ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet94h08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY177404.1| Secale cereale O-methyltransferase mRNA, complete... 295 6e-77
2gb|AC140068.18| Medicago truncatula clone mth2-15l24, complete s... 50 0.006
3gb|AY103669.1| Zea mays PCO073521 mRNA sequence 46 0.092
4gb|AF033496.1|AF033496 Zea mays herbicide safener binding protei... 46 0.092
5gb|AC026689.6| Homo sapiens chromosome 5 clone CTB-55A14, comple... 44 0.36
6gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 42 1.4
7gb|AC124818.7| Mus musculus chromosome 14, clone RP24-505E8, com... 42 1.4
8gb|AY372453.1| Uncultured marine proteobacterium ANT32C12 fosmid... 42 1.4
9gb|AY372452.1| Uncultured marine proteobacterium ANT8C10 fosmid ... 42 1.4
10gb|AC159166.4| Atelerix albiventris clone LB4-482N5, complete se... 42 1.4
11gb|AC158982.2| Mus musculus BAC clone RP23-235N21 from chromosom... 42 1.4
12gb|U40947.1| Caenorhabditis elegans cosmid R03E9, complete sequence 42 1.4
13gb|AC153121.15| Medicago truncatula clone mth2-80o14, complete s... 42 1.4
14gb|AC152351.7| Medicago truncatula clone mth2-75b20, complete se... 42 1.4
15emb|AL731782.15| Mouse DNA sequence from clone RP23-180G3 on chr... 42 1.4
16ref|XM_480481.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.7
17gb|AC004037.1| Homo sapiens chromosome 5, BAC clone 64o24, BAC 5... 40 5.7
18emb|CR513781.13| Zebrafish DNA sequence from clone CH211-61A15 i... 40 5.7
19emb|Z92543.1|HS271G9 Human DNA sequence from clone RP1-271G9 on ... 40 5.7
20gb|AC041039.8| Homo sapiens chromosome 8, clone RP11-273P3, comp... 40 5.7
21emb|AL928834.15| Zebrafish DNA sequence from clone CH211-51E12 i... 40 5.7
22gb|AC129713.1| Homo sapiens chromosome 5 clone RP11-391B2, compl... 40 5.7
23gb|AC022721.9| Homo sapiens, clone RP11-191H13, complete sequence 40 5.7
24gb|AC084197.1| Caenorhabditis elegans cosmid Y73B6BL, complete s... 40 5.7
25gb|AC090466.5| Homo sapiens chromosome 8, clone RP11-619O19, com... 40 5.7
26dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
27gb|AC007354.3|T16B5 Arabidopsis thaliana chromosome 1 BAC T16B5 ... 40 5.7
28gb|AC008528.6|AC008528 Homo sapiens chromosome 5 clone CTC-473M1... 40 5.7
29dbj|AP005441.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
30emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromo... 40 5.7
31emb|BX890562.8| Zebrafish DNA sequence from clone CH211-222H17 i... 40 5.7
32gb|AC125380.4| Mus musculus BAC clone RP23-204N23 from 1, comple... 40 5.7
33emb|AL591373.8| Mouse DNA sequence from clone RP23-268M6 on chro... 40 5.7
34gb|AC090534.10| Mus musculus Strain C57BL6/J chromosome 18 BAC, ... 40 5.7

>gb|AY177404.1| Secale cereale O-methyltransferase mRNA, complete cds
          Length = 1373

 Score =  295 bits (149), Expect = 6e-77
 Identities = 348/411 (84%), Gaps = 8/411 (1%)
 Strand = Plus / Minus

                                                                        
Query: 13   aaaaggaaatatgatacaaagatgacagaaattacaagcttgtcacgtaggctgctacat 72
            ||||||||| |||| |||||||||| |||||||||||||||||||| ||||||| |||||
Sbjct: 1324 aaaaggaaaaatga-acaaagatga-agaaattacaagcttgtcac-taggctgttacat 1268

