ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet95e12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 638 e-180
2gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 272 9e-70
3gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 264 2e-67
4gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 256 5e-65
5gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 240 3e-60
6gb|AY109332.1| Zea mays CL502_5 mRNA sequence 240 3e-60
7gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 220 3e-54
8ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 212 7e-52
9ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 212 7e-52
10ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 212 7e-52
11dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 212 7e-52
12dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 212 7e-52
13dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 212 7e-52
14dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 212 7e-52
15dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 204 2e-49
16dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 196 4e-47
17gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 184 2e-43
18gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 176 4e-41
19ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 172 6e-40
20dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 6e-40
21gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 157 4e-35
22gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 157 4e-35
23ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 151 2e-33
24dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 151 2e-33
25dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 149 9e-33
26dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 149 9e-33
27gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 141 2e-30
28gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 141 2e-30
29dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 137 3e-29
30ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 133 5e-28
31dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 127 3e-26
32dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 127 3e-26
33gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 123 5e-25
34gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 123 5e-25
35emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 123 5e-25
36gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat... 123 5e-25
37ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 117 3e-23
38ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group... 117 3e-23
39dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
40ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 115 1e-22
41dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
42dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
43dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
44dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
45dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 115 1e-22
46dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 113 5e-22
47dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 113 5e-22
48emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 109 8e-21
49gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat... 109 8e-21
50dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 8e-21
51dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 8e-21
52dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 8e-21
53gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 109 8e-21
54dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 109 8e-21
55emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 107 3e-20
56gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 107 3e-20
57gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 107 3e-20
58gb|AY103580.1| Zea mays PCO072544 mRNA sequence 107 3e-20
59gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds 103 5e-19
60ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative... 101 2e-18
61gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds 101 2e-18
62gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)... 101 2e-18
63dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 101 2e-18
64dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 2e-18
65ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 100 8e-18
66dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
67dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
68dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
69dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
70gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 98 3e-17
71gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 96 1e-16
72gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 94 5e-16
73gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 94 5e-16
74gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 94 5e-16
75gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 94 5e-16
76gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm... 94 5e-16
77emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 92 2e-15
78emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Co... 92 2e-15
79gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple... 92 2e-15
80gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 92 2e-15
81emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 90 7e-15
82dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 90 7e-15
83dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 90 7e-15
84dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 90 7e-15
85gb|AY107589.1| Zea mays PCO085320 mRNA sequence 90 7e-15
86dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 90 7e-15
87emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 90 7e-15
88ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channe... 88 3e-14
89gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 88 3e-14
90gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 88 3e-14
91gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 88 3e-14
92emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Co... 88 3e-14
93gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 88 3e-14
94gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 88 3e-14
95emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 86 1e-13
96gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 86 1e-13
97gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co... 86 1e-13
98dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 86 1e-13
99gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 84 4e-13
100emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 84 4e-13
101gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds 84 4e-13
102gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 84 4e-13
103gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 geno... 82 2e-12
104dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
105gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 82 2e-12
106gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 82 2e-12
107dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membran... 82 2e-12
108gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 80 7e-12
109ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 78 3e-11
110gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr... 78 3e-11
111gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (... 78 3e-11
112gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 78 3e-11
113gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 78 3e-11
114emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
115emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
116emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
117emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
118gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 78 3e-11
119gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 78 3e-11
120gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel... 78 3e-11
121gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA 78 3e-11
122emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p... 76 1e-10
123dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 76 1e-10
124gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 76 1e-10
125gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (... 72 2e-09
126ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G3... 70 7e-09
127emb|AJ249384.1|SOL249384 Spinacia oleracea mRNA for PM28B protei... 70 7e-09
128emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for p... 70 7e-09
129emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for p... 70 7e-09
130emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides m... 70 7e-09
131emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
132emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
133emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
134emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
135emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
136emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
137emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
138gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete s... 70 7e-09
139dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 70 7e-09
140gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, com... 70 7e-09
141dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 70 7e-09
142gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr... 68 3e-08
143emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 68 3e-08
144emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major ... 68 3e-08
145gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, c... 68 3e-08
146dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
147dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
148dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
149dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
150dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
151gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c... 68 3e-08
152dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
153dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
154ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 66 1e-07
155gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRN... 66 1e-07
156dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
157dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
158dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 66 1e-07
159dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 66 1e-07
160emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 64 4e-07
161gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 64 4e-07
162gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 64 4e-07
163gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip... 64 4e-07
164dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membran... 64 4e-07
165ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37... 62 2e-06
166gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence 62 2e-06
167gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic pro... 62 2e-06
168gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (... 62 2e-06
169emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrins... 62 2e-06
170emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening memb... 62 2e-06
171emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening memb... 62 2e-06
172gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma m... 62 2e-06
173emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 62 2e-06
174gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein ... 62 2e-06
175gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 62 2e-06
176gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete s... 62 2e-06
177dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative tran... 62 2e-06
178dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 62 2e-06
179gb|AY107675.1| Zea mays PCO112712 mRNA sequence 62 2e-06
180dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane ... 62 2e-06
181ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channe... 60 6e-06
182gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic prot... 60 6e-06
183dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in... 60 6e-06
184gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete s... 60 6e-06
185emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 58 3e-05
186emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 58 3e-05
187dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds 58 3e-05
188gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map... 58 3e-05
189gb|DQ228343.1| Solanum tuberosum clone 148A12 unknown mRNA 56 1e-04
190gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 56 1e-04
191gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 56 1e-04
192emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 56 1e-04
193emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for... 56 1e-04
194gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 56 1e-04
195dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane in... 56 1e-04
196gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel... 56 1e-04
197gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrins... 56 1e-04
198ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G6... 54 4e-04
199ref|XM_470514.1| Oryza sativa (japonica cultivar-group), mRNA 54 4e-04
200gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 54 4e-04
201gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds 54 4e-04
202emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1 54 4e-04
203emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein 54 4e-04
204emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 54 4e-04
205gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom... 54 4e-04
206emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 54 4e-04
207emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 54 4e-04
208emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene) 54 4e-04
209gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 54 4e-04
210gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ... 54 4e-04
211gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 54 4e-04
212dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 54 4e-04
213emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Co... 54 4e-04
214emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Co... 54 4e-04
215gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ... 54 4e-04
216gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete se... 54 4e-04
217gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA... 54 4e-04
218dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane... 54 4e-04
219dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 4e-04
220gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, co... 54 4e-04
221gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, compl... 54 4e-04
222gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co... 54 4e-04
223dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane ... 54 4e-04
224ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) tr... 52 0.002
225ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G0... 52 0.002
226emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic... 52 0.002
227gb|BT000330.1| Arabidopsis thaliana probable plasma membrane int... 52 0.002
228emb|AL132962.1|ATF2A19 Arabidopsis thaliana DNA chromosome 3, BA... 52 0.002
229gb|AY120785.1| Arabidopsis thaliana probable plasma membrane int... 52 0.002
230gb|AY099825.1| Arabidopsis thaliana probable plasma membrane int... 52 0.002
231gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water ... 52 0.002
232gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds 52 0.002
233emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Co... 52 0.002
234emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Co... 52 0.002
235emb|AJ605568.1| Ricinus communis partial mRNA for putative aquap... 52 0.002
236dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protei... 52 0.002
237dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 52 0.002
238gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, c... 52 0.002
239dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane ... 52 0.002
240ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channe... 50 0.006
241gb|AY333929.1| Pringlea antiscorbutica putative transmembrane pr... 50 0.006
242gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758)... 50 0.006
243gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP prote... 50 0.006
244gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP prote... 50 0.006
245emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Co... 50 0.006
246gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete s... 50 0.006
247emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene... 50 0.006
248emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene... 50 0.006
249gb|U27347.1|GMU27347 Glycine max putative water channel protein ... 50 0.006
250ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 48 0.025
251gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence 48 0.025
252emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 48 0.025
253emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 48 0.025
254gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 48 0.025
255gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 48 0.025
256gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 48 0.025
257emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 48 0.025
258dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane in... 48 0.025
259gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, comp... 48 0.025
260gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, comp... 48 0.025
261emb|AJ605569.1| Ricinus communis partial mRNA for putative aquap... 48 0.025
262emb|AJ605565.1| Ricinus communis partial mRNA for putative aquap... 48 0.025
263gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 48 0.025
264ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTR... 46 0.097
265gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence 46 0.097
266gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ... 46 0.097
267emb|Z83830.1|PAMIP1 P.abies mRNA for porin Mip1 46 0.097
268emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic... 46 0.097
269emb|X75881.1|ATPIP1A A.thaliana mRNA for plasma membrane intrins... 46 0.097
270emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial 46 0.097
271gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic prot... 46 0.097
272gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.097
273gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.097
274gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 ... 46 0.097
275gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intr... 46 0.097
276emb|BX824209.1|CNS0A5OV Arabidopsis thaliana Full-length cDNA Co... 46 0.097
277emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Co... 46 0.097
278emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Co... 46 0.097
279emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Co... 46 0.097
280emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Co... 46 0.097
281gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mR... 46 0.097
282dbj|AB206100.1| Mimosa pudica pip2;2 mRNA for plasma membrane in... 46 0.097
283dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane in... 46 0.097
284gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete se... 46 0.097
285dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds 46 0.097
286emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1... 46 0.097
287gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrin... 46 0.097
288gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 46 0.097
289dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 46 0.097
290gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, ... 44 0.39
291emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, c... 44 0.39
292emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative trans... 44 0.39
293gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (P... 44 0.39
294gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA... 44 0.39
295gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP... 44 0.39
296gb|AF195115.1|F5I10 Arabidopsis thaliana BAC F5I10 44 0.39
297gb|AF051202.1|AF051202 Picea mariana probable aquaporin (Sb01) m... 44 0.39
298gb|AF013293.1|IG005I10 Arabidopsis thaliana BAC IG005I10 44 0.39
299ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 42 1.5
300gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 1.5
301gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic prot... 42 1.5
302gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.5
303gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 42 1.5
304emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 42 1.5
305gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 42 1.5
306emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 42 1.5
307gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 42 1.5
308ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-form... 42 1.5
309emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.5
310emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.5
311gb|AF218774.1|AF218774 Lycopersicon esculentum putative water ch... 42 1.5
312gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 42 1.5
313emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 42 1.5
314emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 42 1.5
315emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 42 1.5
316emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 42 1.5
317dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.5
318gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence 42 1.5
319gb|AY084470.1| Arabidopsis thaliana clone 108944 mRNA, complete ... 42 1.5
320gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 42 1.5
321gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming i... 42 1.5
322gb|BC084131.1| Xenopus laevis hypothetical LOC495037, mRNA (cDNA... 42 1.5
323gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 1.5
324gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins... 42 1.5
325dbj|AB002148.1| Nicotiana excelsior mRNA for water channel prote... 42 1.5
326ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G5... 40 6.0
327ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A)... 40 6.0
328gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 6.0
329gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (... 40 6.0
330gb|AY961922.1| Picea abies probable aquaporin (Aqp) mRNA, partia... 40 6.0
331gb|AE014075.1| Escherichia coli CFT073, complete genome 40 6.0
332gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, compl... 40 6.0
333emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrins... 40 6.0
334emb|AL138650.1|ATT5N23 Arabidopsis thaliana DNA chromosome 3, BA... 40 6.0
335emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, B... 40 6.0
336emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on ch... 40 6.0
337gb|AC083943.8| Genomic sequence for Oryza sativa, Nipponbare str... 40 6.0
338gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat... 40 6.0
339gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic pr... 40 6.0
340gb|AF452013.1|AF452013 Petunia x hybrida aquaporin-like protein ... 40 6.0
341gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, comp... 40 6.0
342gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 ... 40 6.0
343gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co... 40 6.0
344dbj|AK220982.1| Arabidopsis thaliana mRNA for plasma membrane in... 40 6.0
345gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic pr... 40 6.0
346gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co... 40 6.0
347emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Co... 40 6.0
348emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Co... 40 6.0
349emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Co... 40 6.0
350emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Co... 40 6.0
351gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete s... 40 6.0
352gb|AF487998.1| Saccharopolyspora erythraea NRRL 2338 eryCI flank... 40 6.0
353gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma... 40 6.0
354dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 6.0
355emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 6.0
356emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 6.0
357gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi... 40 6.0
358gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, com... 40 6.0
359dbj|AB012044.1| Raphanus sativus mRNA for plasma membrane aquapo... 40 6.0

