>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                          
Query: 40       aaaatggcgaaatcgccggccgatcggagcccaatctgagcc 81
                ||||||||| |||||||||| |||||||||||||||||||||
Sbjct: 36272308 aaaatggcggaatcgccggctgatcggagcccaatctgagcc 36272349



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                            
Query: 145      gaaatggccgccactgtcccgatcgggctcgcggcgctcgattcggtggtgttctggccc 204
                |||||||| ||||| | |||||||||||| |||  || ||||||||||||| ||||||| 
Sbjct: 36272413 gaaatggcggccaccgccccgatcgggcttgcgaagcgcgattcggtggtgctctggcct 36272472

                                   
Query: 205      gggggacccgagagctgca 223
                ||||| | || ||||||||
Sbjct: 36272473 gggggtctcgcgagctgca 36272491

>dbj|AP003251.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0446B05
          Length = 149145

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                       
Query: 40    aaaatggcgaaatcgccggccgatcggagcccaatctgagcc 81
             ||||||||| |||||||||| |||||||||||||||||||||
Sbjct: 22185 aaaatggcggaatcgccggctgatcggagcccaatctgagcc 22226



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                         
Query: 145   gaaatggccgccactgtcccgatcgggctcgcggcgctcgattcggtggtgttctggccc 204
             |||||||| ||||| | |||||||||||| |||  || ||||||||||||| ||||||| 
Sbjct: 22290 gaaatggcggccaccgccccgatcgggcttgcgaagcgcgattcggtggtgctctggcct 22349

                                
Query: 205   gggggacccgagagctgca 223
             ||||| | || ||||||||
Sbjct: 22350 gggggtctcgcgagctgca 22368

>dbj|AK099801.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098A15, full
           insert sequence
          Length = 3958

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                     
Query: 40  aaaatggcgaaatcgccggccgatcggagcccaatctgagcc 81
           ||||||||| |||||||||| |||||||||||||||||||||
Sbjct: 98  aaaatggcggaatcgccggctgatcggagcccaatctgagcc 139



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 145 gaaatggccgccactgtcccgatcgggctcgcggcgctcgattcggtggtgttctggccc 204
           |||||||| ||||| | |||||||||||| |||  || ||||||||||||| ||||||| 
Sbjct: 203 gaaatggcggccaccgccccgatcgggcttgcgaagcgcgattcggtggtgctctggcct 262

                              
Query: 205 gggggacccgagagctgca 223
           ||||| | || ||||||||
Sbjct: 263 gggggtctcgcgagctgca 281

>dbj|AK102882.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033112I24, full
           insert sequence
          Length = 2841

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 145 gaaatggccgccactgtcccgatcgggctcgcggcgctcgattcggtggtgttctggccc 204
           |||||||| ||||| | |||||||||||| |||  || ||||||||||||| ||||||| 
Sbjct: 199 gaaatggcggccaccgccccgatcgggcttgcgaagcgcgattcggtggtgctctggcct 258

                              
Query: 205 gggggacccgagagctgca 223
           ||||| | || ||||||||
Sbjct: 259 gggggtctcgcgagctgca 277



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 44  tggcgaaatcgccggccgatcggagcccaatctgagcc 81
           ||||| |||||||||| |||||||||||||||||||||
Sbjct: 98  tggcggaatcgccggctgatcggagcccaatctgagcc 135

>ref|XM_848007.1| PREDICTED: Canis familiaris similar to Rho GTPase activating
           protein 15 (LOC490917), mRNA
          Length = 2272

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 379 ggaggacgagccggaggacgagcttgagg 407
           |||||||||||||||||||||||| ||||
Sbjct: 448 ggaggacgagccggaggacgagctggagg 476

>ref|XM_754401.1| Ustilago maydis 521 hypothetical protein (UM03347.1) partial mRNA
          Length = 7092

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 376  ggaggaggacgagccggagga 396
            |||||||||||||||||||||
Sbjct: 6585 ggaggaggacgagccggagga 6605

>gb|BC060492.1| Xenopus laevis cDNA clone IMAGE:4174459, partial cds
          Length = 2711

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 377  gaggaggacgagccggaggacgagcttga 405
            ||||| |||||| ||||||||||||||||
Sbjct: 2539 gaggacgacgagtcggaggacgagcttga 2567

>ref|XM_949170.1| Theileria annulata strain Ankara hypothetical protein (TA20520)
          partial mRNA
          Length = 648

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 29 tttggttccccaaaatggcga 49
          |||||||||||||||||||||
Sbjct: 66 tttggttccccaaaatggcga 86

>ref|XM_391974.2| PREDICTED: Apis mellifera similar to GA21110-PA (LOC408427), mRNA
          Length = 7845

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 377  gaggaggacgagccggaggacgagc 401
            ||||| |||||||||||||||||||
Sbjct: 4084 gaggacgacgagccggaggacgagc 4108

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 163     ccgatcgggctcgcggcgctc 183
               |||||||||||||||||||||
Sbjct: 1838408 ccgatcgggctcgcggcgctc 1838388

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 163     ccgatcgggctcgcggcgct 182
               ||||||||||||||||||||
Sbjct: 2947972 ccgatcgggctcgcggcgct 2947991

>gb|AC104881.9| Mus musculus chromosome 18, clone RP23-244A24, complete sequence
          Length = 184796

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    agagctgcaggttttctgat 234
              ||||||||||||||||||||
Sbjct: 119850 agagctgcaggttttctgat 119869