                                                                        
Query: 73   gataatatccttgcaaacctaaggcagtccatttannnnnnn-catcaaagcagaccatc 131
            |||||||||||||||||| || |||||| | ||||        || ||||||| ||||||
Sbjct: 1267 gataatatccttgcaaacatagggcagtgcctttatttttcttcagcaaagcaaaccatc 1208

                                                                        
Query: 132  catacataaacaaagcacactgcatgcaagggtacatcagggtactccttgggtggactt 191
            |||||||||| ||||||||||| |    |||||||   || ||||  ||||| |  ||||
Sbjct: 1207 catacataaataaagcacactgaa----agggtactaaagagtacaacttggataaactt 1152

                                                                        
Query: 192  ttaagaaaccgttcacttgtagacctcgataacacctcgtgcacccagtcttttgacaat 251
            ||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||
Sbjct: 1151 ttatgaaaccgttcacttgtagacctcgataacacctcgtgcacccagtttcttgacaat 1092

                                                                        
Query: 252  tttataatcgctgaaccctgctttggtgaataacacatgccagtcactttcactacgctg 311
            ||| || ||||| ||||||||||| ||||| | | ||||||||| | ||||||| || ||
Sbjct: 1091 tttgtagtcgctaaaccctgctttcgtgaagagctcatgccagttattttcacttcgttg 1032

                                                                        
Query: 312  acggcctctcgtgaagacaagcatgagtatgtccatcagagtctgcgcctcaaacatgac 371
            ||||||||||||||| ||||||||||| |||||||||||||| ||  ||| |||||||||
Sbjct: 1031 acggcctctcgtgaacacaagcatgaggatgtccatcagagtttgttccttaaacatgac 972

                                                               
Query: 372  tggtcctaacgatggttccaccacaatgtctatgacaatcacctttcctcc 422
            | | || || || ||  | |||||||||||||| |||||||||||||||||
Sbjct: 971  ttggcccaatgagggggcgaccacaatgtctattacaatcacctttcctcc 921



to top

>gb|AC140068.18| Medicago truncatula clone mth2-15l24, complete sequence
          Length = 111620

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 388   tccaccacaatgtctatgacaatcacctttcct 420
             |||||||| |||||||||| |||||||||||||
Sbjct: 15172 tccaccaccatgtctatgataatcacctttcct 15204



to top

>gb|AY103669.1| Zea mays PCO073521 mRNA sequence
          Length = 1503

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 259  tcgctgaaccctgctttggtgaa 281
            |||||||||||||||||||||||
Sbjct: 1069 tcgctgaaccctgctttggtgaa 1047



to top

>gb|AF033496.1|AF033496 Zea mays herbicide safener binding protein (SBP1) mRNA, complete cds
          Length = 1438

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 259  tcgctgaaccctgctttggtgaa 281
            |||||||||||||||||||||||
Sbjct: 1067 tcgctgaaccctgctttggtgaa 1045



to top

>gb|AC026689.6| Homo sapiens chromosome 5 clone CTB-55A14, complete sequence
          Length = 215150

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 137   ataaacaaagcacactgcatgc 158
             ||||||||||||||||||||||
Sbjct: 25688 ataaacaaagcacactgcatgc 25709



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 294     gtcactttcactacgctgacg 314
               |||||||||||||||||||||
Sbjct: 1351664 gtcactttcactacgctgacg 1351644



to top

>gb|AC124818.7| Mus musculus chromosome 14, clone RP24-505E8, complete sequence
          Length = 159170

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 7     tattggaaaaggaaatatgatacaa 31
             |||| ||||||||||||||||||||
Sbjct: 49690 tattagaaaaggaaatatgatacaa 49666



to top

>gb|AY372453.1| Uncultured marine proteobacterium ANT32C12 fosmid clone
          Length = 39378

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 4    aattattggaaaaggaaatat 24
            |||||||||||||||||||||
Sbjct: 9763 aattattggaaaaggaaatat 9783



to top

>gb|AY372452.1| Uncultured marine proteobacterium ANT8C10 fosmid clone
          Length = 37903