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
            complete cds
          Length = 1283

 Score =  638 bits (322), Expect = e-180
 Identities = 422/450 (93%), Gaps = 9/450 (2%)
 Strand = Plus / Minus

                                                                        
Query: 6    aggaaaaggaatgcgggctaattaagacaagcgatcccatggaccgaattacaacacacg 65
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1189 aggaaaagcaatgcgggctaattaagacaagcgatcccatggaccgaattacaagacacg 1130

                                                                        
Query: 66   gcacgcatgactgggc-acatac---gcatatgcagctgccgacacataaataacacgac 121
            ||||||||||| || | || |||   |||||||||||||||||||||||| |||||||||
Sbjct: 1129 gcacgcatgaccggaccacgtactacgcatatgcagctgccgacacataa-taacacgac 1071

                                                                        
Query: 122  cattgcagcggcc-aactgaactgtcgagaagttgcaaaagcggctttctctttggatgg 180
            |||||| |||||| |||||||||||||||||||||||||||||  ||||||| |||||||
Sbjct: 1070 cattgcggcggccgaactgaactgtcgagaagttgcaaaagcgcatttctctctggatgg 1011

                                                                        
Query: 181  atggacacagcacaggtcgccattgcttcaatcttgcatgcacatcacatggat---aac 237
            ||||||||| ||| |||||||||||||||| |||||||| || || ||||||||   |||
Sbjct: 1010 atggacacaacacgggtcgccattgcttcagtcttgcatacagatgacatggatgataac 951

                                                                        
Query: 238  tcgttacgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgta 297
            | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 950  ttgttacgcgttgctcctgaaggagccgagggccttgatggcgccggccctgaggatgta 891

                                                                        
Query: 298  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 890  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 831

                                                                        
Query: 358  atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 830  atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctccgggccgggtt 771

                                          
Query: 418  gatgccggtgccggtgatcgggatggtggc 447
            |||||||||||||||||| |||||||||||
Sbjct: 770  gatgccggtgccggtgatggggatggtggc 741



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score =  272 bits (137), Expect = 9e-70
 Identities = 188/205 (91%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 924 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 865

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           |||||||||||||||| || ||||| |  | |||||| |||||||||||||| || || |
Sbjct: 864 ggtagaaggccgcgatggcagcgcccacgagggggcccacccagaagatccagtggtcgt 805

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 804 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 745

                                    
Query: 423 cggtgccggtgatcgggatggtggc 447
           ||||||||||||  |||||||||||
Sbjct: 744 cggtgccggtgacggggatggtggc 720



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score =  264 bits (133), Expect = 2e-67
 Identities = 187/205 (91%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 872 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 813

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 812 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 753

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 752 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 693

                                    
Query: 423 cggtgccggtgatcgggatggtggc 447
           ||||||||||||  |||||||||||
Sbjct: 692 cggtgccggtgacggggatggtggc 668



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score =  256 bits (129), Expect = 5e-65
 Identities = 186/205 (90%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           ||||||||||||||||||||||||||||||||||||| || |||| ||| ||||||||||
Sbjct: 943 acgcgttgctcctgaaggagccgagggccttgatggccccagcccggaggatgtactggt 884

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 883 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 824

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 823 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 764

                                    
Query: 423 cggtgccggtgatcgggatggtggc 447
           ||||||||||||  |||||||||||
Sbjct: 763 cggtgccggtgacggggatggtggc 739



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score =  240 bits (121), Expect = 3e-60
 Identities = 184/205 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 996 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 937

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 936 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 877

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
           |||| | ||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 876 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 817

                                    
Query: 423 cggtgccggtgatcgggatggtggc 447
           ||||||||||||  |||||||||||
Sbjct: 816 cggtgccggtgacggggatggtggc 792



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  240 bits (121), Expect = 3e-60
 Identities = 184/205 (89%)
 Strand = Plus / Minus

                                                                        
Query: 243  acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
            ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 1646 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 1587

                                                                        
Query: 303  ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
            |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 1586 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 1527

                                                                        
Query: 363  cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            |||| | ||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 1526 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 1467

                                     
Query: 423  cggtgccggtgatcgggatggtggc 447
            ||||||||||||  |||||||||||
Sbjct: 1466 cggtgccggtgacggggatggtggc 1442



 Score =  176 bits (89), Expect = 4e-41
 Identities = 137/153 (89%)
 Strand = Plus / Minus

                                                                       
Query: 295 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 354
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 321 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 262

                                                                       
Query: 355 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 414
            || || ||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 261 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 202

                                            
Query: 415 gttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||||||||||||| |||||||||||
Sbjct: 201 gttgatgccggtgccggtgatggggatggtggc 169



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score =  220 bits (111), Expect = 3e-54
 Identities = 177/199 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||
Sbjct: 968 acgcgttgctcctgaaggagccgagggccttgatggcgccggcccggaggatgtactggt 909

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 908 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 849

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 848 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 789

                              
Query: 423 cggtgccggtgatcgggat 441
           |||||||||||||||||||
Sbjct: 788 cggtgccggtgatcgggat 770



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score =  212 bits (107), Expect = 7e-52
 Identities = 176/199 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                              
Query: 423 cggtgccggtgatcgggat 441
           |||||||||||||||||||
Sbjct: 798 cggtgccggtgatcgggat 780



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score =  212 bits (107), Expect = 7e-52
 Identities = 176/199 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801

                              
Query: 423 cggtgccggtgatcgggat 441
           |||||||||||||||||||
Sbjct: 800 cggtgccggtgatcgggat 782



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score =  212 bits (107), Expect = 7e-52
 Identities = 176/199 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802

                              
Query: 423 cggtgccggtgatcgggat 441
           |||||||||||||||||||
Sbjct: 801 cggtgccggtgatcgggat 783



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score =  212 bits (107), Expect = 7e-52
 Identities = 176/199 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                              
Query: 423 cggtgccggtgatcgggat 441
           |||||||||||||||||||
Sbjct: 798 cggtgccggtgatcgggat 780



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score =  212 bits (107), Expect = 7e-52
 Identities = 176/199 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 572 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 513

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 512 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 453

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 452 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 393

                              
Query: 423 cggtgccggtgatcgggat 441
           |||||||||||||||||||
Sbjct: 392 cggtgccggtgatcgggat 374



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score =  212 bits (107), Expect = 7e-52
 Identities = 176/199 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                              
Query: 423 cggtgccggtgatcgggat 441
           |||||||||||||||||||
Sbjct: 798 cggtgccggtgatcgggat 780



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score =  212 bits (107), Expect = 7e-52
 Identities = 176/199 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802

                              
Query: 423 cggtgccggtgatcgggat 441
           |||||||||||||||||||
Sbjct: 801 cggtgccggtgatcgggat 783



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score =  204 bits (103), Expect = 2e-49
 Identities = 175/199 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           ||||||||||||||| |||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgagggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801

                              
Query: 423 cggtgccggtgatcgggat 441
           |||||||||||||||||||
Sbjct: 800 cggtgccggtgatcgggat 782



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score =  196 bits (99), Expect = 4e-47
 Identities = 174/199 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||
Sbjct: 544 acgcgttgctcctgaaggagccgagggccttgatggggccggcccggaggatgtactggt 485

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 484 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccattggttgt 425

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||||||||| || |||||| |||||||||| |  ||   | ||||||||||||||||||
Sbjct: 424 gccaggccttctcgttgttgaagatgacggccggtccggtggtcctggccgggttgatgc 365

                              
Query: 423 cggtgccggtgatcgggat 441
           |||||||||||||||||||
Sbjct: 364 cggtgccggtgatcgggat 346



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  184 bits (93), Expect = 2e-43
 Identities = 156/177 (88%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 330
           |||| |||||| |||||| || | |||||||||||||  ||| ||||| || ||||| ||
Sbjct: 927 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 868

                                                                       
Query: 331 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
           ||  ||||| |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 867 cagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 808

                                                                    
Query: 391 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            ||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 807 cgcggctcccaggctcctcgccgggttgatgccggtgccggtgatggggatggtggc 751



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  176 bits (89), Expect = 4e-41
 Identities = 137/153 (89%)
 Strand = Plus / Minus

                                                                       
Query: 295 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 354
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 893 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 834

                                                                       
Query: 355 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 414
            || || ||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 833 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 774

                                            
Query: 415 gttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||||||||||||| |||||||||||
Sbjct: 773 gttgatgccggtgccggtgatggggatggtggc 741



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score =  172 bits (87), Expect = 6e-40
 Identities = 150/171 (87%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                                       
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 396
           ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| 
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782

                                                              
Query: 397 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            |||| |||||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggc 731



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score =  172 bits (87), Expect = 6e-40
 Identities = 150/171 (87%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                                       
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 396
           ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| 
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782

                                                              
Query: 397 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            |||| |||||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggc 731



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score =  157 bits (79), Expect = 4e-35
 Identities = 151/175 (86%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 330
           |||| |||||| |||||| || | |||||||||||||  ||| ||||| || ||||| ||
Sbjct: 935 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 876

                                                                       
Query: 331 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
           ||  || || |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 875 cagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 816

                                                                  
Query: 391 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtg 445
            ||||| |||||| |||| ||||||||||||||||||||||||||  ||||||||
Sbjct: 815 cgcggctcccaggatcctcgccgggttgatgccggtgccggtgatgcggatggtg 761



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score =  157 bits (79), Expect = 4e-35
 Identities = 148/171 (86%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | |||||||||||||  ||| ||||| || ||||||||||  ||
Sbjct: 875 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagcgg 816

                                                                       
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 396
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 815 ccccacccagaagatccattggtcatcccaggccttgtctttgttgtagatgacagcagc 756

                                                              
Query: 397 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            |||| ||| || |||||||||||||||||||||||||| |||||||||||
Sbjct: 755 tcccaagcttctcgccgggttgatgccggtgccggtgatggggatggtggc 705



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score =  151 bits (76), Expect = 2e-33
 Identities = 127/144 (88%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
           ||||  |||||||||||  ||||||||||  |||||| | || |||||||||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

                                   
Query: 418 gatgccggtgccggtgatcgggat 441
           ||||||||||||||||||||||||
Sbjct: 781 gatgccggtgccggtgatcgggat 758



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 242 tacgcgttgctcctgaaggagccg 265
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score =  151 bits (76), Expect = 2e-33
 Identities = 127/144 (88%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
           ||||  |||||||||||  ||||||||||  |||||| | || |||||||||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

                                   
Query: 418 gatgccggtgccggtgatcgggat 441
           ||||||||||||||||||||||||
Sbjct: 781 gatgccggtgccggtgatcgggat 758



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 242 tacgcgttgctcctgaaggagccg 265
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  149 bits (75), Expect = 9e-33
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                            
Query: 243      acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
                |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 15355852 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 15355793

                                                                       
Query: 303      ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
                ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 15355792 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 15355738



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                            
Query: 355      ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 414
                |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 15306327 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 15306268

                                           
Query: 415      gttgatgccggtgccggtgatcgggat 441
                |||||||||||||||||||||||||||
Sbjct: 15306267 gttgatgccggtgccggtgatcgggat 15306241



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                            
Query: 377      ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
                |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 15316356 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 15316297

                     
Query: 437      gggat 441
                |||||
Sbjct: 15316296 gggat 15316292



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                            
Query: 368      gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 427
                ||||| || |||||| |||||||||| || || | |||||||||||||||||||||||||
Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 15355544

                              
Query: 428      ccggtgatcgggat 441
                ||||||||||||||
Sbjct: 15355543 ccggtgatcgggat 15355530



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                            
Query: 377      ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
                |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||||  
Sbjct: 15324236 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 15324177

                        
Query: 437      gggatggt 444
                ||||||||
Sbjct: 15324176 gggatggt 15324169



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 298      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
                ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 15316534 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 15316475



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 298      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
                ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 15306498 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 15306439



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                            
Query: 314      gcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
                ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 15324431 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 15324388



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 242      tacgcgttgctcctgaaggagccg 265
                ||||||||||||| ||||||||||
Sbjct: 15306551 tacgcgttgctccggaaggagccg 15306528



