ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl50a05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
2emb|AL731599.2|OSJN00244 Oryza sativa genomic DNA, chromosome 4,... 68 3e-08
3gb|AC094021.2| Homo sapiens chromosome 3 clone RP11-801L18, comp... 44 0.39
4gb|AC092045.2| Homo sapiens chromosome 3 clone RP11-168J18, comp... 44 0.39
5ref|XM_512922.1| PREDICTED: Pan troglodytes similar to NALP5 (LO... 42 1.5
6emb|CR956406.10| Pig DNA sequence from clone CH242-143L3 on chro... 42 1.5
7gb|AC129078.6| Mus musculus BAC clone RP24-71C5 from chromosome ... 42 1.5
8ref|NM_176811.2| Homo sapiens NACHT, leucine rich repeat and PYD... 42 1.5
9tpg|BK001109.1| TPA: TPA_inf: Homo sapiens NOD16 (NOD16) mRNA, c... 42 1.5
10gb|AC103974.6| Homo sapiens chromosome 11, clone RP11-1081L13, c... 42 1.5
11gb|AC160123.2| Mus musculus BAC clone RP23-354J5 from chromosome... 42 1.5
12gb|AY154463.1| Homo sapiens NALP8 (NALP8) mRNA, complete cds 42 1.5
13gb|AC011470.5|AC011470 Homo sapiens chromosome 19 clone CTC-490M... 42 1.5
14gb|AC135290.5| Mus musculus BAC clone RP23-58D13 from 18, comple... 42 1.5
15ref|XM_513067.1| PREDICTED: Pan troglodytes similar to putative ... 40 6.0
16gb|AC149604.1| Mus musculus BAC clone RP23-472I3 from chromosome... 40 6.0
17gb|AC163769.4| Pan troglodytes BAC clone CH251-59O12 from chromo... 40 6.0
18gb|AC091295.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 6.0
19ref|NM_015609.1| Homo sapiens chromosome 1 open reading frame 14... 40 6.0
20gb|AC093483.6| Mus musculus chromosome 9, clone RP23-79K5, compl... 40 6.0
21gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 6.0
22gb|AC132594.3| Mus musculus BAC clone RP24-222P6 from chromosome... 40 6.0
23gb|AC123944.4| Mus musculus BAC clone RP24-87F18 from chromosome... 40 6.0
24gb|AC125400.4| Mus musculus BAC clone RP24-380E10 from chromosom... 40 6.0
25gb|AC126680.4| Mus musculus BAC clone RP24-347B21 from chromosom... 40 6.0
26gb|AC107024.5| Homo sapiens 3 BAC RP11-447J13 (Roswell Park Canc... 40 6.0
27gb|AC121846.3| Mus musculus BAC clone RP24-83D6 from chromosome ... 40 6.0
28gb|AC121602.2| Mus musculus BAC clone RP23-309B19 from 10, compl... 40 6.0
29gb|AC101875.7| Mus musculus chromosome 12, clone RP23-367G12, co... 40 6.0
30gb|AC005589.1| Homo sapiens BAC clone RP11-161H12 from 7, comple... 40 6.0
31ref|XM_846908.1| PREDICTED: Canis familiaris similar to putative... 40 6.0
32ref|XM_859680.1| PREDICTED: Canis familiaris similar to putative... 40 6.0
33gb|AC107662.9| Mus musculus chromosome 9, clone RP23-99B22, comp... 40 6.0
34gb|BC039981.1| Mus musculus renal tumor antigen, mRNA (cDNA clon... 40 6.0
35gb|AC145773.1| Pan troglodytes BAC clone RP43-32M11 from 7, comp... 40 6.0
36emb|AL358794.19| Human DNA sequence from clone RP11-430L17 on ch... 40 6.0
37gb|AC024886.20| Homo sapiens 3 BAC RP11-25K24 (Roswell Park Canc... 40 6.0
38emb|Z74149.1|SCYDL101C S.cerevisiae chromosome IV reading frame ... 40 6.0
39emb|X95644.1|SCCHRIVLA S.cerevisiae DNA fragment of 38.5kb from ... 40 6.0
