>gb|AC122213.4| Mus musculus BAC clone RP23-104C8 from chromosome 18, complete sequence
          Length = 188125

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 65    aaattccatgcaaatgttcttt 86
             ||||||||||||||||||||||
Sbjct: 60047 aaattccatgcaaatgttcttt 60026

>ref|XM_714481.1| Candida albicans SC5314 hypothetical protein (CaO19_9547), mRNA
          Length = 2130

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 128 aatgaagatacaactgaacat 148
           |||||||||||||||||||||
Sbjct: 292 aatgaagatacaactgaacat 312

>ref|XM_714352.1| Candida albicans SC5314 hypothetical protein (CaO19_1995), mRNA
          Length = 2130

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 128 aatgaagatacaactgaacat 148
           |||||||||||||||||||||
Sbjct: 292 aatgaagatacaactgaacat 312

>emb|AL161508.2|ATCHRIV20 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 20
          Length = 196517

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 304    tgatgggttcaatccgtttgg 324
              |||||||||||||||||||||
Sbjct: 181191 tgatgggttcaatccgtttgg 181211

>emb|AL138663.1|ATF7P3 Arabidopsis thaliana DNA chromosome 3, BAC clone F7P3
          Length = 108227

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 304   tgatgggttcaatccgtttgg 324
             |||||||||||||||||||||
Sbjct: 67301 tgatgggttcaatccgtttgg 67281

>emb|BX957341.7| Zebrafish DNA sequence from clone CH211-11N16 in linkage group 15,
             complete sequence
          Length = 177343

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 360   tgttttcccctcaccacccca 380
             |||||||||||||||||||||
Sbjct: 81956 tgttttcccctcaccacccca 81936

>gb|AC153940.3| Mus musculus 10 BAC RP24-422N15 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 142278

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 299   tgacttgatgggttcaatccg 319
             |||||||||||||||||||||
Sbjct: 17766 tgacttgatgggttcaatccg 17746

>gb|AC155710.5| Mus musculus 10 BAC RP24-141K13 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 183533

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 299    tgacttgatgggttcaatccg 319
              |||||||||||||||||||||
Sbjct: 118637 tgacttgatgggttcaatccg 118617

>gb|AC012327.6|AC012327 Arabidopsis thaliana chromosome 3 BAC T14A11 genomic sequence, complete
             sequence
          Length = 86585

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 304   tgatgggttcaatccgtttgg 324
             |||||||||||||||||||||
Sbjct: 28772 tgatgggttcaatccgtttgg 28752

>gb|AE016754.1| Mus musculus chromosome 10 high-growth region, section 2 of 2 of the
             complete sequence
          Length = 303688

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 299   tgacttgatgggttcaatccg 319
             |||||||||||||||||||||
Sbjct: 53438 tgacttgatgggttcaatccg 53458

>gb|AC007781.2| Genomic sequence for Arabidopsis thaliana BAC F12G6 from chromosome I,
             complete sequence
          Length = 51787

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 304   tgatgggttcaatccgtttgg 324
             |||||||||||||||||||||
Sbjct: 21614 tgatgggttcaatccgtttgg 21634

>emb|BX000997.10| Zebrafish DNA sequence from clone CH211-151C7 in linkage group 3,
             complete sequence
          Length = 160921

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 360   tgttttcccctcaccacccca 380
             |||||||||||||||||||||
Sbjct: 61511 tgttttcccctcaccacccca 61491

>gb|AC018928.1|AC018928 Genomic Sequence For Arabidopsis thaliana Clone F23C08, Chromosome V,
             complete sequence
          Length = 109974

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 304   tgatgggttcaatccgtttgg 324
             |||||||||||||||||||||
Sbjct: 44150 tgatgggttcaatccgtttgg 44170

>gb|AC006192.2|AC006192 Arabidopsis thaliana BAC T24G3 from chromosome V near 70 cM, complete
             sequence
          Length = 97905

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 304   tgatgggttcaatccgtttgg 324
             |||||||||||||||||||||
Sbjct: 67897 tgatgggttcaatccgtttgg 67917

>gb|AC006266.1|AC006266 Arabidopsis thaliana BAC F1K3 from chromosome IV near 21 cM, complete
             sequence
          Length = 105680

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 304   tgatgggttcaatccgtttgg 324
             |||||||||||||||||||||
Sbjct: 52610 tgatgggttcaatccgtttgg 52630

>ref|NM_118399.2| Arabidopsis thaliana ATP binding / protein kinase/ protein
           serine/threonine kinase/ protein-tyrosine kinase
           AT4G22730 mRNA, complete cds
          Length = 2110

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 77  aatgttctttggtatcttcc 96
           ||||||||||||||||||||
Sbjct: 480 aatgttctttggtatcttcc 461

>gb|AC169501.2| Mus musculus BAC clone RP24-445O18 from chromosome 17, complete
             sequence
          Length = 202078

