ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bastl55e12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC107023.4| Homo sapiens 12 BAC RP11-115F18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 150353 Score = 42.1 bits (21), Expect = 0.25 Identities = 21/21 (100%) Strand = Plus / Plus Query: 7 tccttccttccttgcctgctt 27 ||||||||||||||||||||| Sbjct: 137695 tccttccttccttgcctgctt 137715
>gb|AC157532.2| Pan troglodytes BAC clone CH251-305A6 from chromosome unknown, complete sequence Length = 204179 Score = 42.1 bits (21), Expect = 0.25 Identities = 21/21 (100%) Strand = Plus / Minus Query: 7 tccttccttccttgcctgctt 27 ||||||||||||||||||||| Sbjct: 77323 tccttccttccttgcctgctt 77303
>gb|AC115719.10| Mus musculus chromosome 18, clone RP24-356J16, complete sequence Length = 177037 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 ttccttccttccttgcctgc 25 |||||||||||||||||||| Sbjct: 18662 ttccttccttccttgcctgc 18643
>gb|AC121267.17| Mus musculus chromosome 19, clone RP24-444E1, complete sequence Length = 160720 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 ttccttccttccttgcctgc 25 |||||||||||||||||||| Sbjct: 13915 ttccttccttccttgcctgc 13934
>gb|AC100755.8| Homo sapiens chromosome 15, clone RP11-262J5, complete sequence Length = 174177 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 7 tccttccttccttgcctgct 26 |||||||||||||||||||| Sbjct: 87238 tccttccttccttgcctgct 87219
>gb|AC124448.4| Mus musculus BAC clone RP24-211A8 from chromosome 18, complete sequence Length = 159308 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 ttccttccttccttgcctgc 25 |||||||||||||||||||| Sbjct: 62449 ttccttccttccttgcctgc 62430
>gb|AC131759.3| Mus musculus BAC clone RP24-212D8 from chromosome 12, complete sequence Length = 166128 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 ggttccttccttccttgcct 23 |||||||||||||||||||| Sbjct: 48373 ggttccttccttccttgcct 48354
>gb|AC125229.3| Mus musculus BAC clone RP23-45P1 from 5, complete sequence Length = 167771 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 ttccttccttccttgcctgc 25 |||||||||||||||||||| Sbjct: 128502 ttccttccttccttgcctgc 128483
>emb|AL049762.20|HSDJ81F6 Human DNA sequence from clone RP1-81F6 on chromosome 1q24.1-25.2 Contains the 5' end of the gene for HBxAg transactivated protein 2 (XTP2), complete sequence Length = 100575 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 ttccttccttccttgcctgc 25 |||||||||||||||||||| Sbjct: 94009 ttccttccttccttgcctgc 93990
>gb|AC100756.4| Homo sapiens chromosome 18, clone RP11-529J17, complete sequence Length = 173833 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 7 tccttccttccttgcctgct 26 |||||||||||||||||||| Sbjct: 86894 tccttccttccttgcctgct 86875
>gb|AC104247.5| Homo sapiens chromosome 8, clone RP11-1077K19, complete sequence Length = 118230 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Plus Query: 8 ccttccttccttgcctgctt 27 |||||||||||||||||||| Sbjct: 3937 ccttccttccttgcctgctt 3956
>gb|AC104248.3| Homo sapiens chromosome 8, clone RP11-1084E5, complete sequence Length = 200318 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 ccttccttccttgcctgctt 27 |||||||||||||||||||| Sbjct: 4505 ccttccttccttgcctgctt 4486
>gb|AC109632.4| Homo sapiens chromosome 8, clone RP11-46A19, complete sequence Length = 152232 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Plus Query: 8 ccttccttccttgcctgctt 27 |||||||||||||||||||| Sbjct: 94869 ccttccttccttgcctgctt 94888
>gb|AC090527.3|AC090527 Homo sapiens chromosome 15 clone RP11-96O20 map 15q21.1, complete sequence Length = 173585 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 ttccttccttccttgcctgc 25 |||||||||||||||||||| Sbjct: 6157 ttccttccttccttgcctgc 6176
>gb|AC154831.2| Mus musculus BAC clone RP24-556A11 from chromosome 12, complete sequence Length = 199712 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 ccttccttccttgcctgctt 27 |||||||||||||||||||| Sbjct: 51257 ccttccttccttgcctgctt 51238
>gb|AC025580.8| Homo sapiens chromosome 15 clone RP11-519G16 map 15q21.1, complete sequence Length = 200803 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 ttccttccttccttgcctgc 25 |||||||||||||||||||| Sbjct: 192722 ttccttccttccttgcctgc 192741
>gb|AC109338.17| Homo sapiens chromosome 15, clone RP11-228G18, complete sequence Length = 141868 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 7 tccttccttccttgcctgct 26 |||||||||||||||||||| Sbjct: 76421 tccttccttccttgcctgct 76402
>gb|AC112967.14| Mus musculus chromosome 19, clone RP24-151O21, complete sequence Length = 167743 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 ttccttccttccttgcctgc 25 |||||||||||||||||||| Sbjct: 112350 ttccttccttccttgcctgc 112369