40emb|AL645693.8| Mouse DNA sequence from clone RP23-217N23 on chr... 40 6.0
41gb|BC023988.1| Homo sapiens chromosome 1 open reading frame 144,... 40 6.0
42gb|BC010631.1| Homo sapiens chromosome 1 open reading frame 144,... 40 6.0
43emb|CR859294.1| Pongo pygmaeus mRNA; cDNA DKFZp468H135 (from clo... 40 6.0
44emb|CR857727.1| Pongo pygmaeus mRNA; cDNA DKFZp469P2135 (from cl... 40 6.0
45emb|CR615655.1| full-length cDNA clone CS0DI033YE02 of Placenta ... 40 6.0
46dbj|AB097046.1| Homo sapiens mRNA for putative MAPK activating p... 40 6.0
47dbj|AB097045.1| Homo sapiens mRNA for putative MAPK activating p... 40 6.0
48dbj|AB097044.1| Homo sapiens mRNA for putative MAPK activating p... 40 6.0
49dbj|AB097043.1| Homo sapiens mRNA for putative MAPK activating p... 40 6.0
50dbj|AB097042.1| Homo sapiens mRNA for putative MAPK activating p... 40 6.0
51emb|CR626328.1| full-length cDNA clone CS0DL006YG15 of B cells (... 40 6.0
52emb|CR624498.1| full-length cDNA clone CS0DI026YO19 of Placenta ... 40 6.0
53emb|CR619544.1| full-length cDNA clone CS0DE004YJ20 of Placenta ... 40 6.0
54emb|CR619226.1| full-length cDNA clone CS0DC012YM23 of Neuroblas... 40 6.0
55emb|CR619138.1| full-length cDNA clone CS0DI006YM02 of Placenta ... 40 6.0
56emb|CR616707.1| full-length cDNA clone CS0DI005YP09 of Placenta ... 40 6.0
57emb|CR614958.1| full-length cDNA clone CS0DI024YM18 of Placenta ... 40 6.0
58emb|CR602743.1| full-length cDNA clone CS0DC024YB21 of Neuroblas... 40 6.0
59emb|CR598986.1| full-length cDNA clone CS0DI024YN19 of Placenta ... 40 6.0
60emb|CR593854.1| full-length cDNA clone CS0DI025YD12 of Placenta ... 40 6.0
61gb|AC156643.2| Mus musculus BAC clone RP23-192O3 from chromosome... 40 6.0
62gb|AC044790.4|AC044790 Homo sapiens chromosome 11 clone RP11-141... 40 6.0
63gb|AC000134.14| Homo sapiens Chromosome 11q13 BAC Clone 137c7, c... 40 6.0
64gb|AC158800.6| Mus musculus 10 BAC RP23-435N6 (Roswell Park Canc... 40 6.0
65dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
66gb|AC096667.1| Homo sapiens BAC clone RP11-363K21 from 2, comple... 40 6.0
67gb|AC025423.32| Homo sapiens 12 BAC RP11-611O2 (Roswell Park Can... 40 6.0
68gb|AC134237.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
69gb|AC006529.1|AC006529 Homo sapiens clone SCb-20L24 from 7q31, c... 40 6.0
70emb|BX530412.8| Zebrafish DNA sequence from clone DKEY-42F6 in l... 40 6.0
71emb|AJ295987.1|HSA295987 Homo sapiens mRNA for hypothetical prot... 40 6.0
72gb|AC123827.4| Mus musculus BAC clone RP24-100N12 from 5, comple... 40 6.0
73dbj|AP001092.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 6.0
74gb|BC065538.1| Homo sapiens chromosome 1 open reading frame 144,... 40 6.0
75dbj|AB231868.1| Nematostella vectensis genes for zinc finger pro... 40 6.0
76dbj|AP001032.5| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 6.0
77gb|AC165340.3| Mus musculus BAC clone RP24-63G4 from chromosome ... 40 6.0
78emb|AL050028.1|HSM800362 Homo sapiens mRNA; cDNA DKFZp566C0424 (... 40 6.0
79gb|L25548.1|YSCDUN1A Saccharomyces cerevisiae protein kinase (Du... 40 6.0

