ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet95d01 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AB029935.1| Triticum aestivum mRNA for chitinase 2, complete cds Length = 1163 Score = 383 bits (193), Expect = e-103 Identities = 253/273 (92%) Strand = Plus / Minus Query: 192 atctcactgcaccgcgagcccgatgttgaacgacaattggttgtagcagtcgaggttatt 251 ||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||| Sbjct: 983 atctcactgtgccgcgagcccaacgttgaacgacaattggttgtagcagtcgaggttatt 924 Query: 252 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccac 311 |||||||||||||||||| |||||||| ||||||||||||||||||||||| || ||||| Sbjct: 923 cccgtagccgatgccgaaaatgtcacaatagcgcttgtagaacccgatccgatccgccac 864 Query: 312 cttgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgcc 371 |||||||||||||||| ||||||||||||||||||| ||||||||||||||||| || || Sbjct: 863 cttgtcgttctgccccatgccgcattcgatcccgccgttgatgacgttggtgatgacacc 804 Query: 372 gtatccgggtacccgtccggccgcgctgtccctggccgtcggcctccacaaccccgtgat 431 || ||||||||||||||||| ||||| |||||||||||||| |||||| ||||||||| Sbjct: 803 atacccgggtacccgtccggctgcgctatccctggccgtcggagtccacagccccgtgat 744 Query: 432 cacgtcgtggcacgacggcttgttggactgcgt 464 |||||| |||||||||||||||||||||||||| Sbjct: 743 cacgtcatggcacgacggcttgttggactgcgt 711 Score = 89.7 bits (45), Expect = 8e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 81 aggtctggacatccatttatttggtcataaaatacttaccaagattatttatttgtgggt 140 |||||||| |||||||||||||||||||||| ||||| |||||||||||||||| || || Sbjct: 1085 aggtctggtcatccatttatttggtcataaagtacttcccaagattatttatttatgtgt 1026 Query: 141 gatca 145 ||||| Sbjct: 1025 gatca 1021
>gb|AF000966.1|AF000966 Poa pratensis chitinase (Chi2) gene, complete cds Length = 1080 Score = 137 bits (69), Expect = 4e-29 Identities = 132/153 (86%) Strand = Plus / Minus Query: 233 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 292 |||||||||| ||||| || ||||||| || ||||| || ||| |||||||||||||||| Sbjct: 967 tgtagcagtccaggttgtttccgtagctgacgccgaggaggtcgcagtagcgcttgtaga 908 Query: 293 acccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattga 352 ||||||||||||| || || || || |||||| |||||||| |||| ||||||||||| Sbjct: 907 acccgatccggtctgcgacgcggttgtcctgccctttgccgcactcgagcccgccattga 848 Query: 353 tgacgttggtgatcacgccgtatccgggtaccc 385 ||| |||||||||||||||||| ||||| |||| Sbjct: 847 tgatgttggtgatcacgccgtacccgggcaccc 815
>gb|AF000965.1|AF000965 Poa pratensis chitinase (Chi3) pseudogene sequence Length = 1173 Score = 137 bits (69), Expect = 4e-29 Identities = 135/157 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| ||||| | |||||||| || ||||| || ||| |||||||||||| Sbjct: 1134 tggttgtagcagtccaggttgtccccgtagctgacgccgaggaggtcgcagtagcgcttg 1075 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||||||||||||| |||||| || || || ||||||||||||||| |||| |||||| Sbjct: 1074 tagaacccgatcctgtcggcgacgcggttgtcctgccccttgccgcactcgagcccgccg 1015 Query: 349 ttgatgacgttggtgatcacgccgtatccgggtaccc 385 ||||||| ||| |||||||||||||| ||||| |||| Sbjct: 1014 ttgatgatgttagtgatcacgccgtacccgggcaccc 978
>gb|AC132492.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0605G01, complete sequence Length = 146303 Score = 135 bits (68), Expect = 1e-28 Identities = 185/224 (82%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||| ||||||||||||||| |||||||||||||||||| | ||| |||||||||| | Sbjct: 96288 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctgg 96229 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||||| |||||||||| |||||| ||||| | || ||||| || | |||||| Sbjct: 96228 tagaagccgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccg 96169 Query: 349 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 408 ||||||| |||||||||||||||||| || || ||||| ||||||||| |||||| | Sbjct: 96168 ttgatgatgttggtgatcacgccgtaccccggcacccgcccggccgcgatgtcccccgag 96109 Query: 409 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggctt 452 ||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 96108 ctcggcgtccactgccccgtgatcacgtcgtggcacgacggctt 96065 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 252 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 107042 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 106986 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttgtt 455 |||||||||||||||||||| |||||||||||| Sbjct: 87182 ccccgtgatcacgtcgtggctcgacggcttgtt 87150 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 87376 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 87317 Query: 289 tagaacccgatccggt 304 ||||| |||||||||| Sbjct: 87316 tagaagccgatccggt 87301
>gb|AY444342.1| Oryza sativa chitinase gene, complete cds Length = 1101 Score = 135 bits (68), Expect = 1e-28 Identities = 185/224 (82%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||| ||||||||||||||| |||||||||||||||||| | ||| |||||||||| | Sbjct: 1064 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctgg 1005 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||||| |||||||||| |||||| ||||| | || ||||| || | |||||| Sbjct: 1004 tagaagccgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccg 945 Query: 349 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 408 ||||||| |||||||||||||||||| || || ||||| ||||||||| |||||| | Sbjct: 944 ttgatgatgttggtgatcacgccgtaccccggcacccgcccggccgcgatgtcccccgag 885 Query: 409 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggctt 452 ||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 884 ctcggcgtccactgccccgtgatcacgtcgtggcacgacggctt 841
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 135 bits (68), Expect = 1e-28 Identities = 185/224 (82%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||| ||||||||||||||| |||||||||||||||||| | ||| |||||||||| | Sbjct: 19292213 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctgg 19292154 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||||| |||||||||| |||||| ||||| | || ||||| || | |||||| Sbjct: 19292153 tagaagccgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccg 19292094 Query: 349 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 408 ||||||| |||||||||||||||||| || || ||||| ||||||||| |||||| | Sbjct: 19292093 ttgatgatgttggtgatcacgccgtaccccggcacccgcccggccgcgatgtcccccgag 19292034 Query: 409 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggctt 452 ||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 19292033 ctcggcgtccactgccccgtgatcacgtcgtggcacgacggctt 19291990 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 252 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 19302967 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 19302911 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttgtt 455 |||||||||||||||||||| |||||||||||| Sbjct: 19283107 ccccgtgatcacgtcgtggctcgacggcttgtt 19283075 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 19283301 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 19283242 Query: 289 tagaacccgatccggt 304 ||||| |||||||||| Sbjct: 19283241 tagaagccgatccggt 19283226 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacga 446 |||||| ||||||||||||||||| Sbjct: 2157850 ccccgtcatcacgtcgtggcacga 2157827
>gb|L37289.1|RICCHITA Oryza sativa chitinase mRNA, complete cds Length = 1291 Score = 135 bits (68), Expect = 1e-28 Identities = 185/224 (82%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||| ||||||||||||||| |||||||||||||||||| | ||| |||||||||| | Sbjct: 1007 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctgg 948 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||||| |||||||||| |||||| ||||| | || ||||| || | |||||| Sbjct: 947 tagaagccgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccg 888 Query: 349 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 408 ||||||| |||||||||||||||||| || || ||||| ||||||||| |||||| | Sbjct: 887 ttgatgatgttggtgatcacgccgtaccccggcacccgcccggccgcgatgtcccccgag 828 Query: 409 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggctt 452 ||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 827 ctcggcgtccactgccccgtgatcacgtcgtggcacgacggctt 784
>gb|L40337.1|RICRCH1 Oryza sativa chitinase (Rcht1) mRNA, complete cds Length = 1204 Score = 127 bits (64), Expect = 3e-26 Identities = 184/224 (82%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||| ||||||||||||||| |||||||||||||||||| | || |||||||||| | Sbjct: 971 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgttgcagtagcgctgg 912 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||||| |||||||||| |||||| ||||| | || ||||| || | |||||| Sbjct: 911 tagaagccgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccg 852 Query: 349 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 408 ||||||| |||||||||||||||||| || || ||||| ||||||||| |||||| | Sbjct: 851 ttgatgatgttggtgatcacgccgtaccccggcacccgcccggccgcgatgtcccccgag 792 Query: 409 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggctt 452 ||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 791 ctcggcgtccactgccccgtgatcacgtcgtggcacgacggctt 748
>gb|L34211.1|BLYCHI33A Hordeum vulgare chitinase (CHI33) gene, complete cds Length = 1779 Score = 109 bits (55), Expect = 8e-21 Identities = 190/235 (80%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| ||||||||||| ||| | ||||| |||||||||| | Sbjct: 1634 tggttgtagcagtcgaggttgcccccgtagccgacgccaaggatgttgcagtagcgctgg 1575 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||||| |||||||||||||| || | || | |||| | ||||| |||| |||||| Sbjct: 1574 tagaagccgatccggtcggcaacacggctgtccgcccccctaccgcactcgagcccgccg 1515 Query: 349 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 408 ||||||| ||||||||| |||||||| ||||| |||| || |||||| |||| |||| Sbjct: 1514 ttgatgatgttggtgatgacgccgtagccgggcaccctccccgccgcggtgtctgcggcc 1455 Query: 409 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcg 463 |||||| |||| |||||||||||| |||| | ||||||||||||| ||||| Sbjct: 1454 gtcggcgtccattggcccgtgatcacggcgtgagaggacggcttgttggcctgcg 1400