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score =  149 bits (75), Expect = 9e-33
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                         
Query: 243   acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
             |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 62851 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 62792

                                                                    
Query: 303   ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 62791 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 62737



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                         
Query: 355   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 414
             |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 13326 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 13267

                                        
Query: 415   gttgatgccggtgccggtgatcgggat 441
             |||||||||||||||||||||||||||
Sbjct: 13266 gttgatgccggtgccggtgatcgggat 13240



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                         
Query: 377   ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
             |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 23355 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 23296

                  
Query: 437   gggat 441
             |||||
Sbjct: 23295 gggat 23291



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                         
Query: 368   gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 427
             ||||| || |||||| |||||||||| || || | |||||||||||||||||||||||||
Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 62543

                           
Query: 428   ccggtgatcgggat 441
             ||||||||||||||
Sbjct: 62542 ccggtgatcgggat 62529



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                         
Query: 377   ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
             |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||||  
Sbjct: 31235 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 31176

                     
Query: 437   gggatggt 444
             ||||||||
Sbjct: 31175 gggatggt 31168



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 298   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 23533 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 23474



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 298   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 13497 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 13438



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 314   gcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 31430 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 31387



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 242   tacgcgttgctcctgaaggagccg 265
             ||||||||||||| ||||||||||
Sbjct: 13550 tacgcgttgctccggaaggagccg 13527



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score =  141 bits (71), Expect = 2e-30
 Identities = 146/171 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | ||||||||||||    || ||||| || |||||||| |  ||
Sbjct: 825 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 766

                                                                       
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 396
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 765 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 706

                                                              
Query: 397 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            |||| ||||||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 705 gcccaagctcctggccgggttgatgccggtgccggtgatggggatcgtggc 655



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score =  141 bits (71), Expect = 2e-30
 Identities = 146/171 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | ||||||||||||    || ||||| || |||||||| |  ||
Sbjct: 880 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 821

                                                                       
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 396
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 820 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 761

                                                              
Query: 397 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            |||| ||||||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 760 gcccaagctcctggccgggttgatgccggtgccggtgatggggatcgtggc 710



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score =  137 bits (69), Expect = 3e-29
 Identities = 150/177 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 330
           |||| |||||| |||||| || | |||||||||||| ||||| ||||| || || |||||
Sbjct: 913 cttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccgat 854

                                                                       
Query: 331 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
            |  || || |||||||| ||||| || |||||||||||||| || ||||||||||| ||
Sbjct: 853 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 794

                                                                    
Query: 391 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||| || || | |||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 793 ggcagctccgaagctcctcgccgggttgatgccggtgccggtgatcgggatagtggc 737



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score =  133 bits (67), Expect = 5e-28
 Identities = 145/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 837 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 778

                                                                       
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 396
            || |||||||||||||| || |||| ||| ||||||| || ||||||||| || || ||
Sbjct: 777 ccccacccagaagatccagtggtcatgccatgccttgtgctggttgtagatcaccgcagc 718

                                                              
Query: 397 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            |||| |||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 717 tcccaagctccttgccgggttgatgccggtgccggtgatcgggatcgtggc 667



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score =  127 bits (64), Expect = 3e-26
 Identities = 130/152 (85%)
 Strand = Plus / Minus

                                                                       
Query: 296 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 355
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 944 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 885

                                                                       
Query: 356 tgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccggg 415
           || |||||||||||||||||  ||||||||||||| || || |||| ||| || || |||
Sbjct: 884 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 825

                                           
Query: 416 ttgatgccggtgccggtgatcgggatggtggc 447
           |||||||||||||||||||| |||||||||||
Sbjct: 824 ttgatgccggtgccggtgatggggatggtggc 793



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score =  127 bits (64), Expect = 3e-26
 Identities = 130/152 (85%)
 Strand = Plus / Minus

                                                                       
Query: 296 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 355
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 864 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 805

                                                                       
Query: 356 tgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccggg 415
           || |||||||||||||||||  ||||||||||||| || || |||| ||| || || |||
Sbjct: 804 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 745

                                           
Query: 416 ttgatgccggtgccggtgatcgggatggtggc 447
           |||||||||||||||||||| |||||||||||
Sbjct: 744 ttgatgccggtgccggtgatggggatggtggc 713



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score =  123 bits (62), Expect = 5e-25
 Identities = 128/150 (85%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 397 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 338

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 337 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 278

                                         
Query: 418 gatgccggtgccggtgatcgggatggtggc 447
           |||||||||||||||||| |||||||||||
Sbjct: 277 gatgccggtgccggtgatagggatggtggc 248



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  123 bits (62), Expect = 5e-25
 Identities = 128/150 (85%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 828 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 769

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 768 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 709

                                         
Query: 418 gatgccggtgccggtgatcgggatggtggc 447
           |||||||||||||||||| |||||||||||
Sbjct: 708 gatgccggtgccggtgatagggatggtggc 679



to top

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  123 bits (62), Expect = 5e-25
 Identities = 128/150 (85%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 839

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||   |||||| |  ||| |||||||||||| ||| || || |||||||| ||||||||
Sbjct: 838 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 779

                                         
Query: 418 gatgccggtgccggtgatcgggatggtggc 447
           |||||||||||||||||| |||||||||||
Sbjct: 778 gatgccggtgccggtgatggggatggtggc 749



to top

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score =  123 bits (62), Expect = 5e-25
 Identities = 98/110 (89%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           |||||||||||||||||||| || |||||  | || || |||||||||||||||||||| 
Sbjct: 787 ccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacggcggcg 728

                                                             
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || | ||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 727 ccgaagctcctggcggggttgatgccggtgccggtgatggggatggtggc 678



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score =  117 bits (59), Expect = 3e-23
 Identities = 113/131 (86%)
 Strand = Plus / Minus

                                                                       
Query: 314 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 373
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 782 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 723

                                                                       
Query: 374 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 433
              |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 722 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 663

                      
Query: 434 atcgggatggt 444
           |  ||||||||
Sbjct: 662 acggggatggt 652



to top

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score =  117 bits (59), Expect = 3e-23
 Identities = 113/131 (86%)
 Strand = Plus / Minus

                                                                       
Query: 314 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 373
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 340 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 281

                                                                       
Query: 374 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 433
              |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 280 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 221

                      
Query: 434 atcgggatggt 444
           |  ||||||||
Sbjct: 220 acggggatggt 210



to top

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score =  117 bits (59), Expect = 3e-23
 Identities = 113/131 (86%)
 Strand = Plus / Minus

                                                                       
Query: 314 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 373
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 339 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 280

                                                                       
Query: 374 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 433
              |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 279 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 220

                      
Query: 434 atcgggatggt 444
           |  ||||||||
Sbjct: 219 acggggatggt 209



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  115 bits (58), Expect = 1e-22
 Identities = 100/114 (87%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 774 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 715

                                                                 
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            || || |||||||| || ||||||||||||||||||||||| |||||||||||
Sbjct: 714 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggc 661



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score =  115 bits (58), Expect = 1e-22
 Identities = 100/114 (87%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 851 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 792

                                                                 
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            || || |||||||| || ||||||||||||||||||||||| |||||||||||
Sbjct: 791 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggc 738



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score =  115 bits (58), Expect = 1e-22
 Identities = 127/150 (84%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || ||||| || | |||||| |||||||||||||| ||
Sbjct: 888 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 829

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||||||||||| | | || |||||||||||| ||| || || |||||||| || |||||
Sbjct: 828 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 769

                                         
Query: 418 gatgccggtgccggtgatcgggatggtggc 447
           |||||||||||||||||| |||||||||||
Sbjct: 768 gatgccggtgccggtgatggggatggtggc 739



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score =  115 bits (58), Expect = 1e-22
 Identities = 100/114 (87%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 854 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 795

                                                                 
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            || || |||||||| || ||||||||||||||||||||||| |||||||||||
Sbjct: 794 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggc 741



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score =  115 bits (58), Expect = 1e-22
 Identities = 100/114 (87%)
 Strand = Plus / Minus

                                                                        
Query: 334  ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
            |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 1150 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 1091

                                                                  
Query: 394  ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
             || || |||||||| || ||||||||||||||||||||||| |||||||||||
Sbjct: 1090 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggc 1037



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score =  115 bits (58), Expect = 1e-22
 Identities = 100/114 (87%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| |||||||||||||| || |||| |||||| | |||| |||||||||||| |||
Sbjct: 877 ggggcccacccagaagatccaatggtcattccaggcatggtccctgttgtagatgatggc 818

                                                                 
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            ||||| |||||||| || ||||||||||||||||||||||| || ||||||||
Sbjct: 817 agccccaaggctcctagctgggttgatgccggtgccggtgatgggaatggtggc 764



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  113 bits (57), Expect = 5e-22
 Identities = 81/89 (91%)
 Strand = Plus / Minus

                                                                            
Query: 359      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
                ||||||||||||||||||||||||||||| || ||||  |||| |||||| |||||||| 
Sbjct: 25184038 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 25183979

                                             
Query: 419      atgccggtgccggtgatcgggatggtggc 447
                ||||||||||||||||| |||||||||||
Sbjct: 25183978 atgccggtgccggtgatggggatggtggc 25183950



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                            
Query: 359      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
                |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 27065064 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 27065005

                                             
Query: 419      atgccggtgccggtgatcgggatggtggc 447
                ||||| || |||||||| |||||||||||
Sbjct: 27065004 atgccagtaccggtgatggggatggtggc 27064976



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                            
Query: 277      ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
                ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 25184682 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 25184623

                                      
Query: 337      gccgacccagaagatccactga 358
                ||| ||||||||||||||||||
Sbjct: 25184622 gcccacccagaagatccactga 25184601



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                         
Query: 391      ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
                |||||| || ||||| | ||| ||||||||||||||||||||||| |||||||||||
Sbjct: 35369049 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggc 35368993



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score =  113 bits (57), Expect = 5e-22
 Identities = 81/89 (91%)
 Strand = Plus / Minus

                                                                         
Query: 359   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
             ||||||||||||||||||||||||||||| || ||||  |||| |||||| |||||||| 
Sbjct: 84431 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 84372

                                          
Query: 419   atgccggtgccggtgatcgggatggtggc 447
             ||||||||||||||||| |||||||||||
Sbjct: 84371 atgccggtgccggtgatggggatggtggc 84343



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                         
Query: 277   ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
             ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 85075 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 85016

                                   
Query: 337   gccgacccagaagatccactga 358
             ||| ||||||||||||||||||
Sbjct: 85015 gcccacccagaagatccactga 84994



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 753

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||| ||||||||||| || |||||||| |||||||||||
Sbjct: 752 aggctcctggctgggttgatgccagtaccggtgatggggatggtggc 706



to top

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score =  109 bits (55), Expect = 8e-21
 Identities = 154/187 (82%)
 Strand = Plus / Minus

                                                                       
Query: 249 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 308
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 912 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 853

                                                                       
Query: 309 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 368
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 852 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 793

                                                                       
Query: 369 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgc 428
           |||| || ||||||||||| || || |||||||  |||||||| |||||||| |||||||
Sbjct: 792 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtgc 733

                  
Query: 429 cggtgat 435
           | |||||
Sbjct: 732 cagtgat 726



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||| ||||||||||| || |||||||| |||||||||||
Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggc 739



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 841

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||| ||||||||||| || |||||||| |||||||||||
Sbjct: 840 aggctcctggctgggttgatgccagtaccggtgatggggatggtggc 794



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||| ||||||||||| || |||||||| |||||||||||
Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggc 739



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 781

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||| ||||||||||| || |||||||| |||||||||||
Sbjct: 780 aggctcctggctgggttgatgccagtaccggtgatggggatggtggc 734



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 784

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||| ||||||||||| || |||||||| |||||||||||
Sbjct: 783 aggctcctggctgggttgatgccagtaccggtgatggggatggtggc 737



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  107 bits (54), Expect = 3e-20
 Identities = 117/138 (84%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 885 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 826

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 825 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 766

                             
Query: 418 gatgccggtgccggtgat 435
           ||||||||||||||||||
Sbjct: 765 gatgccggtgccggtgat 748