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                                  
Query: 18       tttggggctttgactaaaagtcttgagctaaaaa 51
                ||||||||||||||||||||||||||||||||||
Sbjct: 19140088 tttggggctttgactaaaagtcttgagctaaaaa 19140121



to top

>emb|AL731599.2|OSJN00244 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0053B21,
             complete sequence
          Length = 151936

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                               
Query: 18    tttggggctttgactaaaagtcttgagctaaaaa 51
             ||||||||||||||||||||||||||||||||||
Sbjct: 73608 tttggggctttgactaaaagtcttgagctaaaaa 73641



to top

>gb|AC094021.2| Homo sapiens chromosome 3 clone RP11-801L18, complete sequence
          Length = 214160

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 309    aaaggtggagatgagtgtggag 330
              ||||||||||||||||||||||
Sbjct: 102622 aaaggtggagatgagtgtggag 102601



to top

>gb|AC092045.2| Homo sapiens chromosome 3 clone RP11-168J18, complete sequence
          Length = 171343

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 309   aaaggtggagatgagtgtggag 330
             ||||||||||||||||||||||
Sbjct: 74388 aaaggtggagatgagtgtggag 74409



to top

>ref|XM_512922.1| PREDICTED: Pan troglodytes similar to NALP5 (LOC456316), mRNA
          Length = 6615

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 271  cattcttgctcaagtccagctgtct 295
            ||||||||||||||||||| |||||
Sbjct: 3103 cattcttgctcaagtccagatgtct 3079



to top

>emb|CR956406.10| Pig DNA sequence from clone CH242-143L3 on chromosome 17, complete
             sequence
          Length = 177073

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 67    agctcctccgtccctccctcc 87
             |||||||||||||||||||||
Sbjct: 65685 agctcctccgtccctccctcc 65705



to top

>gb|AC129078.6| Mus musculus BAC clone RP24-71C5 from chromosome 18, complete sequence
          Length = 215826

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 406    cgcaagtatgcggtcaaggcc 426
              |||||||||||||||||||||
Sbjct: 164168 cgcaagtatgcggtcaaggcc 164188



to top

>ref|NM_176811.2| Homo sapiens NACHT, leucine rich repeat and PYD containing 8 (NALP8),
            mRNA
          Length = 3934

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 271  cattcttgctcaagtccagctgtct 295
            ||||||||||||||||||| |||||
Sbjct: 3045 cattcttgctcaagtccagatgtct 3021



to top

>tpg|BK001109.1| TPA: TPA_inf: Homo sapiens NOD16 (NOD16) mRNA, complete cds
          Length = 3934

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 271  cattcttgctcaagtccagctgtct 295
            ||||||||||||||||||| |||||
Sbjct: 3045 cattcttgctcaagtccagatgtct 3021



to top

>gb|AC103974.6| Homo sapiens chromosome 11, clone RP11-1081L13, complete sequence
          Length = 189230

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 256   ggtcctgggcttcttcattct 276
             |||||||||||||||||||||
Sbjct: 91580 ggtcctgggcttcttcattct 91560



to top

>gb|AC160123.2| Mus musculus BAC clone RP23-354J5 from chromosome 9, complete sequence
          Length = 199457

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 69     ctcctccgtccctccctcccc 89
              |||||||||||||||||||||
Sbjct: 175826 ctcctccgtccctccctcccc 175806



to top

>gb|AY154463.1| Homo sapiens NALP8 (NALP8) mRNA, complete cds
          Length = 3090

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 271  cattcttgctcaagtccagctgtct 295
            ||||||||||||||||||| |||||
Sbjct: 2917 cattcttgctcaagtccagatgtct 2893



to top

>gb|AC011470.5|AC011470 Homo sapiens chromosome 19 clone CTC-490M10, complete sequence
          Length = 157141

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 271   cattcttgctcaagtccagctgtct 295
             ||||||||||||||||||| |||||
Sbjct: 89432 cattcttgctcaagtccagatgtct 89456



to top

>gb|AC135290.5| Mus musculus BAC clone RP23-58D13 from 18, complete sequence
          Length = 233915

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 406    cgcaagtatgcggtcaaggcc 426
              |||||||||||||||||||||
Sbjct: 135253 cgcaagtatgcggtcaaggcc 135273



to top

>ref|XM_513067.1| PREDICTED: Pan troglodytes similar to putative MAPK activating
           protein (LOC456475), mRNA
          Length = 850