>gb|AY106654.1| Zea mays PCO078819 mRNA sequence Length = 574 Score = 101 bits (51), Expect = 2e-18 Identities = 170/209 (81%), Gaps = 3/209 (1%) Strand = Plus / Plus Query: 251 tcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggcca 310 ||||||||||||||| ||||| || ||||||||||||||||| || |||||||||| | Sbjct: 229 tcccgtagccgatgcggaagacatcgcagtagcgcttgtagaagccaatccggtcggtga 288 Query: 311 ccttgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgc 370 || | || | ||| | ||||| |||||||| || ||||||| |||||||||||||| Sbjct: 289 cccgggggtccgtcccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgc 348 Query: 371 cgtatccgggtac---ccgtccggccgcgctgtccctggccgtcggcctccacaaccccg 427 |||| || || | ||| |||||||| |||||| ||||| ||| ||||| ||||| Sbjct: 349 cgtaccctggcgcgccccggccggccgccctgtccgcagccgtgggcgtccactgccccg 408 Query: 428 tgatcacgtcgtggcacgacggcttgttg 456 |||||||| |||||||||||||||||||| Sbjct: 409 tgatcacggcgtggcacgacggcttgttg 437
>emb|X15349.1|HVENDCHT Barley (H.vulgare) mRNA for endochitinase Length = 556 Score = 95.6 bits (48), Expect = 1e-16 Identities = 119/140 (85%), Gaps = 2/140 (1%) Strand = Plus / Minus Query: 233 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 292 |||||||||||||||| || |||||||| | ||||| |||||| |||||||||||||| | Sbjct: 517 tgtagcagtcgaggttgttgccgtagccaacgccgaggatgtcgcagtagcgcttgtaaa 458 Query: 293 acccgatccggtcggccaccttgtc-gttctgccccttgccgcattcgatcccgccattg 351 |||||||||| ||||| | || | | || |||||| | ||||| ||||||||||| ||| Sbjct: 457 acccgatccgatcggcga-ctcgactgtcctgcccatgcccgcactcgatcccgccgttg 399 Query: 352 atgacgttggtgatcacgcc 371 | || ||||||||||||||| Sbjct: 398 acgatgttggtgatcacgcc 379
>gb|L34210.1|BLYCHI26A Hordeum vulgare chitinase (CHI26) gene, complete cds Length = 3169 Score = 95.6 bits (48), Expect = 1e-16 Identities = 114/136 (83%) Strand = Plus / Minus Query: 233 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 292 ||||||| |||||||| || |||||||| | ||||| ||||||||||||||||||||| | Sbjct: 2478 tgtagcaatcgaggttgttgccgtagccaacgccgaggatgtcacagtagcgcttgtaaa 2419 Query: 293 acccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattga 352 ||||||| || ||||| || | || |||||| | ||||| ||||||||||| |||| Sbjct: 2418 acccgattcgatcggcgacgcggctgtcctgcccgtgaccgcactcgatcccgccgttga 2359 Query: 353 tgacgttggtgatcac 368 ||| |||||||||||| Sbjct: 2358 tgatgttggtgatcac 2343
>gb|M62904.1|BLYCHI H.vulgare L. 26kD chitinase mRNA, complete cds Length = 998 Score = 95.6 bits (48), Expect = 1e-16 Identities = 114/136 (83%) Strand = Plus / Minus Query: 233 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 292 ||||||| |||||||| || |||||||| | ||||| ||||||||||||||||||||| | Sbjct: 841 tgtagcaatcgaggttgttgccgtagccaacgccgaggatgtcacagtagcgcttgtaaa 782 Query: 293 acccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattga 352 ||||||| || ||||| || | || |||||| | ||||| ||||||||||| |||| Sbjct: 781 acccgattcgatcggcgacgcggctgtcctgcccgtgaccgcactcgatcccgccgttga 722 Query: 353 tgacgttggtgatcac 368 ||| |||||||||||| Sbjct: 721 tgatgttggtgatcac 706
>gb|U02287.1|HVU02287 Hordeum vulgare cultivar NK1558 chitinase gene, complete cds Length = 1684 Score = 95.6 bits (48), Expect = 1e-16 Identities = 119/140 (85%), Gaps = 2/140 (1%) Strand = Plus / Minus Query: 233 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 292 |||||||||||||||| || |||||||| | ||||| |||||| |||||||||||||| | Sbjct: 1536 tgtagcagtcgaggttgttgccgtagccaacgccgaggatgtcgcagtagcgcttgtaaa 1477 Query: 293 acccgatccggtcggccaccttgtc-gttctgccccttgccgcattcgatcccgccattg 351 |||||||||| ||||| | || | | || |||||| | ||||| ||||||||||| ||| Sbjct: 1476 acccgatccgatcggcga-ctcgactgtcctgcccatgcccgcactcgatcccgccgttg 1418 Query: 352 atgacgttggtgatcacgcc 371 | || ||||||||||||||| Sbjct: 1417 acgatgttggtgatcacgcc 1398
>emb|X54367.1|OSCHIT Oryza sativa (rice) gene for endochitinase Length = 1237 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 1080 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 1021 Query: 289 tagaacccgatccggtcggccaccttgtcgt 319 ||||||||||||||||||||||||||||||| Sbjct: 1020 tagaacccgatccggtcggccaccttgtcgt 990
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 30372331 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 30372272 Query: 289 tagaacccgatccggtcggccaccttgtcgt 319 ||||||||||||||||||||||||||||||| Sbjct: 30372271 tagaacccgatccggtcggccaccttgtcgt 30372241 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 30375940 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 30375881 Query: 289 tagaacccgatccggtcggc 308 |||||||| ||||||||||| Sbjct: 30375880 tagaacccaatccggtcggc 30375861
>dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0017G10 Length = 166700 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 9692 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 9633 Query: 289 tagaacccgatccggtcggccaccttgtcgt 319 ||||||||||||||||||||||||||||||| Sbjct: 9632 tagaacccgatccggtcggccaccttgtcgt 9602 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 13301 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 13242 Query: 289 tagaacccgatccggtcggc 308 |||||||| ||||||||||| Sbjct: 13241 tagaacccaatccggtcggc 13222
>dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0548E04 Length = 138037 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 118926 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 118867 Query: 289 tagaacccgatccggtcggccaccttgtcgt 319 ||||||||||||||||||||||||||||||| Sbjct: 118866 tagaacccgatccggtcggccaccttgtcgt 118836 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 122535 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 122476 Query: 289 tagaacccgatccggtcggc 308 |||||||| ||||||||||| Sbjct: 122475 tagaacccaatccggtcggc 122456
>dbj|AK061280.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-F06, full insert sequence Length = 1169 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 1018 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 959 Query: 289 tagaacccgatccggtcggccaccttgtcgt 319 ||||||||||||||||||||||||||||||| Sbjct: 958 tagaacccgatccggtcggccaccttgtcgt 928
>dbj|D16223.1|RICCHT3 Oryza sativa (japonica cultivar-group) Cht-3 gene for endochitinase, complete cds Length = 2808 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 2773 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 2714 Query: 289 tagaacccgatccggtcggccaccttgtcgt 319 ||||||||||||||||||||||||||||||| Sbjct: 2713 tagaacccgatccggtcggccaccttgtcgt 2683
>gb|AF013580.1|AF013580 Oryza sativa clone RGCH8 chitinase gene, complete cds Length = 2730 Score = 87.7 bits (44), Expect = 3e-14 Identities = 125/152 (82%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| Sbjct: 2296 tggttgtagcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttg 2237 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 2236 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 2177 Query: 349 ttgatgacgttggtgatcacgccgtatccggg 380 ||||||| ||||||||| |||||||| ||||| Sbjct: 2176 ttgatgatgttggtgatgacgccgtacccggg 2145
>gb|AF001500.1|OSAF001500 Oryza sativa clone MIRCH1 chitinase mRNA, partial cds Length = 913 Score = 87.7 bits (44), Expect = 3e-14 Identities = 125/152 (82%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| Sbjct: 756 tggttgtagcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttg 697 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 696 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 637 Query: 349 ttgatgacgttggtgatcacgccgtatccggg 380 ||||||| ||||||||| |||||||| ||||| Sbjct: 636 ttgatgatgttggtgatgacgccgtacccggg 605
>emb|Z29962.1|OSCHITIB O.sativa (PCH6) mRNA for chitinase class I Length = 1100 Score = 85.7 bits (43), Expect = 1e-13 Identities = 43/43 (100%) Strand = Plus / Minus Query: 277 cagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 319 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 902 cagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 860
>dbj|AB029936.1| Triticum aestivum Chi 3 mRNA for chitinase 3, complete cds Length = 1148 Score = 85.7 bits (43), Expect = 1e-13 Identities = 121/147 (82%) Strand = Plus / Minus Query: 228 ttggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgctt 287 ||||||||||||||| ||||| | ||||||| || ||| | || ||| ||||||||||| Sbjct: 996 ttggttgtagcagtccaggttgtcaccgtagctgacgccaaggaggtcgcagtagcgctt 937 Query: 288 gtagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcc 347 ||||||||||||||||||||| || | ||| |||||| ||||| |||| ||| || Sbjct: 936 gtagaacccgatccggtcggcgacacggccgtcctgcccgcgcccgcactcgagcccacc 877 Query: 348 attgatgacgttggtgatcacgccgta 374 ||||||| |||||||||||| ||||| Sbjct: 876 gttgatgatgttggtgatcacaccgta 850 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||||||||||||||||| ||| |||||| Sbjct: 800 cccgtgatcacgtcgtggctcgaaggcttg 771
>dbj|AB051579.1| Secale cereale rscc mRNA for seed chitinase-c, complete cds Length = 1018 Score = 83.8 bits (42), Expect = 5e-13 Identities = 111/134 (82%) Strand = Plus / Minus Query: 232 ttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtag 291 ||||||||||||||||| | |||||||| | ||||| |||||| |||||||||||||| Sbjct: 836 ttgtagcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttgtaa 777 Query: 292 aacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattg 351 ||||||||||| ||||| || | || |||||| | ||||| |||| ||| |||||| Sbjct: 776 aacccgatccgatcggcaacgcggctgtcctgcccgtgcccgcactcgagcccaccattg 717 Query: 352 atgacgttggtgat 365 |||| ||||||||| Sbjct: 716 atgatgttggtgat 703