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 4     aattattggaaaaggaaatat 24
             |||||||||||||||||||||
Sbjct: 22274 aattattggaaaaggaaatat 22294



to top

>gb|AC159166.4| Atelerix albiventris clone LB4-482N5, complete sequence
          Length = 61580

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 19    aaatatgatacaaagatgaca 39
             |||||||||||||||||||||
Sbjct: 33950 aaatatgatacaaagatgaca 33970



to top

>gb|AC158982.2| Mus musculus BAC clone RP23-235N21 from chromosome 14, complete sequence
          Length = 208135

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 7      tattggaaaaggaaatatgatacaa 31
              |||| ||||||||||||||||||||
Sbjct: 207329 tattagaaaaggaaatatgatacaa 207305



to top

>gb|U40947.1| Caenorhabditis elegans cosmid R03E9, complete sequence
          Length = 41950

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 378  taacgatggttccaccacaatgtct 402
            ||||||||||||| |||||||||||
Sbjct: 7940 taacgatggttcctccacaatgtct 7964



to top

>gb|AC153121.15| Medicago truncatula clone mth2-80o14, complete sequence
          Length = 115074

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 15   aaggaaatatgatacaaagatgacagaaa 43
            |||||||||||||  ||||||||||||||
Sbjct: 1179 aaggaaatatgatctaaagatgacagaaa 1151



to top

>gb|AC152351.7| Medicago truncatula clone mth2-75b20, complete sequence
          Length = 111786

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 15    aaggaaatatgatacaaagatgacagaaa 43
             |||||||||||||  ||||||||||||||
Sbjct: 46750 aaggaaatatgatctaaagatgacagaaa 46778



to top

>emb|AL731782.15| Mouse DNA sequence from clone RP23-180G3 on chromosome X, complete
             sequence
          Length = 209800

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 317   ctctcgtgaagacaagcatga 337
             |||||||||||||||||||||
Sbjct: 57719 ctctcgtgaagacaagcatga 57699



to top

>ref|XM_480481.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1092

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 145 agcacactgcatgcaagggt 164
           ||||||||||||||||||||
Sbjct: 552 agcacactgcatgcaagggt 533



to top

>gb|AC004037.1| Homo sapiens chromosome 5, BAC clone 64o24, BAC 5001 (LBNL H101),
           complete sequence
          Length = 32424

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 13  aaaaggaaatatgatacaaa 32
           ||||||||||||||||||||
Sbjct: 546 aaaaggaaatatgatacaaa 527



to top

>emb|CR513781.13| Zebrafish DNA sequence from clone CH211-61A15 in linkage group 15,
              complete sequence
          Length = 158040

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 30     aaagatgacagaaattacaa 49
              ||||||||||||||||||||
Sbjct: 107644 aaagatgacagaaattacaa 107625



to top

>emb|Z92543.1|HS271G9 Human DNA sequence from clone RP1-271G9 on chromosome 6q22, complete
             sequence
          Length = 120376

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ttaattattggaaaaggaaa 21
             ||||||||||||||||||||
Sbjct: 65117 ttaattattggaaaaggaaa 65136



to top

>gb|AC041039.8| Homo sapiens chromosome 8, clone RP11-273P3, complete sequence
          Length = 159332

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 29    caaagatgacagaaattacaagct 52
             |||||||||||||||| |||||||
Sbjct: 19726 caaagatgacagaaatgacaagct 19749



to top

>emb|AL928834.15| Zebrafish DNA sequence from clone CH211-51E12 in linkage group 4 Contains
              the gene for a novel protein (zgc:56546), the gene for a
              novel protein similar to the Tctex-1 family, the gene for a
              novel protein similar to vertebrate tubby like protein 4
              (TULP4), the gene for a novel protein similar to vertebrate
              mitochondrial ribosomal protein S10 (MRPS10), the 3' end of
              a novel gene, two novel genes and three CpG islands,
              complete sequence
          Length = 189764