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  107 bits (54), Expect = 3e-20
 Identities = 126/150 (84%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 940 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 881

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||   ||| || |  |||  ||||||||||| |||||| || |||||||| ||||||||
Sbjct: 880 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 821

                                         
Query: 418 gatgccggtgccggtgatcgggatggtggc 447
           |||||||||||||||||| |||||||||||
Sbjct: 820 gatgccggtgccggtgatggggatggtggc 791



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  107 bits (54), Expect = 3e-20
 Identities = 126/150 (84%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 935 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 876

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||   ||| || |  |||  ||||||||||| |||||| || |||||||| ||||||||
Sbjct: 875 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 816

                                         
Query: 418 gatgccggtgccggtgatcgggatggtggc 447
           |||||||||||||||||| |||||||||||
Sbjct: 815 gatgccggtgccggtgatggggatggtggc 786



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  107 bits (54), Expect = 3e-20
 Identities = 126/150 (84%)
 Strand = Plus / Minus

                                                                        
Query: 298  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
            ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 1264 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 1205

                                                                        
Query: 358  atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
             ||   ||| || |  |||  ||||||||||| |||||| || |||||||| ||||||||
Sbjct: 1204 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 1145

                                          
Query: 418  gatgccggtgccggtgatcgggatggtggc 447
            |||||||||||||||||| |||||||||||
Sbjct: 1144 gatgccggtgccggtgatggggatggtggc 1115



to top

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score =  103 bits (52), Expect = 5e-19
 Identities = 121/144 (84%)
 Strand = Plus / Minus

                                                                       
Query: 292 tatgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagat 351
           |||| |||||||||||||||| || || || || || || | ||| || ||||| |||||
Sbjct: 873 tatgaactggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagat 814

                                                                       
Query: 352 ccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggc 411
           |||||| |||||||||||||| || ||||||||||| || || |||||||  ||||||||
Sbjct: 813 ccactggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggc 754

                                   
Query: 412 cgggttgatgccggtgccggtgat 435
            |||||||| |||||||| |||||
Sbjct: 753 agggttgataccggtgccagtgat 730



to top

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||||||||| | ||| || |||  || |||||||| ||||||||| || 
Sbjct: 626 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 567

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           | |||||| ||||| |||||||| |||||||||||||||||||||||
Sbjct: 566 aagctcctcgccggattgatgcccgtgccggtgatcgggatggtggc 520



to top

>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds
          Length = 1070

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| ||||||||||| || ||||| ||||||||||| |||||||| || 
Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagattacggcggctccg 687

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           | ||| ||||| ||||| || ||||||||||||||||| ||||||||
Sbjct: 686 aagcttctggcggggttaattccggtgccggtgatcggaatggtggc 640



to top

>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Minus

                                                                       
Query: 249 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 308
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 466 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 407

                                                                       
Query: 309 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 368
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 406 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 347

                                                                       
Query: 369 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgc 428
           |||| || ||||||||||| || || |||||||  |||||||| |||||||| ||||| |
Sbjct: 346 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtac 287

                  
Query: 429 cggtgat 435
           | |||||
Sbjct: 286 cagtgat 280



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0475E07
          Length = 139961

 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                         
Query: 355   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 414
             |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 92340 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 92281

                                        
Query: 415   gttgatgccggtgccggtgatcgggat 441
             |||||||||||||||||||||||||||
Sbjct: 92280 gttgatgccggtgccggtgatcgggat 92254



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                          
Query: 377    ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
              |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 102369 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 102310

                   
Query: 437    gggat 441
              |||||
Sbjct: 102309 gggat 102305



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                          
Query: 377    ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
              |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||||  
Sbjct: 110249 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 110190

                      
Query: 437    gggatggt 444
              ||||||||
Sbjct: 110189 gggatggt 110182



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                          
Query: 298    ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
              ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 102547 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 102488



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 298   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 92511 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 92452



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 314    gcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
              ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 110444 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 110401



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 242   tacgcgttgctcctgaaggagccg 265
             ||||||||||||| ||||||||||
Sbjct: 92564 tacgcgttgctccggaaggagccg 92541



to top

>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full
           insert sequence
          Length = 1232

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||||||||| | ||| || |||  || |||||||| ||||||||| || 
Sbjct: 808 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 749

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           | |||||| ||||| |||||||| |||||||||||||||||||||||
Sbjct: 748 aagctcctcgccggattgatgcccgtgccggtgatcgggatggtggc 702



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 92/106 (86%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 742 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 683

                                                         
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            ||||| ||| ||||||||||| ||||||||||| |||||||||||
Sbjct: 682 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggc 637



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 247 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 837 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 781



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 92/106 (86%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 728 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 669

                                                         
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            ||||| ||| ||||||||||| ||||||||||| |||||||||||
Sbjct: 668 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggc 623



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 249 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 821 tgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 767



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 92/106 (86%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 841 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 782

                                                         
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            ||||| ||| ||||||||||| ||||||||||| |||||||||||
Sbjct: 781 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggc 736



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 247 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 936 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 880



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 92/106 (86%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 835 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 776

                                                         
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            ||||| ||| ||||||||||| ||||||||||| |||||||||||
Sbjct: 775 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggc 730



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 247 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 930 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 874



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 92/106 (86%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 829 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 770

                                                         
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            ||||| ||| ||||||||||| ||||||||||| |||||||||||
Sbjct: 769 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggc 724



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 247 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 924 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 868



to top

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 79/89 (88%)
 Strand = Plus / Minus

                                                                       
Query: 359 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
           |||| ||||||| |||| |||||||||||||| || || |||| ||| || |||||||||
Sbjct: 407 tcattccaggccctgtctttgttgtagatgacagcagctcccaagcttctcgccgggttg 348

                                        
Query: 419 atgccggtgccggtgatcgggatggtggc 447
           ||||||||||||||||| |||||||||||
Sbjct: 347 atgccggtgccggtgatggggatggtggc 319



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 314 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 373
           ||||||||||| ||||| |  ||||| ||||||||||||||||| ||   |||||| |||
Sbjct: 884 gcgatcgccgctccgatgaacgggcccacccagaagatccactggtcgctccaggctttg 825

                                                                       
Query: 374 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 433
              |||||||| | ||||||||| || |||||||| ||||||||||| |||||||| |||
Sbjct: 824 ctgttgttgtacacgacggcggcgccgaggctcctcgccgggttgataccggtgccagtg 765

                   
Query: 434 atcgggat 441
           ||||||||
Sbjct: 764 atcgggat 757



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || || ||||| || | ||||||||||||||||| ||| || |||
Sbjct: 810 acccagaagatccagtggtcgtcccatgcgtggtccttgttgtagatgatggccgcaccc 751

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |||||||  || |||||||||||||| ||||| || |||||||||||
Sbjct: 750 aggctccgagctgggttgatgccggttccggttatggggatggtggc 704



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||  ||||| || 
Sbjct: 458 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 399

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||| |||||||| ||||| || ||||| |||||||||||
Sbjct: 398 aggctcctggcggggttgataccggtacctgtgattgggatggtggc 352



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||  ||||| || 
Sbjct: 788 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 729

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||| |||||||| ||||| || ||||| |||||||||||
Sbjct: 728 aggctcctggcggggttgataccggtacctgtgattgggatggtggc 682



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete
           cds
          Length = 1325

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                       
Query: 377 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
           |||| |||||||| |||||| || ||||||||||| ||||||||||||||||||||||| 
Sbjct: 968 ttgtcgtagatgatggcggcgccgaggctcctggcggggttgatgccggtgccggtgatg 909

                      
Query: 437 gggatggtggc 447
           |||||||||||
Sbjct: 908 gggatggtggc 898



to top

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||||||||||||||| |||||||| ||||||||||||||||| || || || || || 
Sbjct: 746 acccagaagatccactggtcatcccatgccttgtccttgttgtaaattacagcagctccg 687

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  |||||||| |||||||| ||||||||||| || ||||| |||||
Sbjct: 686 aaactcctggctgggttgataccggtgccggtaattgggatagtggc 640



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 248 ttgctcctgaaggagccgagggccttgatggc 279
           |||||||||||||| ||||| |||||||||||
Sbjct: 839 ttgctcctgaaggatccgagagccttgatggc 808



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                       
Query: 378 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 437
           |||||||||||| ||| || || |||||||| |||||||||||||||||||||||||| |
Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 598

                     
Query: 438 ggatggtggc 447
           ||||||||||
Sbjct: 597 ggatggtggc 588



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 298  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
            ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccactg 1232



to top

>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1128

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 819 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 760

                                                 
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgat 435
           || |  ||||| |||||||| || |||||||| |||||
Sbjct: 759 ccaaaactcctagccgggtttattccggtgccagtgat 722



to top

>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds
          Length = 901

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || ||||||||||||||||| ||||| |||||||| || || 
Sbjct: 771 ccgacccagaacatccaatggtcatcccaggccttgtcgttgttatagatgacagcagct 712

                                                 
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgat 435
           || | ||| || ||||||||||| ||||||||||||||
Sbjct: 711 ccgaagcttctagccgggttgataccggtgccggtgat 674



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || ||||| || | ||||||||||||||||||||| ||
Sbjct: 384 ctggtggtagatggcggctagggcagcgccaatgaaggggccgacccagaagatccaatg 325

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            |||| |||||| |  ||| |||||||||||| ||| || || |||||||| || |||||
Sbjct: 324 gtcattccaggcgtgctccctgttgtagatgatggcagcgccaaggctcctagctgggtt 265

                                         
Query: 418 gatgccggtgccggtgatcgggatggtggc 447
           |||||| ||||| || || |||||||||||
Sbjct: 264 gatgccagtgccagtaatggggatggtggc 235



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                         
Query: 359   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
             ||||||||||| | | || |||||||||||| ||| || || |||||||| || ||||||
Sbjct: 28019 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 27960

                                          
Query: 419   atgccggtgccggtgatcgggatggtggc 447
             ||||||||||||||||| |||||||||||
Sbjct: 27959 atgccggtgccggtgatggggatggtggc 27931



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 334   ggggccgacccagaagatccactg 357
             |||||| |||||||||||||||||
Sbjct: 28605 ggggccaacccagaagatccactg 28582



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                            
Query: 359      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
                ||||||||||| | | || |||||||||||| ||| || || |||||||| || ||||||
Sbjct: 28020793 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 28020734

                                             
Query: 419      atgccggtgccggtgatcgggatggtggc 447
                ||||||||||||||||| |||||||||||
Sbjct: 28020733 atgccggtgccggtgatggggatggtggc 28020705



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                            
Query: 359      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
                |||| ||| ||||||| || ||||||||| || || || |||| |||||| |||||||||
Sbjct: 26074238 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 26074179

                                             
Query: 419      atgccggtgccggtgatcgggatggtggc 447
                ||||||||||||||||||||||| |||||
Sbjct: 26074178 atgccggtgccggtgatcgggatcgtggc 26074150



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                           
Query: 362     tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 421
               ||||| ||||| | || |||||||||||||||||| || | ||||| ||| |||||||||
Sbjct: 8906901 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 8906960

                                         
Query: 422     ccggtgccggtgatcgggatggtggc 447
               || ||||||||||| |||||||||||
Sbjct: 8906961 cccgtgccggtgatggggatggtggc 8906986



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                            
Query: 277      ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
                ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 26074829 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 26074770

                                    
Query: 337      gccgacccagaagatccact 356
                 || ||||||||||||||||
Sbjct: 26074769 ccccacccagaagatccact 26074750



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                        
Query: 247     gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
               |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 8906703 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 8906759



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 334      ggggccgacccagaagatccactg 357
                |||||| |||||||||||||||||
Sbjct: 28021379 ggggccaacccagaagatccactg 28021356



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                         
Query: 359   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
             |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 36713 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 36654

                                          
Query: 419   atgccggtgccggtgatcgggatggtggc 447
             ||||| || |||||||| |||||||||||
Sbjct: 36653 atgccagtaccggtgatggggatggtggc 36625



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                          
Query: 359    tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
              |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 118266 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 118207

                                           
Query: 419    atgccggtgccggtgatcgggatggtggc 447
              ||||| || |||||||| |||||||||||
Sbjct: 118206 atgccagtaccggtgatggggatggtggc 118178



to top

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 96/113 (84%)
 Strand = Plus / Minus