>gb|AC148012.5| Mus musculus BAC clone RP23-174D18 from 18, complete sequence Length = 226568 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 ttccttccttccttgcctgc 25 |||||||||||||||||||| Sbjct: 178878 ttccttccttccttgcctgc 178859
>gb|AC073446.16| Homo sapiens chromosome 15, clone RP11-757E13, complete sequence Length = 185123 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Plus Query: 7 tccttccttccttgcctgct 26 |||||||||||||||||||| Sbjct: 73543 tccttccttccttgcctgct 73562
>dbj|AP003788.1| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1123F5, complete sequence Length = 142348 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 ccttccttccttgcctgctt 27 |||||||||||||||||||| Sbjct: 119781 ccttccttccttgcctgctt 119762
>gb|AC152451.5| Mus musculus BAC clone RP24-309M5 from chromosome 12, complete sequence Length = 145113 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 14910 tttggttccttccttcctt 14892
>gb|AC124543.4| Mus musculus BAC clone RP23-264A21 from chromosome 15, complete sequence Length = 224760 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 179883 tttggttccttccttcctt 179901
>gb|AC122013.4| Mus musculus BAC clone RP24-357P7 from chromosome 12, complete sequence Length = 175788 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 72504 tttggttccttccttcctt 72522
>gb|AC114004.5| Mus musculus BAC clone RP23-174P2 from 7, complete sequence Length = 187196 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 79420 tttggttccttccttcctt 79402
>gb|AC124531.5| Mus musculus BAC clone RP23-299D2 from 7, complete sequence Length = 191228 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 60215 tttggttccttccttcctt 60197
>gb|AC116592.5| Mus musculus BAC clone RP24-90K3 from 2, complete sequence Length = 238657 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 121175 tttggttccttccttcctt 121193
>gb|AC015968.4| Homo sapiens BAC clone RP11-133L20 from 7, complete sequence Length = 128638 Score = 38.2 bits (19), Expect = 3.9 Identities = 22/23 (95%) Strand = Plus / Plus Query: 67 gacgatcccaccacaggggacca 89 |||| |||||||||||||||||| Sbjct: 159 gacggtcccaccacaggggacca 181
>gb|AC073550.14| Homo sapiens BAC clone RP11-457C23 from 7, complete sequence Length = 47362 Score = 38.2 bits (19), Expect = 3.9 Identities = 22/23 (95%) Strand = Plus / Minus Query: 67 gacgatcccaccacaggggacca 89 |||| |||||||||||||||||| Sbjct: 1842 gacggtcccaccacaggggacca 1820
>emb|AL358532.11| Human DNA sequence from clone RP11-186O14 on chromosome 10 Contains the LIPF gene for gastric lipase, the genes for two novel ab-hydrolase associated lipase region domain containing proteins and a CHC1L (chromosome condensation 1-like RCC1-like G exchanging factor RLG) pseudogene, complete sequence Length = 161826 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 6 ttccttccttccttgcctg 24 ||||||||||||||||||| Sbjct: 70424 ttccttccttccttgcctg 70442
>emb|AL354694.18| Human DNA sequence from clone RP11-77E14 on chromosome 9 Contains a novel gene, complete sequence Length = 153324 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 6 ttccttccttccttgcctg 24 ||||||||||||||||||| Sbjct: 151658 ttccttccttccttgcctg 151640
>emb|AL160279.21| Human DNA sequence from clone RP11-65B23 on chromosome 9 Contains the 3' end of the DAPK1 gene for death-associated protein kinase 1, the CTSL gene for cathepsin L, a ,eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa (EIF3S1) pseudogene, a cathepsin pseudogene and two CpG islands, complete sequence Length = 170240 Score = 38.2 bits (19), Expect = 3.9 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 tttggttccttccttccttgcct 23 |||| |||||||||||||||||| Sbjct: 76329 tttgtttccttccttccttgcct 76307
>emb|AL139801.17| Human DNA sequence from clone RP11-247M1 on chromosome 13 Contains a novel FLJ21562 containing gene, a novel gene, a novel pseudogene and a CpG island, complete sequence Length = 145481 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 9128 tttggttccttccttcctt 9146
>emb|AL713994.15| Mouse DNA sequence from clone RP23-378H5 on chromosome 11 Contains the 5' end of the Arf-1 gene for ADP-ribosylation factor 1, the Wnt3a gene for wingless-related MMTV integration site 3A, the Wnt9a gene for wingless-type MMTV integration site 9A, two novel genes, the 5' end of a novel gene and five CpG islands, complete sequence Length = 225396 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 9 cttccttccttgcctgctt 27 ||||||||||||||||||| Sbjct: 69771 cttccttccttgcctgctt 69789
>gb|AC162917.3| Mus musculus BAC clone RP23-379N7 from chromosome 9, complete sequence Length = 189606 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 186639 tttggttccttccttcctt 186621
