>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces
              hansenii
          Length = 2336804

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 146    tcgaattcaatacaacacacaaaaag 171
              ||||||||||||||| ||||||||||
Sbjct: 140956 tcgaattcaatacaatacacaaaaag 140931

>ref|XM_318076.2| Anopheles gambiae str. PEST ENSANGP00000017729
           (ENSANGG00000015240), partial mRNA
          Length = 630

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 156 tacaacacacaaaaagaggaaa 177
           ||||||||||||||||||||||
Sbjct: 63  tacaacacacaaaaagaggaaa 42

>ref|XM_454967.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E22561g predicted mRNA
          Length = 2175

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 22  tcatcccaatttgtcattaa 41
           ||||||||||||||||||||
Sbjct: 920 tcatcccaatttgtcattaa 901

>gb|U23413.1| Caenorhabditis elegans cosmid B0353, complete sequence
          Length = 26112

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   acaaaaagaggaaaatctgt 183
             ||||||||||||||||||||
Sbjct: 15827 acaaaaagaggaaaatctgt 15846

>emb|AL445123.11| Human DNA sequence from clone RP11-242F11 on chromosome 6 Contains
            the 3' part of a novel gene and a novel gene, complete
            sequence
          Length = 120709

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 309  gattgaggcagcttccatcc 328
            ||||||||||||||||||||
Sbjct: 1571 gattgaggcagcttccatcc 1590

>emb|AL121950.8|HSDJ442L6 Human DNA sequence from clone RP3-442L6 on chromosome 6 Contains the 5'
             end of RHAG gene for Rhesus blood group-associated
             glycoprotein (RH50A), the TPX1 gene for Testis specific
             protein 1 and the 3' end of the gene for specific granule
             protein (28 kDa) (SGP28), complete sequence
          Length = 118524

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   gaggcaatggcagccatggg 303
             ||||||||||||||||||||
Sbjct: 73994 gaggcaatggcagccatggg 73975

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 2234072

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 22      tcatcccaatttgtcattaa 41
               ||||||||||||||||||||
Sbjct: 2002259 tcatcccaatttgtcattaa 2002278

>gb|AC174763.1| Gasterosteus aculeatus clone VMRC28-119C03, complete sequence
          Length = 138567

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 30    atttgtcattaaagcatgga 49
             ||||||||||||||||||||
Sbjct: 39595 atttgtcattaaagcatgga 39576


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,435,837
Number of Sequences: 3902068
Number of extensions: 3435837
Number of successful extensions: 83310
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83283
Number of HSP's gapped (non-prelim): 27
length of query: 394
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 372
effective length of database: 17,147,199,772
effective search space: 6378758315184
effective search space used: 6378758315184
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)