca 363

                                           
Query: 373 gataaaatctcgcccatcaaatatctctcaaa 404
           || |||||||| ||||||||||| ||||||||
Sbjct: 362 gacaaaatctcacccatcaaatacctctcaaa 331



to top

>gb|AY110237.1| Zea mays CL7048_1 mRNA sequence
          Length = 972

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 298 tccacctcataagcgtttatgtccgagaagagaaccttctttccagcttcaacttcacta 357
           |||||||||||||| || ||||| ||||||||||||||||| ||||| ||||||||||| 
Sbjct: 608 tccacctcataagcattgatgtctgagaagagaaccttcttcccagcctcaacttcactg 549

                                                          
Query: 358 acatcaacaccgaccgataaaatctcgcccatcaaatatctctcaaa 404
           || ||| |||||| ||||| |||||| ||||||| ||||||||||||
Sbjct: 548 acttcagcaccgatcgatagaatctcacccatcagatatctctcaaa 502



to top

>gb|AC087599.14| Oryza sativa chromosome 10 BAC OSJNBa0057L21 genomic sequence, complete
             sequence
          Length = 183046

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                 
Query: 331   accttctttccagcttcaacttcactaacatcaacaccgaccgataaaatct 382
             |||||||||||||||||||||||| |||||||| |||| || || |||||||
Sbjct: 73109 accttctttccagcttcaacttcattaacatcagcaccaacagacaaaatct 73160



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                 
Query: 253   agatccgactctctgcagaagcagtgcttctcttctgttcccaggtccacct 304
             ||||| ||||| | |||||||||||||||||| || || |||||||||||||
Sbjct: 71621 agatcagactcacggcagaagcagtgcttctcatcggtacccaggtccacct 71672



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                               
Query: 301   acctcataagcgtttatgtccgagaagagaacct 334
             ||||||||||| |||||||| |||||||||||||
Sbjct: 71866 acctcataagcatttatgtcagagaagagaacct 71899



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                    
Query: 331      accttctttccagcttcaacttcactaacatcaacaccgaccgataaaatct 382
                |||||||||||||||||||||||| |||||||| |||| || || |||||||
Sbjct: 21935212 accttctttccagcttcaacttcattaacatcagcaccaacagacaaaatct 21935161



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                    
Query: 253      agatccgactctctgcagaagcagtgcttctcttctgttcccaggtccacct 304
                ||||| ||||| | |||||||||||||||||| || || |||||||||||||
Sbjct: 21936700 agatcagactcacggcagaagcagtgcttctcatcggtacccaggtccacct 21936649



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                                  
Query: 301      acctcataagcgtttatgtccgagaagagaacct 334
                ||||||||||| |||||||| |||||||||||||
Sbjct: 21936455 acctcataagcatttatgtcagagaagagaacct 21936422



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                    
Query: 331      accttctttccagcttcaacttcactaacatcaacaccgaccgataaaatct 382
                |||||||||||||||||||||||| |||||||| |||| || || |||||||
Sbjct: 21946875 accttctttccagcttcaacttcattaacatcagcaccaacagacaaaatct 21946824



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                    
Query: 253      agatccgactctctgcagaagcagtgcttctcttctgttcccaggtccacct 304
                ||||| ||||| | |||||||||||||||||| || || |||||||||||||
Sbjct: 21948363 agatcagactcacggcagaagcagtgcttctcatcggtacccaggtccacct 21948312



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                                  
Query: 301      acctcataagcgtttatgtccgagaagagaacct 334
                ||||||||||| |||||||| |||||||||||||
Sbjct: 21948118 acctcataagcatttatgtcagagaagagaacct 21948085



to top

>gb|BT012852.1| Lycopersicon esculentum clone 113931R, mRNA sequence
          Length = 622

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 289 gttcccaggtccacctcataagcgtttatgtccgagaagagaaccttctt 338
           |||||||  |||||||||||||| || ||||| ||||| |||||||||||
Sbjct: 382 gttcccaaatccacctcataagcattgatgtcagagaaaagaaccttctt 333



to top

>emb|CT573077.2| Medicago truncatula chromosome 5 clone mth2-43j18, COMPLETE SEQUENCE
          Length = 142338

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 87    ttggcaacaaaagaaacacatg 108
             ||||||||||||||||||||||
Sbjct: 13369 ttggcaacaaaagaaacacatg 13390



to top

>emb|CT573215.2| Medicago truncatula chromosome 5 clone mth2-51h23, COMPLETE SEQUENCE
          Length = 121342

