ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet95b04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL021330.1|HS244F1 Human DNA sequence from clone RP1-244F1 o... 52 0.001
2gb|AC141478.3| Mus musculus BAC clone RP24-82N16 from chromosome... 44 0.35
3gb|AC128671.4| Mus musculus BAC clone RP23-247F12 from 18, compl... 44 0.35
4gb|AC146750.32| Medicago truncatula clone mth2-16o6, complete se... 42 1.4
5gb|AC053545.5| Homo sapiens BAC clone RP11-804C24 from 4, comple... 42 1.4
6dbj|AB084510.1| Daubentonia madagascariensis Dama-DRB gene for M... 42 1.4
7dbj|AB078318.1| Propithecus verreauxi verreauxi Prvv-DRB gene fo... 42 1.4
8dbj|AB078317.1| Propithecus verreauxi verreauxi Prvv-DRB gene fo... 42 1.4
9dbj|AB078315.1| Eulemur macaco macaco Eumm-DRB pseudogene for MH... 42 1.4
10dbj|AB078262.1| Hapalemur simus Hasi-DRB gene for MHC class II a... 42 1.4
11dbj|AB078229.1| Lemur catta Leca-DRB gene for MHC class II antig... 42 1.4
12gb|AC091463.9| Mus musculus chromosome 16, clone RP23-301D7, com... 40 5.5
13gb|AC129023.4| Mus musculus BAC clone RP23-430E12 from chromosom... 40 5.5
14gb|AC161213.3| Mus musculus chromosome 3, clone RP23-77D22, comp... 40 5.5
15gb|AC125456.4| Mus musculus BAC clone RP24-193M20 from chromosom... 40 5.5
16gb|AC090136.6| Homo sapiens chromosome 8, clone RP11-21C4, compl... 40 5.5
17gb|AC021518.12| Homo sapiens chromosome 8, clone RP11-313D2, com... 40 5.5
18gb|AC012535.11| Homo sapiens chromosome 8, clone RP11-115G12, co... 40 5.5
19dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
20gb|AC084460.1|AC084460 Caenorhabditis briggsae cosmid CB033D02, ... 40 5.5
21dbj|AP004163.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
22gb|AC103389.10| Mus musculus chromosome 3, clone RP24-419J17, co... 40 5.5
23emb|AL590451.2|CNS07EGI chromosome IX of strain GB-M1 of Encepha... 40 5.5
24emb|AL844199.8| Mouse DNA sequence from clone RP23-39F22 on chro... 40 5.5
25dbj|AB078299.1| Microcebus rufus Miru-DRB gene for MHC class II ... 40 5.5
26dbj|AB078264.1| Hapalemur griseus griseus Hagg-DRB gene for MHC ... 40 5.5

>emb|AL021330.1|HS244F1 Human DNA sequence from clone RP1-244F1 on chromosome 6q16.1-16.3
             Contains a nucleophosmin (nucleolar phosphoprotein B23,
             numatrin) (NPM1) (B23, NPM) pseudogene and a novel
             pseudogene, complete sequence
          Length = 84621

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 65    aatggaggtaaagtaaagaaccgaaattaa 94
             ||||||||||||||||||||| ||||||||
Sbjct: 16079 aatggaggtaaagtaaagaacagaaattaa 16050



to top

>gb|AC141478.3| Mus musculus BAC clone RP24-82N16 from chromosome 18, complete sequence
          Length = 184122

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 141    gaacaagagagaaatgagaaga 162
              ||||||||||||||||||||||
Sbjct: 123303 gaacaagagagaaatgagaaga 123324



to top

>gb|AC128671.4| Mus musculus BAC clone RP23-247F12 from 18, complete sequence
          Length = 172016

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 141    gaacaagagagaaatgagaaga 162
              ||||||||||||||||||||||
Sbjct: 167278 gaacaagagagaaatgagaaga 167257



to top

>gb|AC146750.32| Medicago truncatula clone mth2-16o6, complete sequence
          Length = 114206

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 123   aaggaagaatagtaaaatgaa 143
             |||||||||||||||||||||
Sbjct: 99865 aaggaagaatagtaaaatgaa 99885



to top

>gb|AC053545.5| Homo sapiens BAC clone RP11-804C24 from 4, complete sequence
          Length = 188927

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 137    aaatgaacaagagagaaatga 157
              |||||||||||||||||||||
Sbjct: 119811 aaatgaacaagagagaaatga 119791



to top

>dbj|AB084510.1| Daubentonia madagascariensis Dama-DRB gene for MHC class II
           antigen, exon 2, partial cds, allele:Dama-DRB*09
          Length = 202

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 336 ccggccggcccagctgcgtctccggccgg 364
           ||||||||||||||| |||| ||||||||
Sbjct: 107 ccggccggcccagctccgtcaccggccgg 79



to top

>dbj|AB078318.1| Propithecus verreauxi verreauxi Prvv-DRB gene for MHC class II
           antigen, exon 2, partial cds, allele:Prvv-DRB*We02
          Length = 202

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 336 ccggccggcccagctgcgtctccggccgg 364
           ||||||||||||||| |||| ||||||||
Sbjct: 107 ccggccggcccagctccgtcaccggccgg 79



to top

>dbj|AB078317.1| Propithecus verreauxi verreauxi Prvv-DRB gene for MHC class II
           antigen, exon 2, partial cds, allele:Prvv-DRB*We01
          Length = 202

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 336 ccggccggcccagctgcgtctccggccgg 364
           ||||||||||||||| |||| ||||||||
Sbjct: 107 ccggccggcccagctccgtcaccggccgg 79



to top

>dbj|AB078315.1| Eulemur macaco macaco Eumm-DRB pseudogene for MHC class II antigen,
           exon 2, allele:Eumm-DRB*Wa05#, pseudo
          Length = 202