                                                                       
Query: 335 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 394
           |||||||||||||| ||||| ||||| ||||| |||||   || |||||| |  ||||| 
Sbjct: 194 gggccgacccagaatatccagtgatcctcccacgcctttcgctggttgtacacaacggcc 135

                                                                
Query: 395 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           | |||||||||||| |||||||||||||| ||||||||||  |||||||||||
Sbjct: 134 ggccccaggctccttgccgggttgatgcccgtgccggtgacggggatggtggc 82



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 301 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 360
           ||||||||  ||||| | |||||||||||| |  || || |||||||||||||| || ||
Sbjct: 914 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 855

                                                                       
Query: 361 atcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgat 420
            ||||| ||||  | |||||||||||||| |||||| || |||  ||| |||||||||||
Sbjct: 854 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 795

                                
Query: 421 gccggtgccggtgatcgggat 441
           ||||||||| ||||| |||||
Sbjct: 794 gccggtgcccgtgatggggat 774



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                          
Query: 359    tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
              |||| ||| ||||||| || ||||||||| || || || |||| |||||| |||||||||
Sbjct: 108565 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 108506

                                           
Query: 419    atgccggtgccggtgatcgggatggtggc 447
              ||||||||||||||||||||||| |||||
Sbjct: 108505 atgccggtgccggtgatcgggatcgtggc 108477



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                          
Query: 277    ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
              ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 109156 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 109097

                                  
Query: 337    gccgacccagaagatccact 356
               || ||||||||||||||||
Sbjct: 109096 ccccacccagaagatccact 109077



to top

>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010
           (PIP2;6/PIP2E) mRNA, complete cds
          Length = 1245

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 845 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 786

                                           
Query: 398 cccaggctcctggccgggttgatgccggtgcc 429
           || |  ||||| |||||||| || ||||||||
Sbjct: 785 ccaaaactcctagccgggtttattccggtgcc 754



to top

>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1201

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 840 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 781

                                           
Query: 398 cccaggctcctggccgggttgatgccggtgcc 429
           || |  ||||| |||||||| || ||||||||
Sbjct: 780 ccaaaactcctagccgggtttattccggtgcc 749



to top

>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 870

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 758 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 699

                                           
Query: 398 cccaggctcctggccgggttgatgccggtgcc 429
           || |  ||||| |||||||| || ||||||||
Sbjct: 698 ccaaaactcctagccgggtttattccggtgcc 667



to top

>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1169

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 842 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 783

                                           
Query: 398 cccaggctcctggccgggttgatgccggtgcc 429
           || |  ||||| |||||||| || ||||||||
Sbjct: 782 ccaaaactcctagccgggtttattccggtgcc 751



to top

>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1160

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 829 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 770

                                           
Query: 398 cccaggctcctggccgggttgatgccggtgcc 429
           || |  ||||| |||||||| || ||||||||
Sbjct: 769 ccaaaactcctagccgggtttattccggtgcc 738



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||||   ||||||||||| |  ||  |||||||||||| ||||||||||
Sbjct: 833 acccagaaaatccacatgtcatcccaggcatgctctctgttgtagatgatggcggccccc 774

                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 773 agactcctagcagggttgatgccggttccggtgatggggatggt 730



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 59/64 (92%)
 Strand = Plus / Minus

                                                                       
Query: 378 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 437
           |||||||||||| ||| || ||||||||||| || |||||||||||||||||||||||||
Sbjct: 830 tgttgtagatgatggcagctcccaggctccttgcagggttgatgccggtgccggtgatcg 771

               
Query: 438 ggat 441
           ||||
Sbjct: 770 ggat 767



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |  |||||||||||||| | ||||||||| || ||||| |||
Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagataacagcggctccc 712

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || ||||| || ||||||||||| || || ||||| |||||||||||
Sbjct: 711 agactcctagcagggttgatgccagttccagtgatggggatggtggc 665



to top

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 127/155 (81%)
 Strand = Plus / Minus

                                                                       
Query: 293 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 352
           ||||| |||||||||| ||| ||||| || || || || |  || ||||||||||| |||
Sbjct: 890 atgtattggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatc 831

                                                                       
Query: 353 cactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggcc 412
           ||||||||||||||||||||||  ||||||||||| || || || || || || |  || 
Sbjct: 830 cactgatcatcccaggccttgttgttgttgtagatcacagcagcaccaagactacgagca 771

                                              
Query: 413 gggttgatgccggtgccggtgatcgggatggtggc 447
           |||||||| || |||||||| || |||||||||||
Sbjct: 770 gggttgatacctgtgccggtaattgggatggtggc 736



to top

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || ||||||||||| || |  | |||| |||| || || || || 
Sbjct: 814 acccagaagatccaatggtcatcccaggctttctgttggttgaagataacagcagctccg 755

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || |||||||||||||||||||||||||||||||  |||||||||||
Sbjct: 754 agactcctggccgggttgatgccggtgccggtgactgggatggtggc 708



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| ||||||||||| |||| ||| | |||| ||||||  || || || 
Sbjct: 815 acccagaagatccagtgatcatcccatgcctggtcgtggttgaagatgatagcagctcca 756

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||| ||| |||||||||||||| || ||||| |||||||||||
Sbjct: 755 aggctccgggcggggttgatgccggttccagtgatagggatggtggc 709



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 123/150 (82%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 790 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 731

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||   ||| || |  |||  ||||||||||| |||||| || ||||||||    |||||
Sbjct: 730 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctaaaggggtt 671

                                         
Query: 418 gatgccggtgccggtgatcgggatggtggc 447
           |||||||||||||||||| |||||||||||
Sbjct: 670 gatgccggtgccggtgatggggatggtggc 641



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                         
Query: 362   tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 421
             ||||| ||||| | || |||||||||||||||||| || | ||||| ||| |||||||||
Sbjct: 91210 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 91269

                                       
Query: 422   ccggtgccggtgatcgggatggtggc 447
             || ||||||||||| |||||||||||
Sbjct: 91270 cccgtgccggtgatggggatggtggc 91295



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 247   gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
             |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 91012 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 91068



to top

>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds
          Length = 740

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||| ||||||||||||||||| | ||| |  ||||||||||| || ||||| ||||
Sbjct: 481 cccagaaaatccactgatcatcccatgtcttttttttgttgtagatcacagcggctccca 422

                                                         
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            ||| | ||||||||| ||||| || |||||||||||||| |||||
Sbjct: 421 agctacgggccgggttaatgccagttccggtgatcgggatcgtggc 376



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 96/114 (84%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           ||||||||||||||||||||| || || | |||||| |  ||| |||||||||||| |||
Sbjct: 855 ggggccgacccagaagatccaatggtcgttccaggcgtgatccctgttgtagatgatggc 796

                                                                 
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            || || |||||||| || ||||||||||| ||||| || || |||||||||||
Sbjct: 795 agcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggc 742



to top

>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete
             sequence
          Length = 178692

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Plus

                                                                         
Query: 379   gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
             |||||||| ||||||||| || | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 47653 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 47712

                      
Query: 439   gatggtggc 447
             |||||||||
Sbjct: 47713 gatggtggc 47721



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Minus

                                                                            
Query: 379      gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
                |||||||| ||||||||| || | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 17626978 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17626919

                         
Query: 439      gatggtggc 447
                |||||||||
Sbjct: 17626918 gatggtggc 17626910



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 306      agaaggccgcgatcgccgcg 325
                ||||||||||||||||||||
Sbjct: 13136748 agaaggccgcgatcgccgcg 13136767



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Minus

                                                                            
Query: 379      gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
                |||||||| ||||||||| || | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 17636018 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17635959

                         
Query: 439      gatggtggc 447
                |||||||||
Sbjct: 17635958 gatggtggc 17635950



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 306      agaaggccgcgatcgccgcg 325
                ||||||||||||||||||||
Sbjct: 13144088 agaaggccgcgatcgccgcg 13144107



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 116/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 301 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 360
           |||||||| |||||| | |||||| ||||| |  || || |||||||||||||| || ||
Sbjct: 899 gtggtagatggccgccagcgccgcaccgatgaacggaccaacccagaagatccagtggtc 840

                                                                       
Query: 361 atcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgat 420
            ||||| ||||  | |||||||||||||| |||||| || |||  ||| |||||||||||
Sbjct: 839 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 780

                                
Query: 421 gccggtgccggtgatcgggat 441
           |||||| || ||||| |||||
Sbjct: 779 gccggtccccgtgatggggat 759



to top

>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein
           2-2, complete cds
          Length = 1051

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 122/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 299 tggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactga 358
           |||||||||||||| || || || || || || | ||| || |||||||| ||||| || 
Sbjct: 874 tggtggtagaaggctgcaattgctgctccaatgaagggtcctacccagaaaatccattgg 815

                                                                       
Query: 359 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
           |||||||| |||||||| ||||||||||| || || || || || || || || ||||||
Sbjct: 814 tcatcccaagccttgtctttgttgtagataacagcagctccaagacttctagcggggttg 755

                                        
Query: 419 atgccggtgccggtgatcgggatggtggc 447
           ||||| ||||| ||||| |||||||||||
Sbjct: 754 atgccagtgccagtgattgggatggtggc 726



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||||   ||||||||||| |  || |||||||||| || ||||||||||
Sbjct: 841 acccagaaaatccacatgtcatcccaggcatgctctttgttgtagacgatggcggccccc 782

                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || ||||| || |||||||||||||| || ||||| ||||||||
Sbjct: 781 agactcctagcagggttgatgccggttccagtgatggggatggt 738



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                                                          
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || || |||||||||||||| ||||| || || || || ||||||||
Sbjct: 774 ccgagactcctggccgggttaatgccagttccagtaattgggatggt 728



to top

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |||| ||| |||||||||||||  || || || 
Sbjct: 815 acccagaaaatccagtggtcatcccatgcctcgtctttgttgtagatgatagcagctcca 756

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || |||||||| |||||||| || || |||||||| |||||||||||
Sbjct: 755 agactcctggcagggttgataccagttccggtgattgggatggtggc 709



to top

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||||| |||||| | |||||||||||| || || || 
Sbjct: 843 acccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgacagcagctcca 784

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           | |||||| || ||||||||||| || |||||||| |||||||||||
Sbjct: 783 aagctcctagcagggttgatgccagttccggtgatggggatggtggc 737



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 269 gccttgatggcgccggccctgagtatgtactggtggtaga 308
           ||||||||||| || ||||| || ||||| ||||||||||
Sbjct: 915 gccttgatggctcctgcccttaggatgtattggtggtaga 876



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 785 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 726

                                                          
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || || |||||||||||||| ||||| || || || || ||||||||
Sbjct: 725 ccgagactcctggccgggttaatgccagttccagtaattgggatggt 679



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                                                          
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || || |||||||||||||| ||||| || || || || ||||||||
Sbjct: 774 ccgagactcctggccgggttaatgccagttccagtaattgggatggt 728



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 158 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 99

                                                          
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || || |||||||||||||| ||||| || || || || ||||||||
Sbjct: 98  ccgagactcctggccgggttaatgccagttccagtaattgggatggt 52



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 417 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 358

                                                          
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || || |||||||||||||| ||||| || || || || ||||||||
Sbjct: 357 ccgagactcctggccgggttaatgccagttccagtaattgggatggt 311



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 823 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 764

                                                          
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || || |||||||||||||| ||||| || || || || ||||||||
Sbjct: 763 ccgagactcctggccgggttaatgccagttccagtaattgggatggt 717



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 798 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 739

                                                          
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || || |||||||||||||| ||||| || || || || ||||||||
Sbjct: 738 ccgagactcctggccgggttaatgccagttccagtaattgggatggt 692



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 832 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 773

                                                          
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || || |||||||||||||| ||||| || || || || ||||||||
Sbjct: 772 ccgagactcctggccgggttaatgccagttccagtaattgggatggt 726



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||  || || || 
Sbjct: 825 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 766

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || |||||||| |||||||| || || |||||||| |||||||||||
Sbjct: 765 agactcctggcagggttgataccagttccggtgattgggatggtggc 719



to top

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| ||||||||||||||||| |  | ||||||||| ||||| || || 
Sbjct: 838 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 779