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 814 tgctcaagtccagctgtctg 795



to top

>gb|AC149604.1| Mus musculus BAC clone RP23-472I3 from chromosome 15, complete sequence
          Length = 177501

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 80     ctccctccccgaaataaaat 99
              ||||||||||||||||||||
Sbjct: 137380 ctccctccccgaaataaaat 137361



to top

>gb|AC163769.4| Pan troglodytes BAC clone CH251-59O12 from chromosome unknown, complete
             sequence
          Length = 185010

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 77    tccctccctccccgaaataaaatc 100
             ||||||||||||| ||||||||||
Sbjct: 89520 tccctccctccccaaaataaaatc 89543



to top

>gb|AC091295.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-360N5, complete
             sequence
          Length = 111108

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    ctcctccgtccctccctccc 88
             ||||||||||||||||||||
Sbjct: 47222 ctcctccgtccctccctccc 47203



to top

>ref|NM_015609.1| Homo sapiens chromosome 1 open reading frame 144 (C1orf144), mRNA
          Length = 1701

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 539 tgctcaagtccagctgtctg 520



to top

>gb|AC093483.6| Mus musculus chromosome 9, clone RP23-79K5, complete sequence
          Length = 262048

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 260    ctgggcttcttcattcttgc 279
              ||||||||||||||||||||
Sbjct: 108871 ctgggcttcttcattcttgc 108852



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 350    tgaaagcacgaaatactgca 369
              ||||||||||||||||||||
Sbjct: 838372 tgaaagcacgaaatactgca 838391



to top

>gb|AC132594.3| Mus musculus BAC clone RP24-222P6 from chromosome 7, complete sequence
          Length = 162814

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 157    cctgcgcctcctccagccgatccg 180
              |||||||||||||||||| |||||
Sbjct: 137062 cctgcgcctcctccagcccatccg 137039



to top

>gb|AC123944.4| Mus musculus BAC clone RP24-87F18 from chromosome 10, complete sequence
          Length = 194243

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     tcctccgtccctccctcccc 89
              ||||||||||||||||||||
Sbjct: 150365 tcctccgtccctccctcccc 150346



to top

>gb|AC125400.4| Mus musculus BAC clone RP24-380E10 from chromosome 10, complete
             sequence
          Length = 154681

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    ctcctccgtccctccctccc 88
             ||||||||||||||||||||
Sbjct: 84404 ctcctccgtccctccctccc 84385



to top

>gb|AC126680.4| Mus musculus BAC clone RP24-347B21 from chromosome 7, complete sequence
          Length = 161973

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 157   cctgcgcctcctccagccgatccg 180
             |||||||||||||||||| |||||
Sbjct: 73056 cctgcgcctcctccagcccatccg 73033



to top

>gb|AC107024.5| Homo sapiens 3 BAC RP11-447J13 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 180216

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 32    taaaagtcttgagctaaaaa 51
             ||||||||||||||||||||
Sbjct: 91066 taaaagtcttgagctaaaaa 91085



to top

>gb|AC121846.3| Mus musculus BAC clone RP24-83D6 from chromosome 15, complete sequence
          Length = 182309

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 80     ctccctccccgaaataaaat 99
              ||||||||||||||||||||
Sbjct: 129046 ctccctccccgaaataaaat 129065



to top

>gb|AC121602.2| Mus musculus BAC clone RP23-309B19 from 10, complete sequence
          Length = 182661

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 306    ttcaaaggtggagatgagtgtgga 329
              ||||||| ||||||||||||||||
Sbjct: 172432 ttcaaagctggagatgagtgtgga 172409



to top

>gb|AC101875.7| Mus musculus chromosome 12, clone RP23-367G12, complete sequence
          Length = 184813

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 277   tgctcaagtccagctgtctg 296
             ||||||||||||||||||||
Sbjct: 26115 tgctcaagtccagctgtctg 26134



to top

>gb|AC005589.1| Homo sapiens BAC clone RP11-161H12 from 7, complete sequence
          Length = 132077

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    tcctccgtccctccctcccc 89
             ||||||||||||||||||||
Sbjct: 59500 tcctccgtccctccctcccc 59481



to top

>ref|XM_846908.1| PREDICTED: Canis familiaris similar to putative MAPK activating
           protein PM20,PM21 isoform 2, transcript variant 1
           (LOC608518), mRNA
          Length = 1836