>gb|AY973230.1| Triticum aestivum cultivar Sumai 3 class II chitinase gene, complete cds Length = 811 Score = 83.8 bits (42), Expect = 5e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| | |||||||| | ||||| |||||| |||||||||||| Sbjct: 785 tggttgtagcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttg 726 Query: 289 tagaacccgatccg 302 || ||||||||||| Sbjct: 725 taaaacccgatccg 712
>gb|AY973229.1| Triticum aestivum cultivar Gamenya class II chitinase gene, complete cds Length = 891 Score = 83.8 bits (42), Expect = 5e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| | |||||||| | ||||| |||||| |||||||||||| Sbjct: 785 tggttgtagcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttg 726 Query: 289 tagaacccgatccg 302 || ||||||||||| Sbjct: 725 taaaacccgatccg 712
>gb|AY437443.1| Triticum aestivum cultivar Ning 7840 class I chitinase mRNA, complete cds Length = 1121 Score = 83.8 bits (42), Expect = 5e-13 Identities = 120/146 (82%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| ||||| | ||||||| || ||||| | ||| |||||||||||| Sbjct: 1009 tggttgtagcagtccaggttgtcgccgtagctgacgccgagtaggtcgcagtagcgcttg 950 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 |||||||||||||||||||| || | ||| |||||| ||||| |||| ||| || Sbjct: 949 tagaacccgatccggtcggcaacacgggcgtcctgcccgcgcccgcactcgagcccaccg 890 Query: 349 ttgatgacgttggtgatcacgccgta 374 ||||||| |||||||||||| ||||| Sbjct: 889 ttgatgatgttggtgatcacaccgta 864
>gb|AF000964.1|AF000964 Poa pratensis chitinase (Chi1) gene, complete cds Length = 1252 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 321 ctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccggg 380 |||||| |||||||| |||| |||||||||||||| |||||||||||||||||| ||||| Sbjct: 879 ctgccctttgccgcactcgagcccgccattgatgatgttggtgatcacgccgtacccggg 820 Query: 381 taccc 385 |||| Sbjct: 819 caccc 815 Score = 77.8 bits (39), Expect = 3e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 231 gttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgta 290 |||||||||||| ||||| | ||||||| || ||||| || ||| |||||||||||||| Sbjct: 975 gttgtagcagtccaggttgtctccgtagctgacgccgaggaggtcgcagtagcgcttgta 916 Query: 291 gaacccgatccggtc 305 ||||||||||||||| Sbjct: 915 gaacccgatccggtc 901
>gb|AF280437.1|AF280437 Secale cereale 31.7 kDa class I endochitinase-antifreeze protein precursor, mRNA, complete cds Length = 1192 Score = 79.8 bits (40), Expect = 7e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| || || | ||||||| || ||||| || |||||||||||||||| Sbjct: 989 tggttgtagcagtccagattgtggccgtagctgacgccgaggaggtcacagtagcgcttg 930 Query: 289 tagaacccgatccggtcggc 308 ||||||||||| |||||||| Sbjct: 929 tagaacccgattcggtcggc 910 Score = 48.1 bits (24), Expect = 0.026 Identities = 39/44 (88%) Strand = Plus / Minus Query: 331 ccgcattcgatcccgccattgatgacgttggtgatcacgccgta 374 ||||| |||| ||| || ||||||| |||||||||||||||||| Sbjct: 887 ccgcactcgagcccaccgttgatgatgttggtgatcacgccgta 844
>ref|NM_197596.1| Oryza sativa (japonica cultivar-group) chitinase (OSJNBb0015I11.14), mRNA Length = 924 Score = 77.8 bits (39), Expect = 3e-11 Identities = 180/227 (79%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 767 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 708 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 707 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 648 Query: 349 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 408 ||||||| ||||||||| ||||| || ||||| || || ||||| ||| ||||| ||| Sbjct: 647 ttgatgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgcc 588 Query: 409 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgtt 455 | |||| ||||| || ||| ||||||||||||||||||||||| Sbjct: 587 gacggcgtccaccggccgaggatgacgtcgtggcacgacggcttgtt 541
>gb|AC051633.7| Oryza sativa chromosome 10 BAC OSJNBb0015I11 genomic sequence, complete sequence Length = 138824 Score = 77.8 bits (39), Expect = 3e-11 Identities = 180/227 (79%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 89608 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 89549 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 89548 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 89489 Query: 349 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 408 ||||||| ||||||||| ||||| || ||||| || || ||||| ||| ||||| ||| Sbjct: 89488 ttgatgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgcc 89429 Query: 409 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgtt 455 | |||| ||||| || ||| ||||||||||||||||||||||| Sbjct: 89428 gacggcgtccaccggccgaggatgacgtcgtggcacgacggcttgtt 89382 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 433 acgtcgtggcacgacggcttgttggactgc 462 |||||||||| ||||||||||||| ||||| Sbjct: 104130 acgtcgtggctcgacggcttgttgtactgc 104101 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggtt 248 |||||||||||||||||||| Sbjct: 104334 tggttgtagcagtcgaggtt 104315 Score = 40.1 bits (20), Expect = 6.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 271 atgtcacagtagcgcttgtagaacccgatccggtcg 306 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 104292 atgtcgcagtagcgcttgtagtagccgatgcggtcg 104257
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 77.8 bits (39), Expect = 3e-11 Identities = 180/227 (79%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 20688156 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 20688097 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 20688096 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 20688037 Query: 349 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 408 ||||||| ||||||||| ||||| || ||||| || || ||||| ||| ||||| ||| Sbjct: 20688036 ttgatgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgcc 20687977 Query: 409 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgtt 455 | |||| ||||| || ||| ||||||||||||||||||||||| Sbjct: 20687976 gacggcgtccaccggccgaggatgacgtcgtggcacgacggcttgtt 20687930 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 433 acgtcgtggcacgacggcttgttggactgc 462 |||||||||| ||||||||||||| ||||| Sbjct: 20702678 acgtcgtggctcgacggcttgttgtactgc 20702649 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggtt 248 |||||||||||||||||||| Sbjct: 20702882 tggttgtagcagtcgaggtt 20702863 Score = 40.1 bits (20), Expect = 6.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 271 atgtcacagtagcgcttgtagaacccgatccggtcg 306 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 20702840 atgtcgcagtagcgcttgtagtagccgatgcggtcg 20702805
>dbj|AK070067.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042L15, full insert sequence Length = 1073 Score = 77.8 bits (39), Expect = 3e-11 Identities = 180/227 (79%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 793 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 734 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 733 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 674 Query: 349 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 408 ||||||| ||||||||| ||||| || ||||| || || ||||| ||| ||||| ||| Sbjct: 673 ttgatgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgcc 614 Query: 409 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgtt 455 | |||| ||||| || ||| ||||||||||||||||||||||| Sbjct: 613 gacggcgtccaccggccgaggatgacgtcgtggcacgacggcttgtt 567
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 77.8 bits (39), Expect = 3e-11 Identities = 180/227 (79%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 20699428 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 20699369 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 20699368 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 20699309 Query: 349 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 408 ||||||| ||||||||| ||||| || ||||| || || ||||| ||| ||||| ||| Sbjct: 20699308 ttgatgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgcc 20699249 Query: 409 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgtt 455 | |||| ||||| || ||| ||||||||||||||||||||||| Sbjct: 20699248 gacggcgtccaccggccgaggatgacgtcgtggcacgacggcttgtt 20699202 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 433 acgtcgtggcacgacggcttgttggactgc 462 |||||||||| ||||||||||||| ||||| Sbjct: 20713950 acgtcgtggctcgacggcttgttgtactgc 20713921 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggtt 248 |||||||||||||||||||| Sbjct: 20714154 tggttgtagcagtcgaggtt 20714135 Score = 40.1 bits (20), Expect = 6.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 271 atgtcacagtagcgcttgtagaacccgatccggtcg 306 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 20714112 atgtcgcagtagcgcttgtagtagccgatgcggtcg 20714077
>gb|AY453406.1| Bambusa oldhamii chitinase mRNA, complete cds Length = 1232 Score = 75.8 bits (38), Expect = 1e-10 Identities = 101/122 (82%) Strand = Plus / Minus Query: 331 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccgtccg 390 ||||| |||| |||||||||||||| ||| ||||| |||||||| ||||| ||||| ||| Sbjct: 881 ccgcactcgagcccgccattgatgatgttcgtgatgacgccgtacccgggaacccggccg 822 Query: 391 gccgcgctgtccctggccgtcggcctccacaaccccgtgatcacgtcgtggcacgacggc 450 |||||| |||| | ||||| ||||| ||||||| ||||||||||||||||||| Sbjct: 821 gccgcgatgtctacgctactcggcgtccactgccccgtggccacgtcgtggcacgacggc 762 Query: 451 tt 452 || Sbjct: 761 tt 760