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 180   acaatgatgatcatgggaga 199
             ||||||||||||||||||||
Sbjct: 24177 acaatgatgatcatgggaga 24196

>gb|AC149683.2| Bos taurus  BAC CH240-493H15 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 176832

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 358    tttgttttcccctcaccacc 377
              ||||||||||||||||||||
Sbjct: 132651 tttgttttcccctcaccacc 132670

>gb|AC133906.9| Mus musculus chromosome 14, clone RP24-230P12, complete sequence
          Length = 176220

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    ttggtatcttccaatccctc 104
             ||||||||||||||||||||
Sbjct: 78852 ttggtatcttccaatccctc 78833

>gb|BT010747.1| Arabidopsis thaliana At4g22730 gene, complete cds
          Length = 2067

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 77  aatgttctttggtatcttcc 96
           ||||||||||||||||||||
Sbjct: 480 aatgttctttggtatcttcc 461

>gb|AC121979.3| Mus musculus BAC clone RP24-289L14 from chromosome 9, complete sequence
          Length = 155274

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 389   aatgcaaagcatgcacatat 408
             ||||||||||||||||||||
Sbjct: 79269 aatgcaaagcatgcacatat 79250

>gb|AC131712.3| Mus musculus BAC clone RP23-193A5 from 17, complete sequence
          Length = 218758

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   acaatgatgatcatgggaga 199
             ||||||||||||||||||||
Sbjct: 59574 acaatgatgatcatgggaga 59555

>emb|AL669869.10| Mouse DNA sequence from clone RP23-198E14 on chromosome 11 Contains the
             3' end of the Mgl2 gene for macrophage galactose
             N-acetyl-galactosamine specific lectin 2, the Mgl1 gene
             for macrophage galactose N-acetyl-galactosamine specific
             lectin 1, the gene for a novel RNA polymerase Rpb1
             C-terminal repeat domain containing protein, three novel
             genes, the Bcl6b gene for B-cell CLL/lymphoma 6 member B,
             the Alox12 gene for arachidonate 12-lipoxygenase and four
             CpG islands, complete sequence
          Length = 174390

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 225   ccctagcatggcagaatttt 244
             ||||||||||||||||||||
Sbjct: 19875 ccctagcatggcagaatttt 19894

>emb|AL161557.2|ATCHRIV57 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 57
          Length = 199577

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 77     aatgttctttggtatcttcc 96
              ||||||||||||||||||||
Sbjct: 178658 aatgttctttggtatcttcc 178639

>emb|AL021635.1|ATT12H17 Arabidopsis thaliana DNA chromosome 4, BAC clone T12H17 (ESSAII
             project)
          Length = 89350

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 77    aatgttctttggtatcttcc 96
             ||||||||||||||||||||
Sbjct: 34989 aatgttctttggtatcttcc 34970

>emb|CR933542.3| Mouse DNA sequence from clone DN-476D14 on chromosome 11, complete
             sequence
          Length = 47485

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 225   ccctagcatggcagaatttt 244
             ||||||||||||||||||||
Sbjct: 45341 ccctagcatggcagaatttt 45360

>emb|BX510995.11| Zebrafish DNA sequence from clone CH211-57P8 in linkage group 14,
              complete sequence
          Length = 169766

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 317    ccgtttggttttgtctcaag 336
              ||||||||||||||||||||
Sbjct: 121518 ccgtttggttttgtctcaag 121499

>gb|AC098859.2| Homo sapiens BAC clone RP11-173E2 from 4, complete sequence
          Length = 183680

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     atgcaaatgttctttggtat 91
              ||||||||||||||||||||
Sbjct: 155071 atgcaaatgttctttggtat 155052

>gb|AC079819.40| Mus musculus strain C57BL/6J chromosome 10 clone rp23-438b23, complete
              sequence
          Length = 181149

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 345    ctgttggcatgtgtttgttt 364
              ||||||||||||||||||||
Sbjct: 102049 ctgttggcatgtgtttgttt 102030

>dbj|AK176866.1| Arabidopsis thaliana mRNA for leucine rich repeat receptor
           kinase-like protein, complete cds, clone: RAFL25-42-K06
          Length = 2358

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 77  aatgttctttggtatcttcc 96
           ||||||||||||||||||||
Sbjct: 733 aatgttctttggtatcttcc 714

>emb|CT010498.7| Mouse DNA sequence from clone RP23-105I10 on chromosome 13, complete
             sequence
          Length = 207035

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 91    tcttccaatccctccaagaattca 114
             |||||||| |||||||||||||||
Sbjct: 92186 tcttccaaaccctccaagaattca 92209


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,691,574
Number of Sequences: 3902068
Number of extensions: 3691574
Number of successful extensions: 69519
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69472
Number of HSP's gapped (non-prelim): 47
length of query: 423
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 401
effective length of database: 17,147,199,772
effective search space: 6876027108572
effective search space used: 6876027108572
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)