ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl45f02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC138000.3| Oryza sativa (japonica cultivar-group) chromosome... 363 3e-97
2dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 363 3e-97
3gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 363 3e-97
4dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 101 2e-18
5gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 101 2e-18
6emb|AL954853.5|CNS08CD7 Oryza sativa chromosome 12, . BAC OSJNBb... 101 2e-18
7emb|BX545915.7| Zebrafish DNA sequence from clone DKEY-41B16 in ... 42 1.4
8gb|AC091453.2| Mus musculus chromosome X clones RP21-19N11, RP21... 40 5.5
9gb|AY825832.1| Anopheles gambiae isolate S13 haplotype 2 heat sh... 40 5.5
10gb|AY825831.1| Anopheles gambiae isolate S13 haplotype 1 heat sh... 40 5.5
11gb|AY825830.1| Anopheles gambiae isolate S12 haplotype 2 heat sh... 40 5.5
12gb|AY825829.1| Anopheles gambiae isolate S12 haplotype 1 heat sh... 40 5.5
13gb|AY825828.1| Anopheles gambiae isolate S11 haplotype 2 heat sh... 40 5.5
14gb|AY825827.1| Anopheles gambiae isolate S11 haplotype 1 heat sh... 40 5.5
15gb|AY825826.1| Anopheles gambiae isolate S10 haplotype 2 heat sh... 40 5.5
16gb|AY825825.1| Anopheles gambiae isolate S10 haplotype 1 heat sh... 40 5.5
17gb|AY825824.1| Anopheles gambiae isolate S9 haplotype 2 heat sho... 40 5.5
18gb|AY825823.1| Anopheles gambiae isolate S9 haplotype 1 heat sho... 40 5.5
19gb|AY825822.1| Anopheles gambiae isolate S8 haplotype 2 heat sho... 40 5.5
20gb|AY825821.1| Anopheles gambiae isolate S8 haplotype 1 heat sho... 40 5.5
21gb|AY825820.1| Anopheles gambiae isolate S7 haplotype 2 heat sho... 40 5.5
22gb|AY825819.1| Anopheles gambiae isolate S7 haplotype 1 heat sho... 40 5.5
23gb|AY825818.1| Anopheles gambiae isolate S6 haplotype 2 heat sho... 40 5.5
24gb|AY825817.1| Anopheles gambiae isolate S6 haplotype 1 heat sho... 40 5.5
25gb|AY825816.1| Anopheles gambiae isolate S5 haplotype 2 heat sho... 40 5.5
26gb|AY825815.1| Anopheles gambiae isolate S5 haplotype 1 heat sho... 40 5.5
27gb|AY825814.1| Anopheles gambiae isolate S4 haplotype 2 heat sho... 40 5.5
28gb|AY825813.1| Anopheles gambiae isolate S4 haplotype 1 heat sho... 40 5.5
29gb|AY825812.1| Anopheles gambiae isolate S3 haplotype 2 heat sho... 40 5.5
30gb|AY825811.1| Anopheles gambiae isolate S3 haplotype 1 heat sho... 40 5.5
31gb|AY825810.1| Anopheles gambiae isolate S2 haplotype 2 heat sho... 40 5.5
32gb|AY825809.1| Anopheles gambiae isolate S2 haplotype 1 heat sho... 40 5.5
33gb|AY825808.1| Anopheles gambiae isolate S1 haplotype 2 heat sho... 40 5.5
34gb|AY825807.1| Anopheles gambiae isolate S1 haplotype 1 heat sho... 40 5.5
35gb|AY825806.1| Anopheles gambiae isolate M17 haplotype 2 heat sh... 40 5.5
36gb|AY825805.1| Anopheles gambiae isolate M17 haplotype 1 heat sh... 40 5.5
37gb|AY825804.1| Anopheles gambiae isolate M15 haplotype 2 heat sh... 40 5.5
38gb|AY825803.1| Anopheles gambiae isolate M15 haplotype 1 heat sh... 40 5.5
39gb|AY825802.1| Anopheles gambiae isolate M11 haplotype 2 heat sh... 40 5.5
40gb|AY825801.1| Anopheles gambiae isolate M11 haplotype 1 heat sh... 40 5.5
41gb|AY825800.1| Anopheles gambiae isolate M10 haplotype 2 heat sh... 40 5.5
