| Clone Name | bastl54d11 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Plus Query: 40 aaaatggcgaaatcgccggccgatcggagcccaatctgagcc 81 ||||||||| |||||||||| ||||||||||||||||||||| Sbjct: 36272308 aaaatggcggaatcgccggctgatcggagcccaatctgagcc 36272349 Score = 61.9 bits (31), Expect = 2e-06 Identities = 67/79 (84%) Strand = Plus / Plus Query: 145 gaaatggccgccactgtcccgatcgggctcgcggcgctcgattcggtggtgttctggccc 204 |||||||| ||||| | |||||||||||| ||| || ||||||||||||| ||||||| Sbjct: 36272413 gaaatggcggccaccgccccgatcgggcttgcgaagcgcgattcggtggtgctctggcct 36272472 Query: 205 gggggacccgagagctgca 223 ||||| | || |||||||| Sbjct: 36272473 gggggtctcgcgagctgca 36272491
>dbj|AP003251.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0446B05 Length = 149145 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Plus Query: 40 aaaatggcgaaatcgccggccgatcggagcccaatctgagcc 81 ||||||||| |||||||||| ||||||||||||||||||||| Sbjct: 22185 aaaatggcggaatcgccggctgatcggagcccaatctgagcc 22226 Score = 61.9 bits (31), Expect = 2e-06 Identities = 67/79 (84%) Strand = Plus / Plus Query: 145 gaaatggccgccactgtcccgatcgggctcgcggcgctcgattcggtggtgttctggccc 204 |||||||| ||||| | |||||||||||| ||| || ||||||||||||| ||||||| Sbjct: 22290 gaaatggcggccaccgccccgatcgggcttgcgaagcgcgattcggtggtgctctggcct 22349 Query: 205 gggggacccgagagctgca 223 ||||| | || |||||||| Sbjct: 22350 gggggtctcgcgagctgca 22368
>dbj|AK099801.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098A15, full insert sequence Length = 3958 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Plus Query: 40 aaaatggcgaaatcgccggccgatcggagcccaatctgagcc 81 ||||||||| |||||||||| ||||||||||||||||||||| Sbjct: 98 aaaatggcggaatcgccggctgatcggagcccaatctgagcc 139 Score = 61.9 bits (31), Expect = 2e-06 Identities = 67/79 (84%) Strand = Plus / Plus Query: 145 gaaatggccgccactgtcccgatcgggctcgcggcgctcgattcggtggtgttctggccc 204 |||||||| ||||| | |||||||||||| ||| || ||||||||||||| ||||||| Sbjct: 203 gaaatggcggccaccgccccgatcgggcttgcgaagcgcgattcggtggtgctctggcct 262 Query: 205 gggggacccgagagctgca 223 ||||| | || |||||||| Sbjct: 263 gggggtctcgcgagctgca 281
>dbj|AK102882.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033112I24, full insert sequence Length = 2841 Score = 61.9 bits (31), Expect = 2e-06 Identities = 67/79 (84%) Strand = Plus / Plus Query: 145 gaaatggccgccactgtcccgatcgggctcgcggcgctcgattcggtggtgttctggccc 204 |||||||| ||||| | |||||||||||| ||| || ||||||||||||| ||||||| Sbjct: 199 gaaatggcggccaccgccccgatcgggcttgcgaagcgcgattcggtggtgctctggcct 258 Query: 205 gggggacccgagagctgca 223 ||||| | || |||||||| Sbjct: 259 gggggtctcgcgagctgca 277 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 44 tggcgaaatcgccggccgatcggagcccaatctgagcc 81 ||||| |||||||||| ||||||||||||||||||||| Sbjct: 98 tggcggaatcgccggctgatcggagcccaatctgagcc 135
>ref|XM_848007.1| PREDICTED: Canis familiaris similar to Rho GTPase activating protein 15 (LOC490917), mRNA Length = 2272 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 379 ggaggacgagccggaggacgagcttgagg 407 |||||||||||||||||||||||| |||| Sbjct: 448 ggaggacgagccggaggacgagctggagg 476
>ref|XM_754401.1| Ustilago maydis 521 hypothetical protein (UM03347.1) partial mRNA Length = 7092 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 376 ggaggaggacgagccggagga 396 ||||||||||||||||||||| Sbjct: 6585 ggaggaggacgagccggagga 6605