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 597 tgctcaagtccagctgtctg 578



to top

>ref|XM_859680.1| PREDICTED: Canis familiaris similar to putative MAPK activating
           protein PM20,PM21 isoform 2, transcript variant 2
           (LOC608518), mRNA
          Length = 1816

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 577 tgctcaagtccagctgtctg 558



to top

>gb|AC107662.9| Mus musculus chromosome 9, clone RP23-99B22, complete sequence
          Length = 233476

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 260    ctgggcttcttcattcttgc 279
              ||||||||||||||||||||
Sbjct: 195364 ctgggcttcttcattcttgc 195345



to top

>gb|BC039981.1| Mus musculus renal tumor antigen, mRNA (cDNA clone IMAGE:4952067),
            complete cds
          Length = 5043

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 277  tgctcaagtccagctgtctg 296
            ||||||||||||||||||||
Sbjct: 2191 tgctcaagtccagctgtctg 2172



to top

>gb|AC145773.1| Pan troglodytes BAC clone RP43-32M11 from 7, complete sequence
          Length = 190630

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     tcctccgtccctccctcccc 89
              ||||||||||||||||||||
Sbjct: 117539 tcctccgtccctccctcccc 117520



to top

>emb|AL358794.19| Human DNA sequence from clone RP11-430L17 on chromosome 1 Contains the
             5' end of a novel gene (KIAA1332), a ribosomal protein L22
             (RPL22) pseudogene, a putative MAPK activating protein
             (DKFZp566C0424), a novel gene (LOC374955) and two CpG
             islands, complete sequence
          Length = 124949

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   tgctcaagtccagctgtctg 296
             ||||||||||||||||||||
Sbjct: 80548 tgctcaagtccagctgtctg 80529



to top

>gb|AC024886.20| Homo sapiens 3 BAC RP11-25K24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 173270

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 233    cagtgaactcttgttcatttcttg 256
              ||||||| ||||||||||||||||
Sbjct: 112722 cagtgaaatcttgttcatttcttg 112699



to top

>emb|Z74149.1|SCYDL101C S.cerevisiae chromosome IV reading frame ORF YDL101c
          Length = 1946

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 330 gtacaatatggatgaagctttgaa 353
           ||||||||| ||||||||||||||
Sbjct: 280 gtacaatatagatgaagctttgaa 257



to top

>emb|X95644.1|SCCHRIVLA S.cerevisiae DNA fragment of 38.5kb from left arm of chromosome IV
          Length = 38516

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 330   gtacaatatggatgaagctttgaa 353
             ||||||||| ||||||||||||||
Sbjct: 18670 gtacaatatagatgaagctttgaa 18647



to top

>emb|AL645693.8| Mouse DNA sequence from clone RP23-217N23 on chromosome 13 Contains the
             3' end of a novel serine (or cysteine) proteinase
             inhibitor, clade B (Serpinb) or serine protease inhibitor
             (Spi) family member, complete sequence
          Length = 13777

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    tcctccgtccctccctcccc 89
             ||||||||||||||||||||
Sbjct: 11183 tcctccgtccctccctcccc 11202



to top

>gb|BC023988.1| Homo sapiens chromosome 1 open reading frame 144, mRNA (cDNA clone
           MGC:24215 IMAGE:3825796), complete cds
          Length = 1701

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 539 tgctcaagtccagctgtctg 520



to top

>gb|BC010631.1| Homo sapiens chromosome 1 open reading frame 144, mRNA (cDNA clone
           IMAGE:3867552), with apparent retained intron
          Length = 3416

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 494 tgctcaagtccagctgtctg 475



to top

>emb|CR859294.1| Pongo pygmaeus mRNA; cDNA DKFZp468H135 (from clone DKFZp468H135)
          Length = 3458

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 533 tgctcaagtccagctgtctg 514



to top

>emb|CR857727.1| Pongo pygmaeus mRNA; cDNA DKFZp469P2135 (from clone DKFZp469P2135)
          Length = 1723

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 584 tgctcaagtccagctgtctg 565



to top

>emb|CR615655.1| full-length cDNA clone CS0DI033YE02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1600