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 336 ccggccggcccagctgcgtctccggccgg 364
           ||||||||||||||| |||| ||||||||
Sbjct: 107 ccggccggcccagctccgtcaccggccgg 79



to top

>dbj|AB078262.1| Hapalemur simus Hasi-DRB gene for MHC class II antigen, exon 2,
           partial cds, allele:Hasi-DRB*Wb03
          Length = 202

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 336 ccggccggcccagctgcgtctccggccgg 364
           ||||||||||||||| |||| ||||||||
Sbjct: 107 ccggccggcccagctccgtcaccggccgg 79



to top

>dbj|AB078229.1| Lemur catta Leca-DRB gene for MHC class II antigen, exon 2, partial
           cds, allele:Leca-DRB*Wb02
          Length = 202

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 336 ccggccggcccagctgcgtctccggccgg 364
           ||||||||||||||| |||| ||||||||
Sbjct: 107 ccggccggcccagctccgtcaccggccgg 79



to top

>gb|AC091463.9| Mus musculus chromosome 16, clone RP23-301D7, complete sequence
          Length = 232419

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 268   tggcgcctcacatgcgcgcgtcag 291
             |||| |||||||||||||||||||
Sbjct: 91043 tggctcctcacatgcgcgcgtcag 91066



to top

>gb|AC129023.4| Mus musculus BAC clone RP23-430E12 from chromosome 18, complete
             sequence
          Length = 185832

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 43    atattagttcttttttcccttcaa 66
             ||||| ||||||||||||||||||
Sbjct: 28332 atatttgttcttttttcccttcaa 28309



to top

>gb|AC161213.3| Mus musculus chromosome 3, clone RP23-77D22, complete sequence
          Length = 196596

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 138   aatgaacaagagagaaatga 157
             ||||||||||||||||||||
Sbjct: 83978 aatgaacaagagagaaatga 83959



to top

>gb|AC125456.4| Mus musculus BAC clone RP24-193M20 from chromosome 18, complete sequence
          Length = 142347

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     atattagttcttttttcccttcaa 66
              ||||| ||||||||||||||||||
Sbjct: 131381 atatttgttcttttttcccttcaa 131358



to top

>gb|AC090136.6| Homo sapiens chromosome 8, clone RP11-21C4, complete sequence
          Length = 186304

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 136    aaaatgaacaagagagaaatgagaagaa 163
              |||||||||||| ||||||||| |||||
Sbjct: 177743 aaaatgaacaagtgagaaatgacaagaa 177770



to top

>gb|AC021518.12| Homo sapiens chromosome 8, clone RP11-313D2, complete sequence
          Length = 169566

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 136   aaaatgaacaagagagaaatgagaagaa 163
             |||||||||||| ||||||||| |||||
Sbjct: 42028 aaaatgaacaagtgagaaatgacaagaa 42055



to top

>gb|AC012535.11| Homo sapiens chromosome 8, clone RP11-115G12, complete sequence
          Length = 173414

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 136   aaaatgaacaagagagaaatgagaagaa 163
             |||||||||||| ||||||||| |||||
Sbjct: 55918 aaaatgaacaagtgagaaatgacaagaa 55945



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 352      cgtctccggccggccggccg 371
                ||||||||||||||||||||
Sbjct: 27333558 cgtctccggccggccggccg 27333577



to top

>gb|AC084460.1|AC084460 Caenorhabditis briggsae cosmid CB033D02, complete sequence
          Length = 77513

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 136   aaaatgaacaagagagaaatgaga 159
             ||||||||||||||||||| ||||
Sbjct: 63293 aaaatgaacaagagagaaaggaga 63316



to top

>dbj|AP004163.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1323_A06
          Length = 95665

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 352   cgtctccggccggccggccg 371
             ||||||||||||||||||||
Sbjct: 35085 cgtctccggccggccggccg 35104



to top

>gb|AC103389.10| Mus musculus chromosome 3, clone RP24-419J17, complete sequence
          Length = 162643

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 138 aatgaacaagagagaaatga 157
           ||||||||||||||||||||
Sbjct: 572 aatgaacaagagagaaatga 553



to top

>emb|AL590451.2|CNS07EGI chromosome IX of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 251002

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 40     tacatattagttcttttttc 59
              ||||||||||||||||||||
Sbjct: 135261 tacatattagttcttttttc 135280



to top

>emb|AL844199.8| Mouse DNA sequence from clone RP23-39F22 on chromosome 4, complete
             sequence
          Length = 205589

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 136   aaaatgaacaagagagaaatgaga 159
             |||||||| |||||||||||||||
Sbjct: 85060 aaaatgaataagagagaaatgaga 85037



to top

>dbj|AB078299.1| Microcebus rufus Miru-DRB gene for MHC class II antigen, exon 2,
           partial cds, allele:Miru-DRB*Wb01
          Length = 202

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 337 cggccggcccagctgcgtctccggccgg 364
           |||||||||||||| |||| ||||||||
Sbjct: 106 cggccggcccagctccgtcaccggccgg 79



to top

>dbj|AB078264.1| Hapalemur griseus griseus Hagg-DRB gene for MHC class II antigen,
           exon 2, partial cds, allele:Hagg-DRB*Wa02
          Length = 202

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 337 cggccggcccagctgcgtctccggccgg 364
           |||||||||||||| |||| ||||||||
Sbjct: 106 cggccggcccagctccgtcaccggccgg 79


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,333,532
Number of Sequences: 3902068
Number of extensions: 4333532
Number of successful extensions: 80769
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80686
Number of HSP's gapped (non-prelim): 83
length of query: 411
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 389
effective length of database: 17,147,199,772
effective search space: 6670260711308
effective search space used: 6670260711308
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top