42gb|AY825799.1| Anopheles gambiae isolate M10 haplotype 1 heat sh... 40 5.5
43gb|AY825798.1| Anopheles gambiae isolate M9 haplotype 2 heat sho... 40 5.5
44gb|AY825797.1| Anopheles gambiae isolate M9 haplotype 1 heat sho... 40 5.5
45gb|AY825796.1| Anopheles gambiae isolate M8 haplotype 2 heat sho... 40 5.5
46gb|AY825795.1| Anopheles gambiae isolate M8 haplotype 1 heat sho... 40 5.5
47gb|AY825794.1| Anopheles gambiae isolate M7 haplotype 2 heat sho... 40 5.5
48gb|AY825793.1| Anopheles gambiae isolate M7 haplotype 1 heat sho... 40 5.5
49gb|AY825792.1| Anopheles gambiae isolate M6 haplotype 2 heat sho... 40 5.5
50gb|AY825791.1| Anopheles gambiae isolate M6 haplotype 1 heat sho... 40 5.5
51gb|AY825790.1| Anopheles gambiae isolate M5 haplotype 2 heat sho... 40 5.5
52gb|AY825789.1| Anopheles gambiae isolate M5 haplotype 1 heat sho... 40 5.5
53gb|AY825788.1| Anopheles gambiae isolate M4 haplotype 2 heat sho... 40 5.5
54gb|AY825787.1| Anopheles gambiae isolate M4 haplotype 1 heat sho... 40 5.5
55gb|AY825786.1| Anopheles gambiae isolate M3 haplotype 2 heat sho... 40 5.5
56gb|AY825785.1| Anopheles gambiae isolate M3 haplotype 1 heat sho... 40 5.5
57gb|AY825784.1| Anopheles gambiae isolate M2 haplotype 2 heat sho... 40 5.5
58gb|AY825783.1| Anopheles gambiae isolate M2 haplotype 1 heat sho... 40 5.5
59gb|AY825782.1| Anopheles gambiae isolate M1 haplotype 2 heat sho... 40 5.5
60gb|AY825781.1| Anopheles gambiae isolate M1 haplotype 1 heat sho... 40 5.5
61emb|Z74039.1|CEK03B8 Caenorhabditis elegans Cosmid K03B8, comple... 40 5.5
62emb|CR762488.16| Zebrafish DNA sequence from clone DKEY-266J7 in... 40 5.5
63emb|CR391930.9| Zebrafish DNA sequence from clone CH211-154B16 i... 40 5.5
64gb|AC008620.12| Homo sapiens chromosome 5 clone CTB-14A14, compl... 40 5.5
65emb|AL663082.5| Mouse DNA sequence from clone RP23-327G1 on chro... 40 5.5
66emb|BX649363.11| Zebrafish DNA sequence from clone CH211-13C3 in... 40 5.5
67emb|AL596064.3| Zebrafish DNA sequence from clone BUSM1-55K10 in... 40 5.5
68emb|CR394561.8| Zebrafish DNA sequence from clone CH211-28G14 in... 40 5.5
69gb|DQ420644.1| Saccharomycopsis fibuligera beta-actin gene, part... 40 5.5
70gb|AC161237.8| Mus musculus chromosome 3, clone RP23-307M9, comp... 40 5.5
71emb|BX510347.9| Zebrafish DNA sequence from clone DKEY-5E14 in l... 40 5.5
72emb|CR450244.2| Zebrafish DNA sequence from clone CH211-196O21 i... 40 5.5
73emb|BX255943.6| Zebrafish DNA sequence from clone CH211-246M13 i... 40 5.5
74emb|BX294169.10| Zebrafish DNA sequence from clone DKEY-151N15 i... 40 5.5
75gb|AC008178.3| Homo sapiens BAC clone RP11-551O2 from 2, complet... 40 5.5
76gb|AC122716.2| Homo sapiens chromosome 5 clone RP11-567A12, comp... 40 5.5
77emb|BX294379.5| Zebrafish DNA sequence from clone DKEY-7A20 in l... 40 5.5
78emb|AL928945.5| Zebrafish DNA sequence from clone BUSM1-203G9 in... 40 5.5
79ref|XM_318286.2| Anopheles gambiae str. PEST ENSANGP00000001755 ... 40 5.5
80emb|AL590151.8| Zebrafish DNA sequence from clone RP71-46J2 in l... 40 5.5
81emb|AL805924.5| Mouse DNA sequence from clone RP23-329M9 on chro... 40 5.5 
>gb|AC138000.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0024M06, complete sequence
          Length = 51144