>gb|AC158973.3| Mus musculus chromosome 15, clone RP24-236A19, complete sequence Length = 187091 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 58885 tttggttccttccttcctt 58903
>gb|AC099816.2| Homo sapiens, clone RP11-18K20, complete sequence Length = 151460 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 6 ttccttccttccttgcctg 24 ||||||||||||||||||| Sbjct: 1280 ttccttccttccttgcctg 1262
>gb|AC105026.4| Homo sapiens chromosome 8, clone CTD-2152D24, complete sequence Length = 121171 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 6 ttccttccttccttgcctg 24 ||||||||||||||||||| Sbjct: 115102 ttccttccttccttgcctg 115084
>gb|AC099482.3| Homo sapiens chromosome 16 clone CTC-391G2, complete sequence Length = 109071 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 7 tccttccttccttgcctgc 25 ||||||||||||||||||| Sbjct: 65748 tccttccttccttgcctgc 65766
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 24771822 tttggttccttccttcctt 24771804
>gb|AC145937.2| Pan troglodytes BAC clone RP43-10P16 from chromosome 7, complete sequence Length = 182785 Score = 38.2 bits (19), Expect = 3.9 Identities = 22/23 (95%) Strand = Plus / Minus Query: 67 gacgatcccaccacaggggacca 89 |||| |||||||||||||||||| Sbjct: 148534 gacggtcccaccacaggggacca 148512
>gb|AC101819.10| Mus musculus chromosome 15, clone RP24-375C3, complete sequence Length = 131280 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 108225 tttggttccttccttcctt 108207
>gb|AC007220.4|AC007220 Homo sapiens chromosome 16 clone RP11-396B14, complete sequence Length = 172945 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 6170 tttggttccttccttcctt 6188
>emb|BX005341.6| Zebrafish DNA sequence from clone DKEY-209J17 in linkage group 16, complete sequence Length = 158356 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 49762 tttggttccttccttcctt 49780
>gb|U48937.2|U48937 Homo sapiens amiloride-sensitive epithelial sodium channel gamma subunit gene, promoter region and exon 1 Length = 3278 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 7 tccttccttccttgcctgc 25 ||||||||||||||||||| Sbjct: 2061 tccttccttccttgcctgc 2043
>dbj|AP004680.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0029G06 Length = 169711 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 105503 tttggttccttccttcctt 105485
>emb|CR391975.8| Zebrafish DNA sequence from clone CH211-276C20 in linkage group 18, complete sequence Length = 122652 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 9 cttccttccttgcctgctt 27 ||||||||||||||||||| Sbjct: 47219 cttccttccttgcctgctt 47201
>emb|CR388185.10| Zebrafish DNA sequence from clone CH211-256G21 in linkage group 18, complete sequence Length = 178361 Score = 38.2 bits (19), Expect = 3.9 Identities = 22/23 (95%) Strand = Plus / Minus Query: 5 gttccttccttccttgcctgctt 27 ||||||||||||||||| ||||| Sbjct: 171311 gttccttccttccttgcttgctt 171289
>gb|AC007014.1|AC007014 Homo sapiens chromosome 16 clone 66H6, complete sequence Length = 167080 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 17073 tttggttccttccttcctt 17055
>emb|AL953851.13| Mouse DNA sequence from clone RP24-423N4 on chromosome 4, complete sequence Length = 43627 Score = 38.2 bits (19), Expect = 3.9 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 tttggttccttccttccttgcct 23 |||| |||||||||||||||||| Sbjct: 12252 tttgcttccttccttccttgcct 12274
>gb|AC156981.13| Mus musculus chromosome 18, clone RP23-145E3, complete sequence Length = 210762 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 115104 tttggttccttccttcctt 115086
>gb|AC135358.3| Mus musculus BAC clone RP24-107J13 from 9, complete sequence Length = 182075 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 102439 tttggttccttccttcctt 102457
>emb|AL845529.10| Mouse DNA sequence from clone RP23-276D17 on chromosome 2, complete sequence Length = 166971 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 1 tttggttccttccttcctt 19 ||||||||||||||||||| Sbjct: 98877 tttggttccttccttcctt 98859 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,223,065 Number of Sequences: 3902068 Number of extensions: 1223065 Number of successful extensions: 615433 Number of sequences better than 10.0: 53 Number of HSP's better than 10.0 without gapping: 53 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 614593 Number of HSP's gapped (non-prelim): 840 length of query: 91 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 70 effective length of database: 17,151,101,840 effective search space: 1200577128800 effective search space used: 1200577128800 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