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  || || || ||||||||||| ||||||||||| |||||||||||
Sbjct: 778 aaacttctagctgggttgatgccagtgccggtgattgggatggtggc 732



to top

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| ||||||||||||||||| |  | ||||||||| ||||| || || 
Sbjct: 354 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 295

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  || || || ||||||||||| ||||||||||| |||||||||||
Sbjct: 294 aaacttctagctgggttgatgccagtgccggtgattgggatggtggc 248



to top

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 92/110 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| |||||||| | |||||| || || || || 
Sbjct: 809 ccgacccagaagatccaatggtcatcccatgccttgtcttcgttgtatatcacagcagct 750

                                                             
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || | |||||| ||||||||||| || || |||||||| ||||| |||||
Sbjct: 749 ccaaagctcctagccgggttgataccagttccggtgattgggatagtggc 700



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 90  ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 31

                                     
Query: 398 cccaggctcctggccgggttgatgcc 423
           || || |||||||||||||| |||||
Sbjct: 30  ccgagactcctggccgggttaatgcc 5



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 95/114 (83%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           ||||||||||||||||||||| || ||   |||||| |  ||| |||||||||||| |||
Sbjct: 280 ggggccgacccagaagatccaatggtcgctccaggcatgatccctgttgtagatgatggc 221

                                                                 
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            || || |||||||| || ||||||||||| ||||| || || |||||||||||
Sbjct: 220 agcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggc 167



to top

>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA,
           complete cds
          Length = 1152

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 87/104 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| ||||||||||| |||||||| |||||||||||||  || || || 
Sbjct: 799 acccagaatatccagtgatcatcccatgccttgtctttgttgtagatgattgctgcacca 740

                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || |||||||| ||||| || || || ||||| || ||||||||
Sbjct: 739 agactcctggcggggttaatacctgtaccggtaatagggatggt 696



to top

>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA,
           complete cds
          Length = 1143

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 815 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 756

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||||||||| ||||||||||| || |||||
Sbjct: 755 aaactcctagccgggttgatgccggttccggtgatcggaatagtggc 709



to top

>emb|AJ249384.1|SOL249384 Spinacia oleracea mRNA for PM28B protein (pm28b gene)
          Length = 913

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| |||| |||||| || | |||||||||| |||| |  || || |||
Sbjct: 809 acccagaaaatccaatgatgatcccaagcatggtccttgttgaagataatagcagcaccc 750

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || |||||||| |||||||| ||||| || ||||| |||||||||||
Sbjct: 749 agactcctggctgggttgattccggtacctgtgatggggatggtggc 703



to top

>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.3 gene)
          Length = 1187

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || 
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           | |||||| || |||||||| || || |||||||| || ||||||||
Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggc 694



to top

>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.2 gene)
          Length = 978

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| |||||||||||||| || || |||||| ||||||| || || || 
Sbjct: 826 acccagaaaatccaatgatcatcccaggctttttcattgttgaagatgacagcagcgcca 767

                                  
Query: 401 aggctcctggccgggttgatgcc 423
           | ||||||||| |||||||||||
Sbjct: 766 aagctcctggcagggttgatgcc 744



to top

>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic
           protein 1 (mip1 gene)
          Length = 1187

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || 
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           | |||||| || |||||||| || || |||||||| || ||||||||
Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggc 694



to top

>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1041

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||||||||| ||||||||||| || |||||
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggc 694



to top

>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1079

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||||||||| ||||||||||| || |||||
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggc 694



to top

>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 791 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 732

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||||||||| ||||||||||| || |||||
Sbjct: 731 aaactcctagccgggttgatgccggttccggtgatcggaatagtggc 685



to top

>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1074

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||||||||| ||||||||||| || |||||
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggc 694



to top

>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1095

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||||||||| ||||||||||| || |||||
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggc 694



to top

>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZC08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 821

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 492 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 433

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||||||||| ||||||||||| || |||||
Sbjct: 432 aaactcctagccgggttgatgccggttccggtgatcggaatagtggc 386



to top

>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1083

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 801 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 742

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||||||||| ||||||||||| || |||||
Sbjct: 741 aaactcctagccgggttgatgccggttccggtgatcggaatagtggc 695



to top

>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence
          Length = 1104

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 816 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 757

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||||||||| ||||||||||| || |||||
Sbjct: 756 aaactcctagccgggttgatgccggttccggtgatcggaatagtggc 710



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || ||||||||||| |    |||||||||||||| ||| || || 
Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || |||||||| ||||||||||| || |||||||  |||||||||||
Sbjct: 814 agactcctggctgggttgatgccagttccggtgacggggatggtggc 768



to top

>gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, complete cds
          Length = 1049

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| ||||||||||| |||  ||| | |||| ||||||  || || || 
Sbjct: 797 acccagaagatccagtgatcatcccatgcccggtcttggttgaagatgatagcagctcca 738

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||| ||| ||| |||| ||||| |||||||| |||||||||||
Sbjct: 737 aggctccgggcgggggtgataccggttccggtgattgggatggtggc 691



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                        
Query: 341  acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
            |||||||| | ||| || ||||||||||| |  | |||||||||||||| ||| || || 
Sbjct: 1015 acccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgatggcagcgcca 956

                                                           
Query: 401  aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            || |||||||| ||||||||||| || |||||||  |||||||||||
Sbjct: 955  agactcctggctgggttgatgccagttccggtgacggggatggtggc 909



to top

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || |||||||| ||||||||   |||| | || ||||| |||
Sbjct: 828 ccgacccagaaaatccagtgttcatcccacgccttgtcgccgttgaaaatcacggccgcc 769

                                                             
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || |  ||||| ||||||||||| ||||| ||||||||||| || |||||
Sbjct: 768 ccgaaactcctcgccgggttgattccggtaccggtgatcggaatagtggc 719



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 335 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 394
           ||||| |||||||||||||| || |||||||| || | ||| |||||| |||||| ||||
Sbjct: 866 gggccaacccagaagatccagtggtcatcccatgcatggtctttgttgaagatgatggcg 807

                                                             
Query: 395 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || || || ||||| |||||||| ||||| || || || || ||||||||
Sbjct: 806 gctccaagactccttgccgggttaatgccagttccagttatggggatggt 757



to top

>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc
          Length = 800

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| || ||  | |||||| |||| |||||||| || 
Sbjct: 501 acccagaaaatccaatggtcatcccaagcttttccgttgttgaagatcacggcggcgccg 442

                                                 
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgg 438
           | |||||| |||||||| || |||||||||||||||||
Sbjct: 441 aagctcctcgccgggttaatcccggtgccggtgatcgg 404



to top

>gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, complete cds
          Length = 855

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||| ||||||||||||||||| | ||| |  |||  |||||| || ||||| ||||
Sbjct: 754 cccagaaaatccactgatcatcccatgtcttttttttgccgtagatcacagcggctccca 695

                                                         
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            ||| | ||||||||| ||||| || |||||||||||||| |||||
Sbjct: 694 agctacgggccgggttaatgccagttccggtgatcgggatcgtggc 649



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                                  
Query: 389      acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
                |||||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 21009488 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 21009439



to top

>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:B1274F11
          Length = 171257

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                                
Query: 389    acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
              |||||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 101577 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 101528



to top

>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full
           insert sequence
          Length = 1247

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 389 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
           |||||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 750 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 701



to top

>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full
           insert sequence
          Length = 1066

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 389 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
           |||||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 648 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 599



to top

>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full
           insert sequence
          Length = 1249

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 389 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
           |||||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 748 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 699



to top

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           |||||||| || ||||| |||||||||||||||||    ||||||||||| || || || 
Sbjct: 816 ccgacccaaaatatccattgatcatcccaggccttagaattgttgtagataaccgcagct 757

                                                             
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || | ||| || || |||||||| |||||||| ||||| |||||||||||
Sbjct: 756 ccgaagcttctagcggggttgattccggtgcctgtgattgggatggtggc 707



to top

>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full
           insert sequence
          Length = 1302

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 389 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
           |||||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 743 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 694



to top

>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone: P0478E02
          Length = 140715

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                               
Query: 389   acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
             |||||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 30788 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 30739



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 391 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |||||| || ||||| | ||| ||||||||||||||||||||||| |||||||||||
Sbjct: 887 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggc 831



to top

>gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRNA, complete cds
          Length = 1108

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 379 gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
           |||| |||| ||||| || || || ||||| ||||||||||| |||||||||||||||||
Sbjct: 742 gttgaagataacggcagcgccaagactcctagccgggttgattccggtgccggtgatcgg 683

                    
Query: 439 gatggtggc 447
            ||||||||
Sbjct: 682 aatggtggc 674



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                      
Query: 391   ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
             |||||| || ||||| | ||| ||||||||||||||||||||||| |||||||||||
Sbjct: 29597 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggc 29541



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
           insert sequence
          Length = 1318

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 391 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |||||| || ||||| | ||| ||||||||||||||||||||||| |||||||||||
Sbjct: 886 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggc 830



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                     
Query: 391  ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            |||||| || ||||| | ||| ||||||||||||||||||||||| |||||||||||
Sbjct: 4551 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggc 4495



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 391 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |||||| || ||||| | ||| ||||||||||||||||||||||| |||||||||||
Sbjct: 864 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggc 808



to top

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||| |||||||| ||||| ||||||||||||||  ||||||||||| ||||||
Sbjct: 883 ggggccaacccagaaaatccagtgatcatcccaggcgctgtccttgttgaagatga 828



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| ||||||| ||| || |  || ||||||||||||| ||| || || 
Sbjct: 867 acccagaagatccaatgatcattccatgcgtgttcattgttgtagatgatggctgcaccg 808

                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || || | ||||||||| || || |||||||||||||| |||||
Sbjct: 807 agacttcgggccgggttaatacccgtgccggtgatcggaatggt 764



to top

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 90/108 (83%), Gaps = 1/108 (0%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||  || || || 
Sbjct: 815 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 756

                                                           
Query: 401 aggctcctggc-cgggttgatgccggtgccggtgatcgggatggtggc 447
           || ||||||||  |||||||| || || |||||||| |||||||||||
Sbjct: 755 agactcctggcaggggttgataccagttccggtgattgggatggtggc 708



to top

>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds
          Length = 1217

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| ||||||||||| || | | |||||||| ||||||  || || || 
Sbjct: 805 acccagaaaatccagtgatcatcccaagcgtggcccttgttgaagatgatagcagcaccg 746

                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || ||||| || |||||||||||||| || ||||| ||||||||
Sbjct: 745 agactccttgctgggttgatgccggttccagtgattgggatggt 702



to top

>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein
           2-1, complete cds
          Length = 1311

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 140/176 (79%)
 Strand = Plus / Minus

                                                                       
Query: 248 ttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtag 307
           ||||| ||||| || || || ||||||||||| || || || || ||||| |||||||||
Sbjct: 907 ttgcttctgaaagatcccagagccttgatggctcctgctctcagaatgtattggtggtag 848

                                                                       
Query: 308 aaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccag 367
           ||||| || || || || || || |  || || | |||||||||||| || |||||||| 
Sbjct: 847 aaggcagcaatggcagctccaatgaaaggtccaagccagaagatccattggtcatcccaa 788

                                                                   
Query: 368 gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgcc 423
           || ||||||||||| |||||||| || || || |  ||||| || |||||||||||
Sbjct: 787 gctttgtccttgttatagatgacagcagctcctaaactcctagcagggttgatgcc 732



to top

>ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37180 (RD28) mRNA,
           complete cds
          Length = 1143

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||
Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggc 713



to top

>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence
          Length = 1159

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| ||| || |  || | |||||||||||  || || || 
Sbjct: 854 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 795

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || |||||||| ||||||||||| || |||||||| |||||||||||
Sbjct: 794 agactcctggcggggttgatgccagttccggtgatggggatggtggc 748



to top

>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like
           protein mRNA, partial cds
          Length = 474

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||| ||||||||||| ||||||||||| || ||||||||
Sbjct: 380 aggctcctggcagggttgatgccagtgccggtgataggtatggtggc 334



to top

>gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (At2g37180) mRNA,
           complete cds
          Length = 889

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 752 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 693