>gb|BC060492.1| Xenopus laevis cDNA clone IMAGE:4174459, partial cds Length = 2711 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 377 gaggaggacgagccggaggacgagcttga 405 ||||| |||||| |||||||||||||||| Sbjct: 2539 gaggacgacgagtcggaggacgagcttga 2567
>ref|XM_949170.1| Theileria annulata strain Ankara hypothetical protein (TA20520) partial mRNA Length = 648 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 tttggttccccaaaatggcga 49 ||||||||||||||||||||| Sbjct: 66 tttggttccccaaaatggcga 86
>ref|XM_391974.2| PREDICTED: Apis mellifera similar to GA21110-PA (LOC408427), mRNA Length = 7845 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 377 gaggaggacgagccggaggacgagc 401 ||||| ||||||||||||||||||| Sbjct: 4084 gaggacgacgagccggaggacgagc 4108
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 163 ccgatcgggctcgcggcgctc 183 ||||||||||||||||||||| Sbjct: 1838408 ccgatcgggctcgcggcgctc 1838388
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 163 ccgatcgggctcgcggcgct 182 |||||||||||||||||||| Sbjct: 2947972 ccgatcgggctcgcggcgct 2947991
>gb|AC104881.9| Mus musculus chromosome 18, clone RP23-244A24, complete sequence Length = 184796 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 215 agagctgcaggttttctgat 234 |||||||||||||||||||| Sbjct: 119850 agagctgcaggttttctgat 119869
>ref|XM_543327.2| PREDICTED: Canis familiaris similar to kinesin family member 1B (LOC486202), mRNA Length = 5076 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 376 ggaggaggacgagccggaggacga 399 ||||||||| |||||||||||||| Sbjct: 3207 ggaggaggaagagccggaggacga 3230
>ref|XM_801206.1| Trypanosoma cruzi strain CL Brener trans-sialidase (Tc00.1047053506217.40) partial mRNA Length = 3144 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 403 tgaggctttgctccgtgccggtgg 426 ||||||||||||||| |||||||| Sbjct: 2761 tgaggctttgctccgcgccggtgg 2738
>ref|XM_802226.1| Trypanosoma cruzi strain CL Brener trans-sialidase (Tc00.1047053506341.50) partial mRNA Length = 3126 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 403 tgaggctttgctccgtgccggtgg 426 ||||||||||||||| |||||||| Sbjct: 2740 tgaggctttgctccgcgccggtgg 2717
>ref|XM_804975.1| Trypanosoma cruzi strain CL Brener trans-sialidase (Tc00.1047053509581.10) partial mRNA Length = 3444 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 403 tgaggctttgctccgtgccggtgg 426 |||||||| ||||||||||||||| Sbjct: 3052 tgaggcttcgctccgtgccggtgg 3029
>ref|XM_807627.1| Trypanosoma cruzi strain CL Brener trans-sialidase (Tc00.1047053505365.60) partial mRNA Length = 3126 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 403 tgaggctttgctccgtgccggtgg 426 ||||||||||||||| |||||||| Sbjct: 2734 tgaggctttgctccgcgccggtgg 2711
>ref|XM_807863.1| Trypanosoma cruzi strain CL Brener trans-sialidase (Tc00.1047053510847.10) partial mRNA Length = 3018 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 403 tgaggctttgctccgtgccggtgg 426 ||||||||||||||| |||||||| Sbjct: 2632 tgaggctttgctccgcgccggtgg 2609
>ref|XM_808523.1| Trypanosoma cruzi strain CL Brener trans-sialidase (Tc00.1047053506975.90) partial mRNA Length = 3117 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 403 tgaggctttgctccgtgccggtgg 426 ||||||||||||||| |||||||| Sbjct: 2728 tgaggctttgctccgcgccggtgg 2705
>ref|XM_811368.1| Trypanosoma cruzi strain CL Brener complement regulatory protein (Tc00.1047053509217.160) partial mRNA Length = 3165 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 403 tgaggctttgctccgtgccggtgg 426 ||||||||||||||| |||||||| Sbjct: 2773 tgaggctttgctccgcgccggtgg 2750
