Clone Name | bastl55a09 |
---|---|
Clone Library Name | barley_pub |
>gb|AC135916.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0088M06, from chromosome 5, complete sequence Length = 150099 Score = 38.2 bits (19), Expect = 0.90 Identities = 22/23 (95%) Strand = Plus / Plus Query: 12 tttaatcgccagctctctctctc 34 |||||||| |||||||||||||| Sbjct: 108024 tttaatcgtcagctctctctctc 108046
>gb|AC135922.2| Oryza sativa (japonica cultivar-group) chromosome 5 PAC clone P0411C02, complete sequence Length = 145676 Score = 38.2 bits (19), Expect = 0.90 Identities = 22/23 (95%) Strand = Plus / Plus Query: 12 tttaatcgccagctctctctctc 34 |||||||| |||||||||||||| Sbjct: 104301 tttaatcgtcagctctctctctc 104323
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 38.2 bits (19), Expect = 0.90 Identities = 22/23 (95%) Strand = Plus / Minus Query: 12 tttaatcgccagctctctctctc 34 |||||||| |||||||||||||| Sbjct: 22984435 tttaatcgtcagctctctctctc 22984413
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 38.2 bits (19), Expect = 0.90 Identities = 22/23 (95%) Strand = Plus / Plus Query: 12 tttaatcgccagctctctctctc 34 |||||||| |||||||||||||| Sbjct: 13024232 tttaatcgtcagctctctctctc 13024254 Score = 38.2 bits (19), Expect = 0.90 Identities = 22/23 (95%) Strand = Plus / Plus Query: 12 tttaatcgccagctctctctctc 34 |||||||| |||||||||||||| Sbjct: 9599341 tttaatcgtcagctctctctctc 9599363
>gb|AY188753.1| Pectobacterium carotovorum subsp. carotovorum cellulase (celC) gene, complete cds Length = 1875 Score = 38.2 bits (19), Expect = 0.90 Identities = 22/23 (95%) Strand = Plus / Minus Query: 12 tttaatcgccagctctctctctc 34 |||||||||||||||||| |||| Sbjct: 887 tttaatcgccagctctctttctc 865
>dbj|AP005908.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1121_A05 Length = 172668 Score = 38.2 bits (19), Expect = 0.90 Identities = 22/23 (95%) Strand = Plus / Minus Query: 12 tttaatcgccagctctctctctc 34 |||||||| |||||||||||||| Sbjct: 59649 tttaatcgtcagctctctctctc 59627
>gb|AC158406.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone P0047E03, complete sequence Length = 156641 Score = 38.2 bits (19), Expect = 0.90 Identities = 22/23 (95%) Strand = Plus / Plus Query: 12 tttaatcgccagctctctctctc 34 |||||||| |||||||||||||| Sbjct: 144466 tttaatcgtcagctctctctctc 144488
>ref|XM_593401.2| PREDICTED: Bos taurus hypothetical LOC515386 (LOC515386), mRNA Length = 1795 Score = 36.2 bits (18), Expect = 3.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 17 tcgccagctctctctctc 34 |||||||||||||||||| Sbjct: 1574 tcgccagctctctctctc 1557
>gb|AC147679.13| Canis Familiaris, clone XX-10F3, complete sequence Length = 193944 Score = 36.2 bits (18), Expect = 3.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 2 taaagctttctttaatcg 19 |||||||||||||||||| Sbjct: 46120 taaagctttctttaatcg 46103
>gb|BC116118.1| Bos taurus cDNA clone MGC:138919 IMAGE:8091384, complete cds Length = 1770 Score = 36.2 bits (18), Expect = 3.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 17 tcgccagctctctctctc 34 |||||||||||||||||| Sbjct: 1519 tcgccagctctctctctc 1502
>emb|AL929319.4| Zebrafish DNA sequence from clone CH211-59F17 in linkage group 10, complete sequence Length = 194614 Score = 36.2 bits (18), Expect = 3.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 1 ataaagctttctttaatcgcca 22 |||||| ||||||||||||||| Sbjct: 96182 ataaaggtttctttaatcgcca 96203
>gb|AC129016.4| Mus musculus BAC clone RP24-389J11 from chromosome 10, complete sequence Length = 160180 Score = 36.2 bits (18), Expect = 3.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 17 tcgccagctctctctctc 34 |||||||||||||||||| Sbjct: 152566 tcgccagctctctctctc 152549
>emb|AL358074.22| Human DNA sequence from clone RP11-423C15 on chromosome 9 Contains the 5' end of the MAPKAP1 gene for mitogen-activated protein kinase associated protein 1, a novel gene, the 5' end of the PBX3 gene for pre-B-cell leukemia transcription factor 3 and three CpG islands, complete sequence Length = 109081 Score = 36.2 bits (18), Expect = 3.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 12 tttaatcgccagctctctctct 33 |||||| ||||||||||||||| Sbjct: 8665 tttaattgccagctctctctct 8644
>emb|AL732562.8| Zebrafish DNA sequence from clone CH211-103D22 in linkage group 10 Contains the 3' part of the cxadr gene (coxsackie virus and adenovirus receptor), a novel gene similar to AUTS2 (autism-related protein 1) and four CpG islands, complete sequence Length = 187365 Score = 36.2 bits (18), Expect = 3.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 1 ataaagctttctttaatcgcca 22 |||||| ||||||||||||||| Sbjct: 136429 ataaaggtttctttaatcgcca 136450
>gb|AC098859.2| Homo sapiens BAC clone RP11-173E2 from 4, complete sequence Length = 183680 Score = 36.2 bits (18), Expect = 3.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 3 aaagctttctttaatcgc 20 |||||||||||||||||| Sbjct: 152153 aaagctttctttaatcgc 152170
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 36.2 bits (18), Expect = 3.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 16 atcgccagctctctctct 33 |||||||||||||||||| Sbjct: 12826897 atcgccagctctctctct 12826914
>dbj|AP004811.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0019A05 Length = 144255 Score = 36.2 bits (18), Expect = 3.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 16 atcgccagctctctctct 33 |||||||||||||||||| Sbjct: 127674 atcgccagctctctctct 127691
>gb|AC153958.2| Mus musculus 10 BAC RP24-541B4 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 176618 Score = 36.2 bits (18), Expect = 3.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 17 tcgccagctctctctctc 34 |||||||||||||||||| Sbjct: 106048 tcgccagctctctctctc 106065 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,723,075 Number of Sequences: 3902068 Number of extensions: 4723075 Number of successful extensions: 171365 Number of sequences better than 10.0: 18 Number of HSP's better than 10.0 without gapping: 19 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 170854 Number of HSP's gapped (non-prelim): 511 length of query: 36 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 16 effective length of database: 17,155,003,908 effective search space: 274480062528 effective search space used: 274480062528 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)