>gb|L40336.1|RICCHITB Oryza sativa chitinase (Rcht2) gene, complete cds Length = 5595 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| Sbjct: 4846 tggttgtagcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttg 4787 Query: 289 tagaacccgatccggtcg 306 ||| | ||||| |||||| Sbjct: 4786 tagtagccgatgcggtcg 4769 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 433 acgtcgtggcacgacggcttgtt 455 ||||||||||||||||||||||| Sbjct: 4642 acgtcgtggcacgacggcttgtt 4620
>gb|L40338.1|RICRCH0 Oryza sativa (clone RCH08) chitinase (Rcht2) mRNA, 3' end of cds Length = 652 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| Sbjct: 509 tggttgtagcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttg 450 Query: 289 tagaacccgatccggtcg 306 ||| | ||||| |||||| Sbjct: 449 tagtagccgatgcggtcg 432 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 433 acgtcgtggcacgacggcttgtt 455 ||||||||||||||||||||||| Sbjct: 305 acgtcgtggcacgacggcttgtt 283
>gb|AC148763.14| Medicago truncatula clone mth2-29o24, complete sequence Length = 104879 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Plus Query: 331 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccgtccg 390 |||||||||| ||| || ||||| | |||||||||||||||||||||||| ||||||||| Sbjct: 25093 ccgcattcgagcccaccgttgattatgttggtgatcacgccgtatccggggacccgtccg 25152 Query: 391 gc 392 || Sbjct: 25153 gc 25154 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Plus Query: 331 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccg 386 |||||||||| |||||| ||||| | |||||||||||||||||||||||| ||||| Sbjct: 29219 ccgcattcgagcccgccgttgattatgttggtgatcacgccgtatccggggacccg 29274 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 342 cccgccattgatgacgttggtgatcacgccgtatccgggtaccc 385 |||||| ||||| | ||||||||||||||| ||||||||||||| Sbjct: 14909 cccgccgttgattatgttggtgatcacgccatatccgggtaccc 14952
>gb|AY997529.2| Musa x paradisiaca chitinase (Chi-1) mRNA, complete cds Length = 1082 Score = 75.8 bits (38), Expect = 1e-10 Identities = 101/122 (82%) Strand = Plus / Minus Query: 253 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacc 312 ||||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 981 ccgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacg 922 Query: 313 ttgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccg 372 |||| || || | |||||| || | |||||| ||||||| ||||||||| |||||| Sbjct: 921 cgatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccg 862 Query: 373 ta 374 || Sbjct: 861 ta 860
>gb|AF167323.1|AF167323 Medicago truncatula clone T130002g putative chitinase gene, partial cds Length = 260 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 331 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccgtccg 390 |||||||||| ||| || ||||| | |||||||||||||||||||||||| ||||||||| Sbjct: 177 ccgcattcgagcccaccgttgattatgttggtgatcacgccgtatccggggacccgtccg 118 Query: 391 gc 392 || Sbjct: 117 gc 116
>ref|XM_468715.1| Oryza sativa (japonica cultivar-group), mRNA Length = 981 Score = 73.8 bits (37), Expect = 4e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 254 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 313 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 937 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 878 Query: 314 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 373 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 877 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 818 Query: 374 a 374 | Sbjct: 817 a 817
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 73.8 bits (37), Expect = 4e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 254 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 313 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 17204043 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 17203984 Query: 314 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 373 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 17203983 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 17203924 Query: 374 a 374 | Sbjct: 17203923 a 17203923 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 427 gtgatcacgtcgtggcacgacggcttg 453 ||||| ||||||||||||||||||||| Sbjct: 1841750 gtgattacgtcgtggcacgacggcttg 1841724
>gb|AC145386.1| Oryza sativa chromosome 3 BAC OSJNBb0028K20 genomic sequence, complete sequence Length = 115326 Score = 73.8 bits (37), Expect = 4e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 254 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 313 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 36787 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 36728 Query: 314 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 373 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 36727 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 36668 Query: 374 a 374 | Sbjct: 36667 a 36667
>emb|Z78202.1|PACHI1 Persea americana mRNA for endochitinase Length = 1120 Score = 73.8 bits (37), Expect = 4e-10 Identities = 79/93 (84%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggccaccttgtcgttctgccccttgcc 332 ||||||||| | ||||||||| || || ||||| ||||||||||| || |||||||| Sbjct: 922 gtcacagtacctcttgtagaagccaatgcggtctgccaccttgtcattgaatcccttgcc 863 Query: 333 gcattcgatcccgccattgatgacgttggtgat 365 |||||||||||| || ||||||| ||||||||| Sbjct: 862 gcattcgatcccaccgttgatgatgttggtgat 830
>gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genomic sequence, complete sequence Length = 153247 Score = 73.8 bits (37), Expect = 4e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 254 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 313 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 95436 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 95377 Query: 314 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 373 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 95376 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 95317 Query: 374 a 374 | Sbjct: 95316 a 95316
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 73.8 bits (37), Expect = 4e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 254 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 313 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 17197612 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 17197553 Query: 314 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 373 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 17197552 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 17197493 Query: 374 a 374 | Sbjct: 17197492 a 17197492 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 427 gtgatcacgtcgtggcacgacggcttg 453 ||||| ||||||||||||||||||||| Sbjct: 1841748 gtgattacgtcgtggcacgacggcttg 1841722
>dbj|AB051578.1| Secale cereale rsca mRNA for seed chitinase-a, complete cds Length = 1191 Score = 69.9 bits (35), Expect = 7e-09 Identities = 116/143 (81%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||| ||||||||||| || || ||||| | | | |||||| |||||||||||| Sbjct: 1007 tggttgtaacagtcgaggttgttgccatagccaacacgaaggatgtcgcagtagcgcttg 948 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 || |||||||| || ||||| || | || |||||| | ||||| |||||||||||| Sbjct: 947 taaaacccgattcgatcggcgactcggctgtcctgcccatgcccgcactcgatcccgcca 888 Query: 349 ttgatgacgttggtgatcacgcc 371 |||| || ||||||||||||||| Sbjct: 887 ttgacgatgttggtgatcacgcc 865
>emb|X63899.1|PSCHITIN P.sativum mRNA for chitinase Length = 1143 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 330 gccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccg 386 ||||||||| |||||||||||||| | |||||||||||| || |||||||| ||||| Sbjct: 879 gccgcattcaatcccgccattgattatgttggtgatcacaccatatccggggacccg 823
>dbj|AB029934.1| Triticum aestivum Chi 1 mRNA for chitinase 1, complete cds Length = 979 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 331 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccgtccg 390 ||||| |||| |||||| ||||||| ||||||||||| |||||||||||||||| ||| Sbjct: 726 ccgcactcgagcccgccgttgatgatattggtgatcactccgtatccgggtaccctgccg 667 Query: 391 gccgcgctgtccctggccgtcggcctcca 419 || ||| |||| |||||||||| |||| Sbjct: 666 gcagcggtgtcggcggccgtcggcgtcca 638
>gb|AY378172.1| Oryza sativa (japonica cultivar-group) OsmChiI-34 mRNA, partial cds Length = 894 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 890 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 831 Query: 289 tagaacccgatccggtcggc 308 |||||||| ||||||||||| Sbjct: 830 tagaacccaatccggtcggc 811
>emb|Z29961.1|OSCHITIA O.sativa (PCH16) mRNA for chitinase class I Length = 1159 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 1073 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 1014 Query: 289 tagaacccgatccggtcggc 308 |||||||| ||||||||||| Sbjct: 1013 tagaacccaatccggtcggc 994
>emb|X87109.1|OSDNARC24 O.sativa RC24 gene Length = 2048 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 2006 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 1947 Query: 289 tagaacccgatccggtcggc 308 |||||||| ||||||||||| Sbjct: 1946 tagaacccaatccggtcggc 1927
>emb|X78672.1|HVCHT2B H.vulgare mRNA for chitinase 2b Length = 1013 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 315 gtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgta 374 ||||||||| ||| ||||||| |||| |||||| ||||||| |||||||| |||||||| Sbjct: 709 gtcgttctggcccatgccgcactcgagcccgccgttgatgatattggtgattacgccgta 650 Query: 375 tccgggtacccg 386 ||| || ||||| Sbjct: 649 tccaggcacccg 638 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 433 acgtcgtggcacgacggcttgttg 456 |||||||||| ||||||||||||| Sbjct: 591 acgtcgtggctcgacggcttgttg 568