>ref|XM_812240.1| Trypanosoma cruzi strain CL Brener trans-sialidase (Tc00.1047053503861.40) partial mRNA Length = 3114 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 403 tgaggctttgctccgtgccggtgg 426 ||||||||| |||||||||||||| Sbjct: 2725 tgaggctttcctccgtgccggtgg 2702
>ref|XM_813755.1| Trypanosoma cruzi strain CL Brener trans-sialidase (Tc00.1047053510643.40) partial mRNA Length = 3162 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 403 tgaggctttgctccgtgccggtgg 426 ||||||||||||||| |||||||| Sbjct: 2770 tgaggctttgctccgcgccggtgg 2747
>ref|XM_798237.1| Trypanosoma cruzi strain CL Brener trans-sialidase (Tc00.1047053509841.10) partial mRNA Length = 696 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 403 tgaggctttgctccgtgccggtgg 426 ||||||||||||||| |||||||| Sbjct: 310 tgaggctttgctccgcgccggtgg 287
>ref|XM_799130.1| Trypanosoma cruzi strain CL Brener trans-sialidase (Tc00.1047053510981.20) partial mRNA Length = 2242 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 403 tgaggctttgctccgtgccggtgg 426 ||||||||||||||| |||||||| Sbjct: 1856 tgaggctttgctccgcgccggtgg 1833
>ref|XM_801651.1| Trypanosoma cruzi strain CL Brener trans-sialidase (Tc00.1047053511105.60) partial mRNA Length = 2370 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 403 tgaggctttgctccgtgccggtgg 426 ||||||||||||||| |||||||| Sbjct: 1984 tgaggctttgctccgcgccggtgg 1961
>emb|BX883047.1| Rattus norvegicus chromosome 20, major histocompatibility complex, assembled from 40 BACs, strain Brown Norway (BN/ssNHsd), RT1n haplotype; segment 6/11 Length = 349571 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 aagccccgggtttggttccc 38 |||||||||||||||||||| Sbjct: 226776 aagccccgggtttggttccc 226757
>emb|BX572605.1| Rhodopseudomonas palustris CGA009 complete genome; segment 13/16 Length = 349746 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 162 cccgatcgggctcgcggcgc 181 |||||||||||||||||||| Sbjct: 299705 cccgatcgggctcgcggcgc 299686
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 163 ccgatcgggctcgcggcgct 182 |||||||||||||||||||| Sbjct: 1126501 ccgatcgggctcgcggcgct 1126520
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 198 ctggcccgggggacccgagagctg 221 ||||||||||||||||| |||||| Sbjct: 4879450 ctggcccgggggacccgggagctg 4879473
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 163 ccgatcgggctcgcggcgct 182 |||||||||||||||||||| Sbjct: 721151 ccgatcgggctcgcggcgct 721170
>gb|AC158772.5| Mus musculus chromosome 18, clone RP23-291M14, complete sequence Length = 198851 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 215 agagctgcaggttttctgat 234 |||||||||||||||||||| Sbjct: 3200 agagctgcaggttttctgat 3219
>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome Length = 4303871 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 151 gccgccactgtcccgatcgg 170 |||||||||||||||||||| Sbjct: 3679437 gccgccactgtcccgatcgg 3679456 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,448,136 Number of Sequences: 3902068 Number of extensions: 2448136 Number of successful extensions: 46230 Number of sequences better than 10.0: 32 Number of HSP's better than 10.0 without gapping: 32 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 45685 Number of HSP's gapped (non-prelim): 545 length of query: 431 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 409 effective length of database: 17,147,199,772 effective search space: 7013204706748 effective search space used: 7013204706748 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)