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 501 tgctcaagtccagctgtctg 482



to top

>dbj|AB097046.1| Homo sapiens mRNA for putative MAPK activating protein, complete
           cds, clone: PM22
          Length = 1731

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 572 tgctcaagtccagctgtctg 553



to top

>dbj|AB097045.1| Homo sapiens mRNA for putative MAPK activating protein, complete
           cds, clone: PM21
          Length = 904

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 513 tgctcaagtccagctgtctg 494



to top

>dbj|AB097044.1| Homo sapiens mRNA for putative MAPK activating protein, complete
           cds, clone: PM20
          Length = 904

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 513 tgctcaagtccagctgtctg 494



to top

>dbj|AB097043.1| Homo sapiens mRNA for putative MAPK activating protein, complete
           cds, clone: PM19
          Length = 1585

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 522 tgctcaagtccagctgtctg 503



to top

>dbj|AB097042.1| Homo sapiens mRNA for putative MAPK activating protein, complete
           cds, clone: PM18
          Length = 1585

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 522 tgctcaagtccagctgtctg 503



to top

>emb|CR626328.1| full-length cDNA clone CS0DL006YG15 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1663

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 556 tgctcaagtccagctgtctg 537



to top

>emb|CR624498.1| full-length cDNA clone CS0DI026YO19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1630

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 502 tgctcaagtccagctgtctg 483



to top

>emb|CR619544.1| full-length cDNA clone CS0DE004YJ20 of Placenta of Homo sapiens
           (human)
          Length = 1622

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 505 tgctcaagtccagctgtctg 486



to top

>emb|CR619226.1| full-length cDNA clone CS0DC012YM23 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1594

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 517 tgctcaagtccagctgtctg 498



to top

>emb|CR619138.1| full-length cDNA clone CS0DI006YM02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1575

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 504 tgctcaagtccagctgtctg 485



to top

>emb|CR616707.1| full-length cDNA clone CS0DI005YP09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1605

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 504 tgctcaagtccagctgtctg 485



to top

>emb|CR614958.1| full-length cDNA clone CS0DI024YM18 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 906

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 557 tgctcaagtccagctgtctg 538



to top

>emb|CR602743.1| full-length cDNA clone CS0DC024YB21 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1663

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 567 tgctcaagtccagctgtctg 548



to top

>emb|CR598986.1| full-length cDNA clone CS0DI024YN19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1625

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 520 tgctcaagtccagctgtctg 501



to top

>emb|CR593854.1| full-length cDNA clone CS0DI025YD12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1616

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 517 tgctcaagtccagctgtctg 498



to top

>gb|AC156643.2| Mus musculus BAC clone RP23-192O3 from chromosome 12, complete sequence
          Length = 197420

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    cttgttcatttcttggtcct 261
              ||||||||||||||||||||
Sbjct: 164271 cttgttcatttcttggtcct 164252



to top

>gb|AC044790.4|AC044790 Homo sapiens chromosome 11 clone RP11-141J21 containing NRXN2 (NRXN2)
            gene, partial cds; and RST and OAT4 genes, complete cds,
            complete sequence
          Length = 170114

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 77   tccctccctccccgaaataaaatc 100
            ||||||||||||| ||||||||||
Sbjct: 2847 tccctccctccccaaaataaaatc 2870



to top

>gb|AC000134.14| Homo sapiens Chromosome 11q13 BAC Clone 137c7, complete sequence
          Length = 203300

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 77    tccctccctccccgaaataaaatc 100
             ||||||||||||| ||||||||||
Sbjct: 66585 tccctccctccccaaaataaaatc 66562



to top

>gb|AC158800.6| Mus musculus 10 BAC RP23-435N6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190805

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 306    ttcaaaggtggagatgagtgtgga 329
              ||||||| ||||||||||||||||
Sbjct: 105042 ttcaaagctggagatgagtgtgga 105019



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 350    tgaaagcacgaaatactgca 369
              ||||||||||||||||||||
Sbjct: 838370 tgaaagcacgaaatactgca 838389



to top

>gb|AC096667.1| Homo sapiens BAC clone RP11-363K21 from 2, complete sequence
          Length = 194508

