Clone Name | bastl54e01 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence | 38 | 5.6 | 2 | emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete ... | 38 | 5.6 | 3 | gb|AE005931.1| Caulobacter crescentus CB15 section 257 of 359 of... | 38 | 5.6 |
---|
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence Length = 3694126 Score = 38.2 bits (19), Expect = 5.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 6 tgcagtgcaagaagtaagg 24 ||||||||||||||||||| Sbjct: 3547873 tgcagtgcaagaagtaagg 3547891 Score = 38.2 bits (19), Expect = 5.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 99 gcaggccgtcgagaaggcg 117 ||||||||||||||||||| Sbjct: 940158 gcaggccgtcgagaaggcg 940140
>emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29 Length = 283100 Score = 38.2 bits (19), Expect = 5.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 103 gccgtcgagaaggcggagg 121 ||||||||||||||||||| Sbjct: 60430 gccgtcgagaaggcggagg 60412
>gb|AE005931.1| Caulobacter crescentus CB15 section 257 of 359 of the complete genome Length = 8649 Score = 38.2 bits (19), Expect = 5.6 Identities = 25/27 (92%) Strand = Plus / Plus Query: 93 cggcatgcaggccgtcgagaaggcgga 119 ||||| ||||||||| ||||||||||| Sbjct: 3918 cggcaagcaggccgtggagaaggcgga 3944 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 236,632 Number of Sequences: 3902068 Number of extensions: 236632 Number of successful extensions: 16100 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 16061 Number of HSP's gapped (non-prelim): 39 length of query: 122 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 101 effective length of database: 17,151,101,840 effective search space: 1732261285840 effective search space used: 1732261285840 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)