>emb|X76041.1|TACHIG T.aestivum (Chinese spring) chi gene for endochitinase Length = 1985 Score = 63.9 bits (32), Expect = 4e-07 Identities = 32/32 (100%) Strand = Plus / Minus Query: 277 cagtagcgcttgtagaacccgatccggtcggc 308 |||||||||||||||||||||||||||||||| Sbjct: 1531 cagtagcgcttgtagaacccgatccggtcggc 1500
>emb|X56063.1|OSENDO O.sativa mRNA for endochitinase Length = 1160 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 905 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 846 Query: 289 tagaacccgatccggtcggc 308 |||||||| ||||||||||| Sbjct: 845 tagaacccaatccggtcggc 826
>emb|AJ276226.1|HVU276226 Hordeum vulgare mRNA for chitinase II (pathogenesis-related protein 3) (cht2 gene) Length = 890 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 315 gtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgta 374 ||||||||| ||| ||||||| |||| |||||| ||||||| |||||||| |||||||| Sbjct: 715 gtcgttctggcccatgccgcactcgagcccgccgttgatgatattggtgattacgccgta 656 Query: 375 tccgggtacccg 386 ||| || ||||| Sbjct: 655 tccaggcacccg 644 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 433 acgtcgtggcacgacggcttgttg 456 |||||||||| ||||||||||||| Sbjct: 597 acgtcgtggctcgacggcttgttg 574
>dbj|AK105798.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A08, full insert sequence Length = 1141 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 1010 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 951 Query: 289 tagaacccgatccggtcggc 308 |||||||| ||||||||||| Sbjct: 950 tagaacccaatccggtcggc 931
>dbj|AK104020.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-C04, full insert sequence Length = 1136 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 1005 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 946 Query: 289 tagaacccgatccggtcggc 308 |||||||| ||||||||||| Sbjct: 945 tagaacccaatccggtcggc 926
>dbj|AK099339.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028I21, full insert sequence Length = 1174 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 986 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 927 Query: 289 tagaacccgatccggtcggc 308 |||||||| ||||||||||| Sbjct: 926 tagaacccaatccggtcggc 907
>dbj|AK061042.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-D05, full insert sequence Length = 1217 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 1008 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 949 Query: 289 tagaacccgatccggtcggc 308 |||||||| ||||||||||| Sbjct: 948 tagaacccaatccggtcggc 929
>dbj|D16221.1|RICCHT1 Oryza sativa (japonica cultivar-group) Cht-1 gene for endochitinase, complete cds Length = 2739 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 2270 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 2211 Query: 289 tagaacccgatccggtcggc 308 |||||||| ||||||||||| Sbjct: 2210 tagaacccaatccggtcggc 2191
>dbj|AB016497.1| Oryza sativa mRNA for chitinase, complete cds Length = 923 Score = 63.9 bits (32), Expect = 4e-07 Identities = 122/152 (80%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 773 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 714 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 713 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 654 Query: 349 ttgatgacgttggtgatcacgccgtatccggg 380 ||||||| ||||||||| ||||| || ||||| Sbjct: 653 ttgatgatgttggtgatgacgccatacccggg 622
>gb|AC135418.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0035J16, complete sequence Length = 170233 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 252 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 6316 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 6260
>emb|X56787.1|OSLMRNAC O.sativa L. mRNA for endochitinase Length = 1186 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttgtt 455 |||||||||||||||||||| |||||||||||| Sbjct: 792 ccccgtgatcacgtcgtggctcgacggcttgtt 760 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 986 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 927 Query: 289 tagaacccgatccggt 304 ||||| |||||||||| Sbjct: 926 tagaagccgatccggt 911
>dbj|AK108949.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-C03, full insert sequence Length = 979 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttgtt 455 |||||||||||||||||||| |||||||||||| Sbjct: 457 ccccgtgatcacgtcgtggctcgacggcttgtt 425 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 651 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 592 Query: 289 tagaacccgatccggt 304 ||||| |||||||||| Sbjct: 591 tagaagccgatccggt 576
>dbj|AK071196.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086B11, full insert sequence Length = 1305 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 252 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1029 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 973
>dbj|AB096139.1| Oryza sativa (japonica cultivar-group) Chia1d mRNA for chitinase, complete cds Length = 1285 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 252 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1016 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 960
>dbj|D16222.1|RICCHT2 Oryza sativa (japonica cultivar-group) Cht-2 gene for endochitinase, complete cds Length = 2986 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttgtt 455 |||||||||||||||||||| |||||||||||| Sbjct: 2227 ccccgtgatcacgtcgtggctcgacggcttgtt 2195 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 2421 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 2362 Query: 289 tagaacccgatccggt 304 ||||| |||||||||| Sbjct: 2361 tagaagccgatccggt 2346
>dbj|AB012855.1| Oryza sativa mRNA for chitinase, complete cds Length = 1300 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 252 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1031 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 975
>dbj|AB018248.1| Oryza sativa (indica cultivar-group) mRNA for chitinase, complete cds Length = 1280 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 252 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1005 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 949
>gb|L16798.1|MZECHITINA Zea mays class I acidic chitinase mRNA, partial cds Length = 1012 Score = 56.0 bits (28), Expect = 1e-04 Identities = 117/146 (80%), Gaps = 3/146 (2%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| | ||||||| |||||| | |||||| ||||||| || Sbjct: 776 tggttgtagcagtccaagttgtcgccgtagctgatgccaaggatgtcgcagtagctggtg 717 Query: 289 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 348 ||||| | |||||| ||||||||| ||||| | || |||||||| ||||| ||| Sbjct: 716 tagaagaaggtccggttggccaccttctcgttgtagcctttgccgcactcgat---gccg 660 Query: 349 ttgatgacgttggtgatcacgccgta 374 ||||||| ||||||||| |||||||| Sbjct: 659 ttgatgatgttggtgatgacgccgta 634 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 432 cacgtcgtggcacgacggcttg 453 |||||||||||||||||||||| Sbjct: 576 cacgtcgtggcacgacggcttg 555
>gb|AF135133.1|AF135133 Arabis blepharophylla country USA class I chitinase gene, partial cds Length = 1308 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacgg 449 |||||||||||||||||||||||||| Sbjct: 1098 cccgtgatcacgtcgtggcacgacgg 1073
>gb|AY643483.1| Drosera spathulata CHIT1 (chit1) gene, partial cds Length = 911 Score = 50.1 bits (25), Expect = 0.006 Identities = 46/53 (86%) Strand = Plus / Minus Query: 343 ccgccattgatgacgttggtgatcacgccgtatccgggtacccgtccggccgc 395 ||||| ||||||| |||||||||||| ||||| || ||||| ||||| ||||| Sbjct: 907 ccgccgttgatgatgttggtgatcaccccgtagcctggtactcgtccagccgc 855
>gb|AY253986.1| Galega orientalis class Ib chitinase mRNA, complete cds Length = 1149 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 357 gttggtgatcacgccgtatccgggtacccgtcc 389 |||||||||||||||||| ||||| |||||||| Sbjct: 855 gttggtgatcacgccgtagccgggaacccgtcc 823
>gb|U02286.1|OSU02286 Oryza sativa IR58 chitinase mRNA, complete cds Length = 1051 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttgtt 455 |||||||| ||||||||||| |||||||||||| Sbjct: 787 ccccgtgaccacgtcgtggctcgacggcttgtt 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 342 cccgccattgatgacgttggtgatcacgccgta 374 |||||| |||| || |||||||||||||||||| Sbjct: 862 cccgccgttgacgatgttggtgatcacgccgta 830 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggtt 248 |||||||||||||||||||| Sbjct: 975 tggttgtagcagtcgaggtt 956
>gb|AY532766.1| Zea diploperennis isolate d8 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532765.1| Zea diploperennis isolate d7 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532764.1| Zea diploperennis isolate d6 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532763.1| Zea diploperennis isolate d5 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532762.1| Zea diploperennis isolate d5b chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532761.1| Zea diploperennis isolate d4 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532760.1| Zea diploperennis isolate d3 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532759.1| Zea diploperennis isolate d2 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532758.1| Zea diploperennis isolate d1 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532757.1| Zea mays subsp. parviglumis isolate p15 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532756.1| Zea mays subsp. parviglumis isolate p14b chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532755.1| Zea mays subsp. parviglumis isolate p14 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532754.1| Zea mays subsp. parviglumis isolate p13b chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532753.1| Zea mays subsp. parviglumis isolate p13 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532752.1| Zea mays subsp. parviglumis isolate p12 chitinase (chiI) gene, complete cds Length = 1082 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532751.1| Zea mays subsp. parviglumis isolate p11 chitinase (chiI) gene, complete cds Length = 1081 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 756 ccccgtcatgacgtcgtggcacgacggcttg 726