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 240    tcttttgacaattttataat 259
              ||||||||||||||||||||
Sbjct: 124745 tcttttgacaattttataat 124726



to top

>gb|AC129713.1| Homo sapiens chromosome 5 clone RP11-391B2, complete sequence
          Length = 65846

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 13  aaaaggaaatatgatacaaa 32
           ||||||||||||||||||||
Sbjct: 339 aaaaggaaatatgatacaaa 320



to top

>gb|AC022721.9| Homo sapiens, clone RP11-191H13, complete sequence
          Length = 164354

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 29    caaagatgacagaaattacaagct 52
             |||||||||||||||| |||||||
Sbjct: 19977 caaagatgacagaaatgacaagct 19954



to top

>gb|AC084197.1| Caenorhabditis elegans cosmid Y73B6BL, complete sequence
          Length = 216143

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   cttttgacaattttataatc 260
             ||||||||||||||||||||
Sbjct: 48038 cttttgacaattttataatc 48057



to top

>gb|AC090466.5| Homo sapiens chromosome 8, clone RP11-619O19, complete sequence
          Length = 191049

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 29     caaagatgacagaaattacaagct 52
              |||||||||||||||| |||||||
Sbjct: 183486 caaagatgacagaaatgacaagct 183463



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 145     agcacactgcatgcaagggt 164
               ||||||||||||||||||||
Sbjct: 5376615 agcacactgcatgcaagggt 5376634



to top

>gb|AC007354.3|T16B5 Arabidopsis thaliana chromosome 1 BAC T16B5 sequence, complete sequence
          Length = 70116

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 4     aattattggaaaaggaaata 23
             ||||||||||||||||||||
Sbjct: 11508 aattattggaaaaggaaata 11527



to top

>gb|AC008528.6|AC008528 Homo sapiens chromosome 5 clone CTC-473M13, complete sequence
          Length = 125764

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    aaaaggaaatatgatacaaa 32
             ||||||||||||||||||||
Sbjct: 11658 aaaaggaaatatgatacaaa 11677



to top

>dbj|AP005441.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0056O06
          Length = 151038

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   agcacactgcatgcaagggt 164
             ||||||||||||||||||||
Sbjct: 46426 agcacactgcatgcaagggt 46445



to top

>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib
          Length = 2013089

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 14     aaaggaaatatgatacaaagatga 37
              ||||||| ||||||||||||||||
Sbjct: 875301 aaaggaagtatgatacaaagatga 875278



to top

>emb|BX890562.8| Zebrafish DNA sequence from clone CH211-222H17 in linkage group 4,
             complete sequence
          Length = 195554

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 240   tcttttgacaattttataat 259
             ||||||||||||||||||||
Sbjct: 72864 tcttttgacaattttataat 72883



to top

>gb|AC125380.4| Mus musculus BAC clone RP23-204N23 from 1, complete sequence
          Length = 214005

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 134   tacataaacaaagcacactg 153
             ||||||||||||||||||||
Sbjct: 31022 tacataaacaaagcacactg 31003



to top

>emb|AL591373.8| Mouse DNA sequence from clone RP23-268M6 on chromosome 18, complete
             sequence
          Length = 174264

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 235   cccagtcttttgacaattttataa 258
             ||||||||| ||||||||||||||
Sbjct: 33435 cccagtcttctgacaattttataa 33458



to top

>gb|AC090534.10| Mus musculus Strain C57BL6/J chromosome 18 BAC, RP23-233F17, complete
              sequence
          Length = 176773

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 235    cccagtcttttgacaattttataa 258
              ||||||||| ||||||||||||||
Sbjct: 156054 cccagtcttctgacaattttataa 156077


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,499,476
Number of Sequences: 3902068
Number of extensions: 3499476
Number of successful extensions: 69075
Number of sequences better than 10.0: 34
Number of HSP's better than 10.0 without gapping: 34
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68994
Number of HSP's gapped (non-prelim): 79
length of query: 422
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 400
effective length of database: 17,147,199,772
effective search space: 6858879908800
effective search space used: 6858879908800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top