>ref|XM_543327.2| PREDICTED: Canis familiaris similar to kinesin family member 1B
            (LOC486202), mRNA
          Length = 5076

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 376  ggaggaggacgagccggaggacga 399
            ||||||||| ||||||||||||||
Sbjct: 3207 ggaggaggaagagccggaggacga 3230

>ref|XM_801206.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053506217.40) partial mRNA
          Length = 3144

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 403  tgaggctttgctccgtgccggtgg 426
            ||||||||||||||| ||||||||
Sbjct: 2761 tgaggctttgctccgcgccggtgg 2738

>ref|XM_802226.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053506341.50) partial mRNA
          Length = 3126

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 403  tgaggctttgctccgtgccggtgg 426
            ||||||||||||||| ||||||||
Sbjct: 2740 tgaggctttgctccgcgccggtgg 2717

>ref|XM_804975.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053509581.10) partial mRNA
          Length = 3444

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 403  tgaggctttgctccgtgccggtgg 426
            |||||||| |||||||||||||||
Sbjct: 3052 tgaggcttcgctccgtgccggtgg 3029

>ref|XM_807627.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053505365.60) partial mRNA
          Length = 3126

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 403  tgaggctttgctccgtgccggtgg 426
            ||||||||||||||| ||||||||
Sbjct: 2734 tgaggctttgctccgcgccggtgg 2711

>ref|XM_807863.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053510847.10) partial mRNA
          Length = 3018

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 403  tgaggctttgctccgtgccggtgg 426
            ||||||||||||||| ||||||||
Sbjct: 2632 tgaggctttgctccgcgccggtgg 2609

>ref|XM_808523.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053506975.90) partial mRNA
          Length = 3117

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 403  tgaggctttgctccgtgccggtgg 426
            ||||||||||||||| ||||||||
Sbjct: 2728 tgaggctttgctccgcgccggtgg 2705

>ref|XM_811368.1| Trypanosoma cruzi strain CL Brener complement regulatory protein
            (Tc00.1047053509217.160) partial mRNA
          Length = 3165

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 403  tgaggctttgctccgtgccggtgg 426
            ||||||||||||||| ||||||||
Sbjct: 2773 tgaggctttgctccgcgccggtgg 2750

>ref|XM_812240.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053503861.40) partial mRNA
          Length = 3114

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 403  tgaggctttgctccgtgccggtgg 426
            ||||||||| ||||||||||||||
Sbjct: 2725 tgaggctttcctccgtgccggtgg 2702

>ref|XM_813755.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053510643.40) partial mRNA
          Length = 3162

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 403  tgaggctttgctccgtgccggtgg 426
            ||||||||||||||| ||||||||
Sbjct: 2770 tgaggctttgctccgcgccggtgg 2747

>ref|XM_798237.1| Trypanosoma cruzi strain CL Brener trans-sialidase
           (Tc00.1047053509841.10) partial mRNA
          Length = 696

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 403 tgaggctttgctccgtgccggtgg 426
           ||||||||||||||| ||||||||
Sbjct: 310 tgaggctttgctccgcgccggtgg 287

>ref|XM_799130.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053510981.20) partial mRNA
          Length = 2242

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 403  tgaggctttgctccgtgccggtgg 426
            ||||||||||||||| ||||||||
Sbjct: 1856 tgaggctttgctccgcgccggtgg 1833

>ref|XM_801651.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053511105.60) partial mRNA
          Length = 2370

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 403  tgaggctttgctccgtgccggtgg 426
            ||||||||||||||| ||||||||
Sbjct: 1984 tgaggctttgctccgcgccggtgg 1961

>emb|BX883047.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
              assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
              RT1n haplotype; segment 6/11
          Length = 349571

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     aagccccgggtttggttccc 38
              ||||||||||||||||||||
Sbjct: 226776 aagccccgggtttggttccc 226757

>emb|BX572605.1| Rhodopseudomonas palustris CGA009 complete genome; segment 13/16
          Length = 349746

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 162    cccgatcgggctcgcggcgc 181
              ||||||||||||||||||||
Sbjct: 299705 cccgatcgggctcgcggcgc 299686

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 163     ccgatcgggctcgcggcgct 182
               ||||||||||||||||||||
Sbjct: 1126501 ccgatcgggctcgcggcgct 1126520

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 198     ctggcccgggggacccgagagctg 221
               ||||||||||||||||| ||||||
Sbjct: 4879450 ctggcccgggggacccgggagctg 4879473

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 163    ccgatcgggctcgcggcgct 182
              ||||||||||||||||||||
Sbjct: 721151 ccgatcgggctcgcggcgct 721170

>gb|AC158772.5| Mus musculus chromosome 18, clone RP23-291M14, complete sequence
          Length = 198851

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 215  agagctgcaggttttctgat 234
            ||||||||||||||||||||
Sbjct: 3200 agagctgcaggttttctgat 3219

>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome
          Length = 4303871

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 151     gccgccactgtcccgatcgg 170
               ||||||||||||||||||||
Sbjct: 3679437 gccgccactgtcccgatcgg 3679456


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,448,136
Number of Sequences: 3902068
Number of extensions: 2448136
Number of successful extensions: 46230
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45685
Number of HSP's gapped (non-prelim): 545
length of query: 431
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 409
effective length of database: 17,147,199,772
effective search space: 7013204706748
effective search space used: 7013204706748
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)