>gb|AY532750.1| Zea mays subsp. parviglumis isolate p9 chitinase (chiI) gene, complete cds Length = 1084 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 909 gtcacagtatcgtttgtagaagccgatccggtcggc 874 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 759 ccccgtcatgacgtcgtggcacgacggcttg 729
>gb|AY532749.1| Zea mays subsp. parviglumis isolate p8 chitinase (chiI) gene, complete cds Length = 1081 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 756 ccccgtcatgacgtcgtggcacgacggcttg 726
>gb|AY532748.1| Zea mays subsp. parviglumis isolate p6 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532747.1| Zea mays subsp. parviglumis isolate p5 chitinase (chiI) gene, complete cds Length = 1089 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 756 ccccgtcatgacgtcgtggcacgacggcttg 726
>gb|AY532746.1| Zea mays subsp. parviglumis isolate p4 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532745.1| Zea mays subsp. parviglumis isolate p3 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532744.1| Zea mays subsp. parviglumis isolate p2 chitinase (chiI) gene, complete cds Length = 1087 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttg 723
>gb|AY532743.1| Zea mays subsp. parviglumis isolate p1 chitinase (chiI) gene, complete cds Length = 1081 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggcttg 453 |||||| || ||||||||||||||||||||| Sbjct: 756 ccccgtcatgacgtcgtggcacgacggcttg 726
>emb|AJ277279.1|MAC277279 Musa acuminata mRNA for putative chitinase isoform 2 Length = 1129 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Minus Query: 430 atcacgtcgtggcacgacggcttg 453 |||||||||||||||||||||||| Sbjct: 754 atcacgtcgtggcacgacggcttg 731
>emb|AJ277278.1|MAC277278 Musa acuminata mRNA for putative chitinase isoform 1 Length = 1186 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Minus Query: 430 atcacgtcgtggcacgacggcttg 453 |||||||||||||||||||||||| Sbjct: 738 atcacgtcgtggcacgacggcttg 715
>gb|AF416677.1|AF416677 Musa acuminata endochitinase (EndoChit1) mRNA, partial cds Length = 862 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Minus Query: 430 atcacgtcgtggcacgacggcttg 453 |||||||||||||||||||||||| Sbjct: 473 atcacgtcgtggcacgacggcttg 450
>gb|DQ078282.1| Ulmus pumila chitinase (CHT) mRNA, complete cds Length = 954 Score = 48.1 bits (24), Expect = 0.026 Identities = 39/44 (88%) Strand = Plus / Minus Query: 331 ccgcattcgatcccgccattgatgacgttggtgatcacgccgta 374 |||||||| ||||| || ||||||| ||||||||||| |||||| Sbjct: 812 ccgcattctatcccaccgttgatgatgttggtgatcatgccgta 769
>dbj|AB161939.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS104 Length = 1172 Score = 48.1 bits (24), Expect = 0.026 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatsacgtcgtggcacgacggcttg 926
>gb|L00973.1|MZECHITC Zea mays acidic class I chitinase mRNA, complete cds Length = 1128 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 273 gtcacagtagcgcttgtagaacccgatccggtcggc 308 ||||||||| || |||||||| |||||||||||||| Sbjct: 921 gtcacagtatcgtttgtagaagccgatccggtcggc 886
>gb|AC140005.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJA1004C08, complete sequence Length = 138054 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 427 gtgatcacgtcgtggcacgacggcttg 453 ||||| ||||||||||||||||||||| Sbjct: 66612 gtgattacgtcgtggcacgacggcttg 66586
>gb|AC146189.3| Pan troglodytes BAC clone CH251-490L21 from Y, complete sequence Length = 180597 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 147 cacatccacacacgcacatgcat 169 ||||||||||||||||||||||| Sbjct: 119650 cacatccacacacgcacatgcat 119628
>gb|AC140850.20| Medicago truncatula clone mth2-11i23, complete sequence Length = 138846 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 142 atcatcacatccacacacgcacatgca 168 |||||||||||| |||||||||||||| Sbjct: 130057 atcatcacatccccacacgcacatgca 130031
>gb|AC167968.5| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940121D9, complete sequence Length = 108830 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Plus Query: 330 gccgcattcgatcccgccattgatgacgttg 360 |||||| ||||| |||||||||||||||||| Sbjct: 73169 gccgcactcgatgccgccattgatgacgttg 73199
>dbj|BS000612.1| Pan troglodytes chromosome Y clone:PTBY-009O17, complete sequences Length = 80000 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 147 cacatccacacacgcacatgcat 169 ||||||||||||||||||||||| Sbjct: 64086 cacatccacacacgcacatgcat 64108
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 147 cacatccacacacgcacatgcat 169 ||||||||||||||||||||||| Sbjct: 23891747 cacatccacacacgcacatgcat 23891725
>dbj|AK099355.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044P19, full insert sequence Length = 1097 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 427 gtgatcacgtcgtggcacgacggcttg 453 ||||| ||||||||||||||||||||| Sbjct: 610 gtgattacgtcgtggcacgacggcttg 584
>dbj|AK059871.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-207-E11, full insert sequence Length = 1086 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 427 gtgatcacgtcgtggcacgacggcttg 453 ||||| ||||||||||||||||||||| Sbjct: 613 gtgattacgtcgtggcacgacggcttg 587
>gb|AC154093.1| Homo sapiens chromosome 13 clone fa0790, complete sequence Length = 37001 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 cacatccacacacgcacatgca 168 |||||||||||||||||||||| Sbjct: 36335 cacatccacacacgcacatgca 36356
>ref|NM_197598.1| Oryza sativa (japonica cultivar-group) putative chitinase (OSJNBb0015I11.16), mRNA Length = 891 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 433 acgtcgtggcacgacggcttgttggactgc 462 |||||||||| ||||||||||||| ||||| Sbjct: 659 acgtcgtggctcgacggcttgttgtactgc 630 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggtt 248 |||||||||||||||||||| Sbjct: 863 tggttgtagcagtcgaggtt 844 Score = 40.1 bits (20), Expect = 6.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 271 atgtcacagtagcgcttgtagaacccgatccggtcg 306 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 821 atgtcgcagtagcgcttgtagtagccgatgcggtcg 786
>gb|AF513017.2| Leucaena leucocephala chitinase mRNA, complete cds; leucoplast gene for leucoplast product Length = 1080 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacgacggctt 452 ||||||||| |||||||||||||| ||||| Sbjct: 763 ccccgtgatgacgtcgtggcacgatggctt 734
>gb|AC124684.3| Mus musculus BAC clone RP24-375D13 from chromosome 1, complete sequence Length = 167927 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 148 acatccacacacgcacatgcat 169 |||||||||||||||||||||| Sbjct: 115354 acatccacacacgcacatgcat 115375
>emb|CR733892.2|CNS0GT1V Tetraodon nigroviridis full-length cDNA Length = 1579 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 339 gatcccgccattgatgacgttg 360 |||||||||||||||||||||| Sbjct: 553 gatcccgccattgatgacgttg 532
>emb|AL359649.8| Human DNA sequence from clone RP11-65D24 on chromosome 13 Contains 2 novel genes, complete sequence Length = 144792 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 cacatccacacacgcacatgca 168 |||||||||||||||||||||| Sbjct: 109684 cacatccacacacgcacatgca 109663
>gb|AC153149.4| Mus musculus BAC clone RP23-176O2 from chromosome 3, complete sequence Length = 206540 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 cacatccacacacgcacatgca 168 |||||||||||||||||||||| Sbjct: 146384 cacatccacacacgcacatgca 146405
>gb|AC084760.2| Gallus gallus clone WAG-65N20, complete sequence Length = 109569 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 98 tatttggtcataaaatacttac 119 |||||||||||||||||||||| Sbjct: 23660 tatttggtcataaaatacttac 23639
>gb|AC019306.10| Homo sapiens chromosome 18, clone RP11-326M20, complete sequence Length = 175840 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Plus Query: 147 cacatccacacacgcacatgcataaa 172 ||||| |||||||||||||||||||| Sbjct: 137699 cacatacacacacgcacatgcataaa 137724