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 87    ttggcaacaaaagaaacacatg 108
             ||||||||||||||||||||||
Sbjct: 33917 ttggcaacaaaagaaacacatg 33896



to top

>gb|AC106169.5| Rattus norvegicus x BAC CH230-105D14 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 227592

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 91    caacaaaagaaacacatgtat 111
             |||||||||||||||||||||
Sbjct: 32057 caacaaaagaaacacatgtat 32037



to top

>gb|DP000017.1| Sus scrofa target 1 genomic scaffold
          Length = 1471440

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 276     gtgcttctcttctgttccca 295
               ||||||||||||||||||||
Sbjct: 1150851 gtgcttctcttctgttccca 1150870



to top

>gb|AC092478.2| Sus scrofa clone RP44-360A14, complete sequence
          Length = 161008

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 276   gtgcttctcttctgttccca 295
             ||||||||||||||||||||
Sbjct: 12415 gtgcttctcttctgttccca 12434



to top

>gb|AC127313.3| Mus musculus BAC clone RP23-311A21 from 5, complete sequence
          Length = 195651

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 278    gcttctcttctgttcccagg 297
              ||||||||||||||||||||
Sbjct: 108219 gcttctcttctgttcccagg 108238



to top

>gb|AC016885.16| Homo sapiens chromosome 8, clone RP11-388K12, complete sequence
          Length = 210008

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 336  ctttccagcttcaacttcac 355
            ||||||||||||||||||||
Sbjct: 3690 ctttccagcttcaacttcac 3671



to top

>gb|AC022825.9| Homo sapiens chromosome 8, clone RP11-88J22, complete sequence
          Length = 191772

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 336    ctttccagcttcaacttcac 355
              ||||||||||||||||||||
Sbjct: 168210 ctttccagcttcaacttcac 168191



to top

>gb|AC106747.2| Homo sapiens chromosome 5 clone RP11-152C23, complete sequence
          Length = 106038

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 275   agtgcttctcttctgttccc 294
             ||||||||||||||||||||
Sbjct: 95406 agtgcttctcttctgttccc 95387



to top

>gb|AC106822.3| Homo sapiens chromosome 5 clone RP11-772C9, complete sequence
          Length = 115988

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 275  agtgcttctcttctgttccc 294
            ||||||||||||||||||||
Sbjct: 3929 agtgcttctcttctgttccc 3910



to top

>gb|AC096755.2| Homo sapiens BAC clone RP11-519M16 from 4, complete sequence
          Length = 182440

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 333   cttctttccagcttcaactt 352
             ||||||||||||||||||||
Sbjct: 27729 cttctttccagcttcaactt 27748



to top

>dbj|AK018236.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
           enriched library, clone:6330559I19
           product:unclassifiable, full insert sequence
          Length = 1364

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 278 gcttctcttctgttcccagg 297
           ||||||||||||||||||||
Sbjct: 903 gcttctcttctgttcccagg 922



to top

>gb|AC019196.10| Homo sapiens BAC clone RP11-356G6 from 2, complete sequence
          Length = 175504

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 265    ctgcagaagcagtgcttctcttct 288
              |||||||| |||||||||||||||
Sbjct: 104979 ctgcagaaccagtgcttctcttct 104956



to top

>gb|AC007595.9| Homo sapiens chromosome 16 clone RP11-109M19, complete sequence
          Length = 186303

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 289   gttcccaggtccacctcata 308
             ||||||||||||||||||||
Sbjct: 20747 gttcccaggtccacctcata 20728



to top

>gb|AC007024.4|AC007024 Homo sapiens PAC clone RP4-664A21 from 7p15, complete sequence
          Length = 83848

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 275   agtgcttctcttctgttccc 294
             ||||||||||||||||||||
Sbjct: 43264 agtgcttctcttctgttccc 43283



to top

>gb|AC105046.10| Homo sapiens chromosome 8, clone CTD-3247F14, complete sequence
          Length = 87734

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 328   agaaccttctttccagcttc 347
             ||||||||||||||||||||
Sbjct: 38586 agaaccttctttccagcttc 38605



to top

>gb|AC002073.1|AC002073 Human PAC clone RP3-515N1 from 22q11.2-q22, complete sequence
          Length = 128978

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 122    tcaaatcactcaacccatga 141
              ||||||||||||||||||||
Sbjct: 110432 tcaaatcactcaacccatga 110451


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,148,249
Number of Sequences: 3902068
Number of extensions: 4148249
Number of successful extensions: 147549
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 147454
Number of HSP's gapped (non-prelim): 95
length of query: 405
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 383
effective length of database: 17,147,199,772
effective search space: 6567377512676
effective search space used: 6567377512676
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top