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 190   atggagttctcataaccctc 209
             ||||||||||||||||||||
Sbjct: 16862 atggagttctcataaccctc 16843



to top

>gb|AC025423.32| Homo sapiens 12 BAC RP11-611O2 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 150579

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 277    tgctcaagtccagctgtctg 296
              ||||||||||||||||||||
Sbjct: 144570 tgctcaagtccagctgtctg 144551



to top

>gb|AC134237.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0090O10,
              complete sequence
          Length = 162132

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 350    tgaaagcacgaaatactgca 369
              ||||||||||||||||||||
Sbjct: 133917 tgaaagcacgaaatactgca 133936



to top

>gb|AC006529.1|AC006529 Homo sapiens clone SCb-20L24 from 7q31, complete sequence
          Length = 178069

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    ctcctccgtccctccctccc 88
             ||||||||||||||||||||
Sbjct: 79671 ctcctccgtccctccctccc 79652



to top

>emb|BX530412.8| Zebrafish DNA sequence from clone DKEY-42F6 in linkage group 4,
             complete sequence
          Length = 218203

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    ctcctccgtccctccctccc 88
             ||||||||||||||||||||
Sbjct: 44704 ctcctccgtccctccctccc 44685



to top

>emb|AJ295987.1|HSA295987 Homo sapiens mRNA for hypothetical protein (ORF1), clone
           Telethon(Italy_B41)_Strait01448_FL406
          Length = 3429

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 518 tgctcaagtccagctgtctg 499



to top

>gb|AC123827.4| Mus musculus BAC clone RP24-100N12 from 5, complete sequence
          Length = 185363

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     tttggggctttgactaaaag 37
              ||||||||||||||||||||
Sbjct: 121662 tttggggctttgactaaaag 121643



to top

>dbj|AP001092.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-727K3, complete
              sequence
          Length = 160739

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 77     tccctccctccccgaaataaaatc 100
              ||||||||||||| ||||||||||
Sbjct: 157893 tccctccctccccaaaataaaatc 157870



to top

>gb|BC065538.1| Homo sapiens chromosome 1 open reading frame 144, mRNA (cDNA clone
           MGC:70432 IMAGE:6053254), complete cds
          Length = 954

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 519 tgctcaagtccagctgtctg 500



to top

>dbj|AB231868.1| Nematostella vectensis genes for zinc finger proteins Nv-ZicB, Nv-ZicC,
              Nv-ZicD, Nv-ZicE, complete cds
          Length = 177971

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     aaaagtcttgagctaaaaag 52
              ||||||||||||||||||||
Sbjct: 171453 aaaagtcttgagctaaaaag 171472



to top

>dbj|AP001032.5| Homo sapiens genomic DNA, chromosome 18 clone:RP11-874N19, complete
              sequence
          Length = 165113

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 227    actgtgcagtgaactcttgt 246
              ||||||||||||||||||||
Sbjct: 116096 actgtgcagtgaactcttgt 116077



to top

>gb|AC165340.3| Mus musculus BAC clone RP24-63G4 from chromosome 7, complete sequence
          Length = 241077

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 69     ctcctccgtccctccctccc 88
              ||||||||||||||||||||
Sbjct: 134474 ctcctccgtccctccctccc 134493



to top

>emb|AL050028.1|HSM800362 Homo sapiens mRNA; cDNA DKFZp566C0424 (from clone DKFZp566C0424);
           partial cds
          Length = 1651

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 277 tgctcaagtccagctgtctg 296
           ||||||||||||||||||||
Sbjct: 518 tgctcaagtccagctgtctg 499



to top

>gb|L25548.1|YSCDUN1A Saccharomyces cerevisiae protein kinase (Dun1) gene, complete cds
          Length = 2000

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 330  gtacaatatggatgaagctttgaa 353
            ||||||||| ||||||||||||||
Sbjct: 1638 gtacaatatagatgaagctttgaa 1661


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,092,872
Number of Sequences: 3902068
Number of extensions: 4092872
Number of successful extensions: 232152
Number of sequences better than 10.0: 79
Number of HSP's better than 10.0 without gapping: 79
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 231785
Number of HSP's gapped (non-prelim): 367
length of query: 449
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 427
effective length of database: 17,147,199,772
effective search space: 7321854302644
effective search space used: 7321854302644
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top