>dbj|AB161943.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS110 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161942.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS109 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161941.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS108 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161940.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS107 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161938.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS103 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161937.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS102 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161936.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS101 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161935.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY10 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161934.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY09 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161933.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY07 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161932.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY05 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161931.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY04 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161930.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY03 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161929.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY02 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161928.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY01 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161927.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS10 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161926.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS09 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161925.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS08 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161924.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS06 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161923.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS05 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161922.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS04 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161921.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS03 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161920.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS02 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161919.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ31 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161918.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ30 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161917.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ23 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161916.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ18 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161914.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ15 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161913.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ11 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB161912.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ10 Length = 1172 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttg 926
>dbj|AB096365.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Nishi-iwai1 Length = 1468 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1251 cccgtcatgacgtcgtggcacgacggcttg 1222
>dbj|AB096364.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-iwai2 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096363.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-iwai1 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096362.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Iwateken12 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096361.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Iwateken10 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096360.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Iwateken9 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096359.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Iwateken1 Length = 1467 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttg 1221
>dbj|AB096358.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Ninohe1 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096357.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kesen6 Length = 1467 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttg 1221
>dbj|AB096356.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kesen5 Length = 1467 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttg 1221
>dbj|AB096354.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kami-hei11 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096353.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kami-hei8 Length = 1467 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttg 1221
>dbj|AB096352.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kami-hei5 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096351.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kami-hei4 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096350.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kami-hei2 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096349.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kamiichi3 Length = 1467 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttg 1221
>dbj|AB096348.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Hayatsuki17 Length = 1467 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttg 1221
>dbj|AB096347.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Ohyama1 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096346.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Isurugi2 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096345.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Johana1 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096344.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Ohara504 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096343.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Ohara15 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096342.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Ohara7 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096341.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Iwafune5 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096340.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Naoetsu1 Length = 1468 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1251 cccgtcatgacgtcgtggcacgacggcttg 1222
>dbj|AB096339.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kashiwazaki-shi2 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096338.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Nagaoka-shi2 Length = 1467 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttg 1221
>dbj|AB096337.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-kubiki2 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096336.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-kabahara1 Length = 1467 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttg 1221
>dbj|AB096335.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kita-kabahara2 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096334.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kita-kabahara1 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096333.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Senzu2 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096332.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Nishikawa7 Length = 1467 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttg 1221
>dbj|AB096331.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Tenryu10 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096330.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Keta4 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096329.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kanra1 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096328.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-kamo7 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096327.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-kamo6 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096326.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-kamo3 Length = 1467 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttg 1221
>dbj|AB096325.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-kamo2 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096324.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Amagi7 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096323.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Amagi6 Length = 1467 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttg 1221
>dbj|AB096322.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Amagi3 Length = 1467 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttg 1221
>dbj|AB096321.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Amagi1 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096320.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Minami-shitara6 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096319.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Minami-shitara2 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>dbj|AB096318.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kita-shitara2 Length = 1466 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttg 1220
>gb|AC153644.3| Mus musculus BAC clone RP24-531A1 from 1, complete sequence Length = 166988 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 148 acatccacacacgcacatgcat 169 |||||||||||||||||||||| Sbjct: 15411 acatccacacacgcacatgcat 15432