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||
Sbjct: 692 aaactcctagccgggttgataccggttccggtgatcggaatagtggc 646



to top

>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b
          Length = 1095

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||  || || 
Sbjct: 767 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggacgctccg 708

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||||||||| ||||||||||| || |||||
Sbjct: 707 aaactcctagccgggttgatgccggttccggtgatcggaatagtggc 661



to top

>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone
           pNY507
          Length = 1107

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| ||| || |  || | |||||||||||  || || || 
Sbjct: 794 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 735

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || |||||||| ||||||||||| || |||||||| |||||||||||
Sbjct: 734 agactcctggcggggttgatgccagttccggtgatggggatggtggc 688



to top

>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone
           pTOM75
          Length = 859

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| ||| || |  || | |||||||||||  || || || 
Sbjct: 605 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 546

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || |||||||| ||||||||||| || |||||||| |||||||||||
Sbjct: 545 agactcctggcggggttgatgccagttccggtgatggggatggtggc 499



to top

>gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 2C (At2g37180) mRNA, complete cds
          Length = 1151

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||
Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggc 713



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 437
           ||||||||| || |||||| || ||||| |  || ||||||||||||||||||||||| |
Sbjct: 829 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 770

                  
Query: 438 ggatggt 444
           |||||||
Sbjct: 769 ggatggt 763



to top

>gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein (PIP2;3) mRNA, complete
           cds
          Length = 1279

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| |||||||| || || | ||| || ||||| | |||| |||| ||||| || || 
Sbjct: 797 acccaaaagatccaatggtctttccaagctttgtcttggttgaagataacggcagctcca 738

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || ||||| || |||||||||||||||||||| ||||| ||||||||
Sbjct: 737 agactccttgctgggttgatgccggtgccggtaatcggaatggtggc 691



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 437
           ||||||||| || |||||| || ||||| |  || ||||||||||||||||||||||| |
Sbjct: 820 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 761

                  
Query: 438 ggatggt 444
           |||||||
Sbjct: 760 ggatggt 754



to top

>gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete sequence
          Length = 1060

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||
Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggc 713



to top

>dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative transmenbrane channel
           protein
          Length = 1121

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 802 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 743

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||
Sbjct: 742 aaactcctagccgggttgataccggttccggtgatcggaatagtggc 696



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || ||||||||||| |  | |||||||||||||| ||| || || 
Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgatggcagcgcca 819

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || || || || ||||||||||| || |||||||  |||||||||||
Sbjct: 818 agacttcttgctgggttgatgccagttccggtgacggggatggtggc 772



to top

>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 437
           ||||||||| || |||||| || ||||| |  || ||||||||||||||||||||||| |
Sbjct: 253 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 194

                  
Query: 438 ggatggt 444
           |||||||
Sbjct: 193 ggatggt 187



to top

>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c,
           complete cds
          Length = 1065

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || ||||| || 
Sbjct: 788 acccagaatatccagtggtcatcccacggcttggactcgttgtagataaccgcggctccg 729

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |  |||||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 728 aaactcctggccgggttaataccggttccggtgatcggaatagtggc 682



to top

>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660
           (PIP2;4/PIP2F) mRNA, complete cds
          Length = 1139

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 99/122 (81%)
 Strand = Plus / Minus

                                                                       
Query: 326 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 385
           |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| 
Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764

                                                                       
Query: 386 atgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtg 445
           || ||||| || || | ||| |  ||||||||||| ||||| |||||||| || ||||||
Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggtgatgggaatggtg 704

             
Query: 446 gc 447
           ||
Sbjct: 703 gc 702



to top

>gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic protein (mip3) mRNA,
           partial cds
          Length = 495

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 362 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 421
           |||||||||||||| ||||||||||| || || || || ||||| || || ||||| |||
Sbjct: 485 tcccaggccttgtcattgttgtagatcactgcagctccaaggcttcttgctgggtttatg 426

                                     
Query: 422 ccggtgccggtgatcgggatggtggc 447
           || ||||| ||||| ||||| |||||
Sbjct: 425 ccagtgccagtgattgggattgtggc 400



to top

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 377 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
           |||||||| ||||| || ||||| | |||||||||||||||||| || ||||| ||||| 
Sbjct: 759 ttgttgtacatgactgcagccccaaagctcctggccgggttgataccagtgccagtgatg 700

                     
Query: 437 gggatggtgg 446
           || |||||||
Sbjct: 699 ggaatggtgg 690



to top

>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence
          Length = 1120

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 99/122 (81%)
 Strand = Plus / Minus

                                                                       
Query: 326 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 385
           |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| 
Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764

                                                                       
Query: 386 atgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtg 445
           || ||||| || || | ||| |  ||||||||||| ||||| |||||||| || ||||||
Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggtgatgggaatggtg 704

             
Query: 446 gc 447
           ||
Sbjct: 703 gc 702



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||  || || 
Sbjct: 814 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 755

                                                        
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatg 442
           || || ||||| || |||||||| || || |||||||| ||||||
Sbjct: 754 ccaagactcctagctgggttgattcctgttccggtgattgggatg 710



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| || ||||||||||| | |||| ||||||||||||
Sbjct: 770 acccagaagatccagtggtcatcccaggcgtggtccctgttgtagatga 722



to top

>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds
          Length = 1278

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                       
Query: 343 ccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccag 402
           |||||||||||| || |||||||| || ||||||||||||||||| || || || || | 
Sbjct: 768 ccagaagatccattggtcatcccaagctttgtccttgttgtagatcacagcagctccaaa 709

                                                        
Query: 403 gctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
            || || || |||||||| || || || ||||| |||||||||||
Sbjct: 708 acttctagcagggttgataccagttccagtgattgggatggtggc 664



to top

>gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map ve018, complete
             sequence
          Length = 80736

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                         
Query: 359   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
             |||||||| | ||||  |||||| ||||| ||||| || || |  ||||| |||||||||
Sbjct: 25113 tcatcccatggcttgctcttgttatagattacggcagctccgaaactcctagccgggttg 25054

                                          
Query: 419   atgccggtgccggtgatcgggatggtggc 447
             |||||||| ||||||||||| || |||||
Sbjct: 25053 atgccggttccggtgatcggaatagtggc 25025



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                         
Query: 359   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
             |||||||| | ||||  ||||||  |||| |||||||| || |  ||||| |||||||||
Sbjct: 20235 tcatcccatggcttgctcttgttaaagattacggcggctccgaaactcctagccgggttg 20294

                                          
Query: 419   atgccggtgccggtgatcgggatggtggc 447
             || ||||| ||||||||||| || |||||
Sbjct: 20295 ataccggttccggtgatcggaatagtggc 20323



to top

>gb|DQ228343.1| Solanum tuberosum clone 148A12 unknown mRNA
          Length = 1082

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 404 ctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |||||||| ||||||||||| || |||||||| |||||||||||
Sbjct: 775 ctcctggcggggttgatgccagttccggtgatggggatggtggc 732



to top

>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||||||
Sbjct: 288 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccactg 347



to top

>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||||||
Sbjct: 489 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccactg 430



to top

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                       
Query: 376 cttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgat 435
           ||||||||| |||||||| || || |  || ||||| ||||||||||| ||||| |||||
Sbjct: 763 cttgttgtaaatgacggcagctccaaaacttctggctgggttgatgccagtgccagtgat 704

                       
Query: 436 cgggatggtggc 447
            |||||||||||
Sbjct: 703 ggggatggtggc 692



to top

>emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for putative aquaporin, exon 1
          Length = 880

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                       
Query: 376 cttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgat 435
           ||||||||| |||||||| || || |  || ||||| ||||||||||| ||||| |||||
Sbjct: 741 cttgttgtaaatgacggcagctccaaaacttctggctgggttgatgccagtgccagtgat 682

                       
Query: 436 cgggatggtggc 447
            |||||||||||
Sbjct: 681 ggggatggtggc 670



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||| ||| || |||||||| || |||||||||||| |||||| ||| || || 
Sbjct: 815 acccagaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagcacca 756

                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
           || || || || |||||||| || || || ||||| ||||||||
Sbjct: 755 agacttcttgctgggttgattccagttccagtgatggggatggt 712



to top

>dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane intrinsic protein
           2;3, complete cds
          Length = 1218

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 404 ctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           |||||||||||||| |||||||| |||||||  |||||||||||
Sbjct: 790 ctcctggccgggttaatgccggtaccggtgactgggatggtggc 747



to top

>gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel protein MipE mRNA,
           complete cds
          Length = 1179

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 404 ctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||| || ||||||||||||||||| ||||| |||||||||||
Sbjct: 808 ctcctagcagggttgatgccggtgccagtgatggggatggtggc 765



to top

>gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipE) mRNA, partial cds
          Length = 963

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 404 ctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           ||||| || ||||||||||||||||| ||||| |||||||||||
Sbjct: 592 ctcctagcagggttgatgccggtgccagtgatggggatggtggc 549



to top

>ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G61430 (PIP1A) mRNA,
           complete cds
          Length = 1254

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 969 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 910

                                                              
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
            || || ||||| || || ||||||||||| ||||| ||||| ||||||||
Sbjct: 909 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggt 859



to top

>ref|XM_470514.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 843

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 413 gggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||| ||||||||||| |||||||||||
Sbjct: 656 gggttgatgccagtgccggtgatggggatggtggc 622



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 413      gggttgatgccggtgccggtgatcgggatggtggc 447
                ||||||||||| ||||||||||| |||||||||||
Sbjct: 36057500 gggttgatgccagtgccggtgatggggatggtggc 36057466



to top

>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds
          Length = 1248

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
           |||||||||||||  ||||  || || ||||| || |||||||| ||||||||||| || 
Sbjct: 785 ttgttgtagatgatagcggtaccaagactcctagcagggttgataccggtgccggtaatg 726

                      
Query: 437 gggatggtggc 447
           |||||||||||
Sbjct: 725 gggatggtggc 715



to top

>emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1
          Length = 1204

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| |||||||| || || ||||| |||| |||  ||||||||||||  || || || 
Sbjct: 854 acccaaaagatccagtggtcgtcccatgcctggtctgtgttgtagatgatcgcagctcca 795

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || ||||| || ||||||||||| || |||||||| || ||||||||
Sbjct: 794 agactcctagcggggttgatgccagttccggtgatgggaatggtggc 748



to top

>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein
          Length = 1179

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 413 gggttgatgccggtgccggtgatcgggatggtggc 447
           |||||||| |||||||||||||| |||||||||||
Sbjct: 778 gggttgattccggtgccggtgatggggatggtggc 744



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           |||||||| |||| ||| || |||||||| || |||||||||||| |||||| ||| || 
Sbjct: 800 ccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagct 741

                                  
Query: 398 cccaggctcctggccgggttgat 420
           || || ||||| || ||||||||
Sbjct: 740 ccaagactccttgctgggttgat 718



to top

>gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genomic sequence, complete
              sequence
          Length = 164179

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 413    gggttgatgccggtgccggtgatcgggatggtggc 447
              ||||||||||| ||||||||||| |||||||||||
Sbjct: 119011 gggttgatgccagtgccggtgatggggatggtggc 118977



to top

>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59
          Length = 199199

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                         
Query: 374   tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 433
             |||||||||||||||| ||| || || || |||||||||||||| ||||| || || || 
Sbjct: 75489 tccttgttgtagatgatggcagctccgagactcctggccgggttaatgccagttccagta 75430

                        
Query: 434   atcgggatggt 444
             || ||||||||
Sbjct: 75429 attgggatggt 75419



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   ccgacccagaagatccactg 357
             ||||||||||||||||||||
Sbjct: 75658 ccgacccagaagatccactg 75639



to top

>emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, BAC clone F16G20 (ESSAII
             project)
          Length = 97006

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                         
Query: 374   tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 433
             |||||||||||||||| ||| || || || |||||||||||||| ||||| || || || 
Sbjct: 33957 tccttgttgtagatgatggcagctccgagactcctggccgggttaatgccagttccagta 33898

                        
Query: 434   atcgggatggt 444
             || ||||||||
Sbjct: 33897 attgggatggt 33887



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   ccgacccagaagatccactg 357
             ||||||||||||||||||||
Sbjct: 34126 ccgacccagaagatccactg 34107



to top

>emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene)
          Length = 995

