>gb|AC092235.1|AC092235 Drosophila melanogaster, chromosome 2L, region 21E-21F, BAC clone
              BACR30G21, complete sequence
          Length = 168370

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 59     gcaggatccagatccaactc 78
              ||||||||||||||||||||
Sbjct: 113309 gcaggatccagatccaactc 113290

>gb|AE003588.3| Drosophila melanogaster chromosome 2L, section 3 of 83 of the complete
              sequence
          Length = 308447

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 59     gcaggatccagatccaactc 78
              ||||||||||||||||||||
Sbjct: 150432 gcaggatccagatccaactc 150413

>gb|AC004420.1|AC004420 Drosophila melanogaster DNA sequence (P1 DS02649 (D132)), complete
             sequence
          Length = 79987

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 59    gcaggatccagatccaactc 78
             ||||||||||||||||||||
Sbjct: 54042 gcaggatccagatccaactc 54061

>ref|XM_745620.1| Aspergillus fumigatus Af293 hypothetical protein (Afu6g08240)
          partial mRNA
          Length = 7749

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                 
Query: 3  aagtcgcatcggatcgaaccgtt 25
          |||||||||||| ||||||||||
Sbjct: 70 aagtcgcatcggttcgaaccgtt 92

>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 56      tgcgcaggatccagatcca 74
               |||||||||||||||||||
Sbjct: 4342710 tgcgcaggatccagatcca 4342728

>emb|BX294137.1| Pirellula sp. strain 1 complete genome; segment 5/24
          Length = 302550

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 65    tccagatccaactccactc 83
             |||||||||||||||||||
Sbjct: 25980 tccagatccaactccactc 25998

>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 56      tgcgcaggatccagatcca 74
               |||||||||||||||||||
Sbjct: 4349365 tgcgcaggatccagatcca 4349383

>gb|K01991.1|ECOMELB Escherichia coli alpha-galactosidase (melA) gene, partial cds; and
            melibiose carrier (melB) gene, complete cds
          Length = 1575

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 56   tgcgcaggatccagatcca 74
            |||||||||||||||||||
Sbjct: 1367 tgcgcaggatccagatcca 1385

>gb|AY623658.2| Aeromicrobium erythreum putative transcriptional repressor and putative
             dehydrogenase/reductase genes, complete cds; erythromycin
             biosynthesis gene cluster, complete sequence; putative
             oxidoreductase and LipN genes, complete cds; monoamine
             oxidase gene, partial cds; and unknown gene
          Length = 61845

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 35    tccgggtctcgaccagccc 53
             |||||||||||||||||||
Sbjct: 40395 tccgggtctcgaccagccc 40377

>gb|U14003.1|ECOUW93 Escherichia coli K-12 chromosomal region from 92.8 to 00.1 minutes
          Length = 338534

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 56    tgcgcaggatccagatcca 74
             |||||||||||||||||||
Sbjct: 35515 tgcgcaggatccagatcca 35533

>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 56      tgcgcaggatccagatcca 74
               |||||||||||||||||||
Sbjct: 4374738 tgcgcaggatccagatcca 4374756


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 482,417
Number of Sequences: 3902068
Number of extensions: 482417
Number of successful extensions: 29740
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29678
Number of HSP's gapped (non-prelim): 62
length of query: 118
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 97
effective length of database: 17,151,101,840
effective search space: 1663656878480
effective search space used: 1663656878480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)