>gb|AY111529.1| Zea mays CL2382_1 mRNA sequence Length = 990 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 432 cacgtcgtggcacgacggcttg 453 |||||||||||||||||||||| Sbjct: 532 cacgtcgtggcacgacggcttg 511 Score = 40.1 bits (20), Expect = 6.3 Identities = 74/92 (80%) Strand = Plus / Minus Query: 229 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 288 |||||||||||||| | ||| | ||||||| |||||| | |||||| ||||||| || Sbjct: 732 tggttgtagcagtccaagttgtcgccgtagctgatgccaaggatgtcgcagtagctggtg 673 Query: 289 tagaacccgatccggtcggccaccttgtcgtt 320 ||||| | |||||| ||||||||| ||||| Sbjct: 672 tagaagaaggtccggttggccaccttctcgtt 641
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome Length = 7215267 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Minus Query: 330 gccgcattcgatcccgccattgatga 355 |||||||||||| ||||||||||||| Sbjct: 1140779 gccgcattcgatgccgccattgatga 1140754
>dbj|AB077022.1| Cryptomeria japonica Chi1 gene for chitinase class I partial cds, exon 3 Length = 273 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 cccgtgatcacgtcgtggcacgacggcttg 453 ||||| || ||||||||||||||||||||| Sbjct: 98 cccgtcatgacgtcgtggcacgacggcttg 69
>emb|AL591393.10| Human DNA sequence from clone RP11-224J22 on chromosome 9 Contains a novel gene (FLJ33868) and 2 CpG islands, complete sequence Length = 174911 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 110 aaatacttaccaagattatttattt 134 |||||||||||||| |||||||||| Sbjct: 80594 aaatacttaccaagtttatttattt 80570
>emb|BX322565.11| Zebrafish DNA sequence from clone CH211-262K18 in linkage group 24, complete sequence Length = 158981 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 146 tcacatccacacacgcacatgcata 170 |||||| |||||||||||||||||| Sbjct: 125189 tcacatacacacacgcacatgcata 125165
>emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 in linkage group 24, complete sequence Length = 152545 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 146 tcacatccacacacgcacatgcata 170 |||||| |||||||||||||||||| Sbjct: 66156 tcacatacacacacgcacatgcata 66180
>gb|AF494397.1| Malus x domestica class II chitinase (CHT-3) mRNA, partial cds Length = 667 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 328 ttgccgcattcgatcccgccattgatgacgttggtgatcac 368 ||||||||||| | || |||||||||| |||||||||||| Sbjct: 431 ttgccgcattcaagacctccattgatgatgttggtgatcac 391
>emb|BX294095.13| Zebrafish DNA sequence from clone CH211-248L17 in linkage group 24, complete sequence Length = 147604 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 146 tcacatccacacacgcacatgcata 170 |||||| |||||||||||||||||| Sbjct: 105496 tcacatacacacacgcacatgcata 105472
>gb|AY107475.1| Zea mays PCO104428 mRNA sequence Length = 686 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 433 acgtcgtggcacgacggcttg 453 ||||||||||||||||||||| Sbjct: 602 acgtcgtggcacgacggcttg 582
>gb|AC166486.5| Mus musculus chromosome 1, clone RP23-187M9, complete sequence Length = 187098 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 93 ccatttatttggtcataaaa 112 |||||||||||||||||||| Sbjct: 13104 ccatttatttggtcataaaa 13085
>gb|AC137616.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0069I13, complete sequence Length = 94252 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 423 ccccgtgatcacgtcgtggcacga 446 |||||| ||||||||||||||||| Sbjct: 27079 ccccgtcatcacgtcgtggcacga 27056
>gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosome 5, complete sequence Length = 203437 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 147 cacatccacacacgcacatgcata 170 ||||| |||||||||||||||||| Sbjct: 10245 cacatacacacacgcacatgcata 10268
>gb|AY643484.1| Dionaea muscipula CHIT1 (chit1) gene, partial cds Length = 234 Score = 40.1 bits (20), Expect = 6.3 Identities = 38/44 (86%) Strand = Plus / Minus Query: 349 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggc 392 ||||||| |||||||||||| || || ||||| | ||||||||| Sbjct: 233 ttgatgatgttggtgatcactccatagccgggaagccgtccggc 190
>gb|AF098302.1| Brassica juncea chitinase mRNA, complete cds Length = 1297 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 427 gtgatcacgtcgtggcacga 446 |||||||||||||||||||| Sbjct: 959 gtgatcacgtcgtggcacga 940
>gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome 5, complete sequence Length = 181395 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 cacatccacacacgcacatgcata 170 ||||| |||||||||||||||||| Sbjct: 177006 cacatacacacacgcacatgcata 176983
>gb|AC069288.7| Homo sapiens BAC clone RP11-416J17 from 7, complete sequence Length = 145709 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 cacatccacacacgcacatg 166 |||||||||||||||||||| Sbjct: 136461 cacatccacacacgcacatg 136480
>emb|CR735059.2|CNS0GTYA Tetraodon nigroviridis full-length cDNA Length = 1566 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>gb|AC121591.4| Mus musculus BAC clone RP23-289H3 from 1, complete sequence Length = 195393 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 93 ccatttatttggtcataaaa 112 |||||||||||||||||||| Sbjct: 12989 ccatttatttggtcataaaa 13008
>emb|CR933541.6| Mouse DNA sequence from clone DN-97M20 on chromosome 11, complete sequence Length = 176646 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 cacatccacacacgcacatgcata 170 ||||| |||||||||||||||||| Sbjct: 66957 cacatgcacacacgcacatgcata 66934
>emb|CR735005.2|CNS0GTWS Tetraodon nigroviridis full-length cDNA Length = 1561 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR734871.2|CNS0GTT2 Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 544 tcccgccattgatgacgttg 525
>emb|CR734832.2|CNS0GTRZ Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 550 tcccgccattgatgacgttg 531
>emb|CR734821.2|CNS0GTRO Tetraodon nigroviridis full-length cDNA Length = 1526 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 532 tcccgccattgatgacgttg 513
>emb|CR734784.2|CNS0GTQN Tetraodon nigroviridis full-length cDNA Length = 1557 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR734271.2|CNS0GTCE Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 542 tcccgccattgatgacgttg 523
>emb|CR734258.2|CNS0GTC1 Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR734222.2|CNS0GTB1 Tetraodon nigroviridis full-length cDNA Length = 1470 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 447 tcccgccattgatgacgttg 428
>emb|CR734221.2|CNS0GTB0 Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 543 tcccgccattgatgacgttg 524
>emb|CR734121.2|CNS0GT88 Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR660465.2|CNS0F8L3 Tetraodon nigroviridis full-length cDNA Length = 1549 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR734099.2|CNS0GT7M Tetraodon nigroviridis full-length cDNA Length = 1572 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 550 tcccgccattgatgacgttg 531
>emb|CR734078.2|CNS0GT71 Tetraodon nigroviridis full-length cDNA Length = 1472 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 450 tcccgccattgatgacgttg 431
>emb|CR734011.2|CNS0GT56 Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR733956.2|CNS0GT3N Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR733647.2|CNS0GSV2 Tetraodon nigroviridis full-length cDNA Length = 1578 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 556 tcccgccattgatgacgttg 537
>emb|CR733499.2|CNS0GSQY Tetraodon nigroviridis full-length cDNA Length = 1571 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 557 tcccgccattgatgacgttg 538
>emb|CR733422.2|CNS0GSOW Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR733844.2|CNS0GT0J Tetraodon nigroviridis full-length cDNA Length = 1566 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR733835.2|CNS0GT0A Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR733710.2|CNS0GSWT Tetraodon nigroviridis full-length cDNA Length = 1553 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR733648.2|CNS0GSV3 Tetraodon nigroviridis full-length cDNA Length = 1546 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 523 tcccgccattgatgacgttg 504
>emb|CR733358.2|CNS0GSNX Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR733481.1|CNS0GSQG Tetraodon nigroviridis full-length cDNA Length = 1527 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 531 tcccgccattgatgacgttg 512
>emb|CR733235.2|CNS0GSM1 Tetraodon nigroviridis full-length cDNA Length = 1579 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 557 tcccgccattgatgacgttg 538
>emb|CR733200.2|CNS0GSLG Tetraodon nigroviridis full-length cDNA Length = 1522 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 532 tcccgccattgatgacgttg 513
>emb|CR732950.2|CNS0GSGO Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR732939.2|CNS0GSGE Tetraodon nigroviridis full-length cDNA Length = 1540 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR732821.2|CNS0GSDN Tetraodon nigroviridis full-length cDNA Length = 1563 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR733142.1|CNS0GSKK Tetraodon nigroviridis full-length cDNA Length = 1544 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 tcccgccattgatgacgttg 360 |||||||||||||||||||| Sbjct: 538 tcccgccattgatgacgttg 519 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,466,740 Number of Sequences: 3902068 Number of extensions: 3466740 Number of successful extensions: 72721 Number of sequences better than 10.0: 827 Number of HSP's better than 10.0 without gapping: 830 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 70731 Number of HSP's gapped (non-prelim): 1970 length of query: 464 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 442 effective length of database: 17,147,199,772 effective search space: 7579062299224 effective search space used: 7579062299224 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