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 873 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 814

                                                              
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
            || || ||||| || || ||||||||||| ||||| ||||| ||||||||
Sbjct: 813 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggt 763



to top

>gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds
          Length = 861

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 786 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 727

                                                              
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
            || || ||||| || || ||||||||||| ||||| ||||| ||||||||
Sbjct: 726 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggt 676



to top

>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete
             sequence
          Length = 96827

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Minus

                                                                         
Query: 355   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 414
             |||||||||||| ||||| |  ||||||||||||||||| || || |  ||||| |||||
Sbjct: 65646 ctgatcatcccaagccttttgattgttgtagatgacggcagctccaaaactcctagccgg 65587

                            
Query: 415   gttgatgccggtgcc 429
             ||| || ||||||||
Sbjct: 65586 gtttattccggtgcc 65572



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   ccgacccagaagatccactg 357
             ||||||||||||||||||||
Sbjct: 65741 ccgacccagaagatccactg 65722



to top

>gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds
          Length = 1092

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 853 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 794

                                                              
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
            || || ||||| || || ||||||||||| ||||| ||||| ||||||||
Sbjct: 793 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggt 743



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 413      gggttgatgccggtgccggtgatcgggatggtggc 447
                ||||||||||| ||||||||||| |||||||||||
Sbjct: 36147574 gggttgatgccagtgccggtgatggggatggtggc 36147540



to top

>emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH79ZH01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 724 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 665

                                                              
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
            || || ||||| || || ||||||||||| ||||| ||||| ||||||||
Sbjct: 664 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggt 614



to top

>emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS55ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1059

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 832 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 773

                                                              
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
            || || ||||| || || ||||||||||| ||||| ||||| ||||||||
Sbjct: 772 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggt 722



to top

>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds
          Length = 909

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           |||||||||||||| || |||||||| ||||| || |||||||||||
Sbjct: 740 acccagaagatccaatggtcatcccacgccttctcgttgttgtagat 694



to top

>gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete sequence
          Length = 1234

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 969 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 910

                                                              
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
            || || ||||| || || ||||||||||| ||||| ||||| ||||||||
Sbjct: 909 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggt 859



to top

>gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA, complete cds
          Length = 920

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 832 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 773

                                                              
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggt 444
            || || ||||| || || ||||||||||| ||||| ||||| ||||||||
Sbjct: 772 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggt 722



to top

>dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane intrinsic protein,
           complete cds
          Length = 1145

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
           ||||||||||||| ||| ||||| ||||| || || ||||||||||| ||||| || || 
Sbjct: 845 ttgttgtagatgatggcagccccaaggcttctagcagggttgatgccagtgcctgtaatg 786

                      
Query: 437 gggatggtggc 447
           || ||||||||
Sbjct: 785 ggaatggtggc 775



to top

>dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-154-B04, full
           insert sequence
          Length = 1099

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 413 gggttgatgccggtgccggtgatcgggatggtggc 447
           ||||||||||| ||||||||||| |||||||||||
Sbjct: 744 gggttgatgccagtgccggtgatggggatggtggc 710



to top

>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1298

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 413 gggttgatgccggtgccggtgatcgggatggtggc 447
           |||||||||||||| |||||||| |||||||||||
Sbjct: 774 gggttgatgccggttccggtgatggggatggtggc 740



to top

>gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, complete cds
          Length = 1158

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| |||||||| || || ||||| |||| |||  ||||||||||||  || || || 
Sbjct: 854 acccaaaagatccagtggtcgtcccatgcctggtctgtgttgtagatgatcgcagctcca 795

                                                          
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 447
           || ||||| || ||||||||||| || |||||||| || ||||||||
Sbjct: 794 agactcctagcggggttgatgccagttccggtgatgggaatggtggc 748



to top

>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1179

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 413 gggttgatgccggtgccggtgatcgggatggtggc 447
           |||||||| |||||||||||||| |||||||||||
Sbjct: 778 gggttgattccggtgccggtgatggggatggtggc 744



to top

>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b,
           complete cds
          Length = 1087

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || ||||| || 
Sbjct: 789 acccagaaaatccagtggtcatcccacggcttggactcgttgtagataaccgcggctcca 730

                                              
Query: 401 aggctcctggccgggttgatgccggtgccggtgat 435
           |  |||||||||||||| || ||||| ||||||||
Sbjct: 729 aaactcctggccgggttaatcccggttccggtgat 695



to top

>ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) transcript variant
           AT4G00430.2 mRNA, complete cds
          Length = 1367

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 996 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 937

                                                 
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgg 438
           || || || || |||||||| ||||| |||||||||||
Sbjct: 936 agacttctagctgggttgattccggtcccggtgatcgg 899



to top

>ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G00430 (TMP-C)
           transcript variant AT4G00430.1 mRNA, complete cds
          Length = 1643

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 868 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 809

                                                 
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgg 438
           || || || || |||||||| ||||| |||||||||||
Sbjct: 808 agacttctagctgggttgattccggtcccggtgatcgg 771



to top

>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2
          Length = 1214

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || || ||||| ||||||||   |||| | || ||||| |||
Sbjct: 794 ccgacccagaaaatccagtgttcgtcccatgccttgtcgccgttgaaaatcacggccgcc 735

                                                 
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgat 435
           || |  ||||| ||||||||||| ||||| ||||||||
Sbjct: 734 ccgaaactcctcgccgggttgattccggtaccggtgat 697



to top

>gb|BT000330.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c
           (At4g00430) mRNA, complete cds
          Length = 1331

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 782 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 723

                                                 
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgg 438
           || || || || |||||||| ||||| |||||||||||
Sbjct: 722 agacttctagctgggttgattccggtcccggtgatcgg 685



to top

>emb|AL132962.1|ATF2A19 Arabidopsis thaliana DNA chromosome 3, BAC clone F2A19
          Length = 95993

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Minus

                                                                         
Query: 359   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
             ||||||||||  | ||| |||||||||||||  || || || ||||| || || ||||||
Sbjct: 29060 tcatcccaggaatggtctttgttgtagatgattgcagctccaaggcttctagctgggttg 29001

                                       
Query: 419   atgccggtgccggtgatcgggatggt 444
             ||||| ||||| ||||| ||||||||
Sbjct: 29000 atgcctgtgccagtgattgggatggt 28975



to top

>gb|AY120785.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c
           (At4g00430) mRNA, complete cds
          Length = 1083

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 860 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 801

                                                 
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgg 438
           || || || || |||||||| ||||| |||||||||||
Sbjct: 800 agacttctagctgggttgattccggtcccggtgatcgg 763



to top

>gb|AY099825.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c
           (At4g00430) mRNA, complete cds
          Length = 1631

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 856 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 797

                                                 
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgg 438
           || || || || |||||||| ||||| |||||||||||
Sbjct: 796 agacttctagctgggttgattccggtcccggtgatcgg 759



to top

>gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water channel AQP-t1 mRNA,
           complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 326 ccgatcatggggccgacccagaagatccactgat 359
           ||||||||||| ||||||||||||||||| ||||
Sbjct: 761 ccgatcatgggaccgacccagaagatccagtgat 728



to top

>gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds
          Length = 864

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 782 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 723

                                                 
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgg 438
           || || || || |||||||| ||||| |||||||||||
Sbjct: 722 agacttctagctgggttgattccggtcccggtgatcgg 685



to top

>emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS77ZD01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1155

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 975 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 916

                                                 
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgg 438
           || || || || |||||||| ||||| |||||||||||
Sbjct: 915 agacttctagctgggttgattccggtcccggtgatcgg 878



to top

>emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL83ZB07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1000

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 843 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 784

                                                 
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgg 438
           || || || || |||||||| ||||| |||||||||||
Sbjct: 783 agacttctagctgggttgattccggtcccggtgatcgg 746



to top

>emb|AJ605568.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-3 gene),
           clone pR450-4
          Length = 452

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Minus

                                                                       
Query: 359 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
           ||||||||||||||||||| |||||| || || || || || |  ||||| || ||||||
Sbjct: 428 tcatcccaggccttgtcctggttgtaaataacagcagctcctaaactccttgctgggttg 369

                                     
Query: 419 atgccggtgccggtgatcgggatggt 444
           ||||| ||||| ||||| || |||||
Sbjct: 368 atgccagtgccagtgattggaatggt 343



to top

>dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protein, complete cds
          Length = 1024

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 819 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 760

                                                 
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgg 438
           || || || || |||||||| ||||| |||||||||||
Sbjct: 759 agacttctagctgggttgattccggtcccggtgatcgg 722



to top

>dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24
          Length = 77999

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                         
Query: 362   tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 421
             ||||||||||| || |||||||| || ||||| || || | ||| |  ||||||||||| 
Sbjct: 19109 tcccaggccttttcgttgttgtaaataacggcagctccaaagctacgagccgggttgata 19168

                                       
Query: 422   ccggtgccggtgatcgggatggtggc 447
             ||||| |||||||| || ||||||||
Sbjct: 19169 ccggttccggtgatgggaatggtggc 19194



to top

>gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 326 ccgatcatggggccgacccagaagatccactgat 359
           ||||||||||| ||||||||||||||||| ||||
Sbjct: 761 ccgatcatgggaccgacccagaagatccagtgat 728



to top

>dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane protein, complete cds
          Length = 1100

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 915 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 856

                                                 
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgg 438
           || || || || |||||||| ||||| |||||||||||
Sbjct: 855 agacttctagctgggttgattccggtcccggtgatcgg 818



to top

>ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channel AT3G54820
           (PIP2;5/PIP2D) mRNA, complete cds
          Length = 1229

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 851 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 803



to top

>gb|AY333929.1| Pringlea antiscorbutica putative transmembrane protein mRNA,
           partial cds
          Length = 380

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || || ||||| |  | ||||||||||||||| | |||||| 
Sbjct: 219 ccgacccagaaaatccaatggtcgtcccaagagtggtccttgttgtagataatggcggct 160

                                                    
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgg 438
           || ||||| || || |||||||| || || ||||| |||||
Sbjct: 159 ccaaggcttctagctgggttgattccagttccggttatcgg 119



to top

>gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758) putative
           aquaporin/plasma membrane intrinsic protein (At3g54820)
           mRNA, complete cds
          Length = 1143

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 771 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 723



to top

>gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP protein (At3g54820)
           mRNA, complete cds
          Length = 892

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 755 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 707



to top

>gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP protein (At3g54820)
           mRNA, complete cds
          Length = 1194

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 850 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 802



to top

>emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB54ZF09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 897

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 571 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 523



to top

>gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete sequence
          Length = 1222

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 852 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 804



to top

>emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene), clone pP5L
          Length = 1157

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || ||||||||  | ||||| |||||||||||||| || || || 
Sbjct: 819 acccagaaaatccaatggtcatcccacactttgtcattgttgtagatgacagcagctcca 760

                            
Query: 401 aggctcctggccgggtt 417
           | ||||||||| |||||
Sbjct: 759 aagctcctggctgggtt 743



to top

>emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene), clone pP2L
          Length = 1095

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| |||||||||||| | | |||||||||| ||||||
Sbjct: 868 acccagaaaatccaatgatcatcccagccttggtccttgttgaagatga 820



to top

>gb|U27347.1|GMU27347 Glycine max putative water channel protein (Pip1) mRNA, complete
           cds
          Length = 1255

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| |||||||| || |||||||||||||| |  | |||||| ||||| || || || 
Sbjct: 848 acccaaaagatccaatggtcatcccaggccttctgttggttgtacatgacagcagctcct 789

                                        
Query: 401 aggctcctggccgggttgatgccggtgcc 429
           |||||||| || ||||| ||||| |||||
Sbjct: 788 aggctcctagcagggttaatgccagtgcc 760



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 908 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 857


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,633,304
Number of Sequences: 3902068
Number of extensions: 3633304
Number of successful extensions: 66463
Number of sequences better than 10.0: 359
Number of HSP's better than 10.0 without gapping: 363
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64688
Number of HSP's gapped (non-prelim): 1738
length of query: 447
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 425
effective length of database: 17,147,199,772
effective search space: 7287559903100
effective search space used: 7287559903100
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top