 Score =  363 bits (183), Expect = 3e-97
 Identities = 333/383 (86%)
 Strand = Plus / Plus

                                                                         
Query: 30    aaagaagctgttctccttcactatctgatacacttagacgaaaaggaagcagcctgttgt 89
             ||||||| | ||||||||| || ||||||||||| ||| ||||||| |||||||||||||
Sbjct: 37616 aaagaagtttttctccttcgctctctgatacactcagaagaaaagggagcagcctgttgt 37675

                                                                         
Query: 90    gtggaagtcagacgatgcacagaaggaagagatcatctggctccaacaaatgtggatatc 149
             ||||  ||||||| |||||||||||||||||||||||||||||||  ||||||| |||||
Sbjct: 37676 gtgggggtcagacaatgcacagaaggaagagatcatctggctccagtaaatgtgcatatc 37735

                                                                         
Query: 150   ttaaaaaatcttcccaaggcgagccactcttgggtgatagttgccatttttcttactcgt 209
             |||  || ||||||||| ||  ||||||||| | ||||||||| |||||| |||| || |
Sbjct: 37736 ttacgaagtcttcccaaagcacgccactcttagatgatagttgtcattttgcttattcat 37795

                                                                         
Query: 210   catttgattcagcaagcgagggagtttcaaccatatttggagaactagatttagaagctt 269
             |||||||||||||||| || | |||||| ||||| ||||||||| ||||||| |||||||
Sbjct: 37796 catttgattcagcaagtgatgaagtttcgaccatctttggagaattagatttggaagctt 37855

                                                                         
Query: 270   tgagccggttggatggcagaaggtggtcaagctgtaagagccaggatgggattgctttgc 329
             ||||| | ||||||||| ||||||||||||||||||| || ||||||||||||||  |||
Sbjct: 37856 tgagcagattggatggccgaaggtggtcaagctgtaaaagtcaggatgggattgcactgc 37915

                                                                         
Query: 330   cttccagtggagctgatcatgcagtttcagaccagagaagcttgagccagaagtaccgtc 389
             ||   ||||||||||||||||||||||| |||||||||||||||||||| || ||||| |
Sbjct: 37916 ctatgagtggagctgatcatgcagtttcggaccagagaagcttgagccaaaaataccgac 37975

                                    
Query: 390   caagatcatatcatgaaattgtt 412
             |||| |||| | ||||| |||||
Sbjct: 37976 caaggtcatttaatgaacttgtt 37998
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  363 bits (183), Expect = 3e-97
 Identities = 333/383 (86%)
 Strand = Plus / Minus

                                                                           
Query: 30      aaagaagctgttctccttcactatctgatacacttagacgaaaaggaagcagcctgttgt 89
               ||||||| | ||||||||| || ||||||||||| ||| ||||||| |||||||||||||
Sbjct: 7678651 aaagaagtttttctccttcgctctctgatacactcagaagaaaagggagcagcctgttgt 7678592

                                                                           
Query: 90      gtggaagtcagacgatgcacagaaggaagagatcatctggctccaacaaatgtggatatc 149
               ||||  ||||||| |||||||||||||||||||||||||||||||  ||||||| |||||
Sbjct: 7678591 gtgggggtcagacaatgcacagaaggaagagatcatctggctccagtaaatgtgcatatc 7678532

                                                                           
Query: 150     ttaaaaaatcttcccaaggcgagccactcttgggtgatagttgccatttttcttactcgt 209
               |||  || ||||||||| ||  ||||||||| | ||||||||| |||||| |||| || |
Sbjct: 7678531 ttacgaagtcttcccaaagcacgccactcttagatgatagttgtcattttgcttattcat 7678472

                                                                           
Query: 210     catttgattcagcaagcgagggagtttcaaccatatttggagaactagatttagaagctt 269
               |||||||||||||||| || | |||||| ||||| ||||||||| ||||||| |||||||
Sbjct: 7678471 catttgattcagcaagtgatgaagtttcgaccatctttggagaattagatttggaagctt 7678412

                                                                           
Query: 270     tgagccggttggatggcagaaggtggtcaagctgtaagagccaggatgggattgctttgc 329
               ||||| | ||||||||| ||||||||||||||||||| || ||||||||||||||  |||
Sbjct: 7678411 tgagcagattggatggccgaaggtggtcaagctgtaaaagtcaggatgggattgcactgc 7678352

                                                                           
Query: 330     cttccagtggagctgatcatgcagtttcagaccagagaagcttgagccagaagtaccgtc 389
               ||   ||||||||||||||||||||||| |||||||||||||||||||| || ||||| |
Sbjct: 7678351 ctatgagtggagctgatcatgcagtttcggaccagagaagcttgagccaaaaataccgac 7678292

                                      
Query: 390     caagatcatatcatgaaattgtt 412
               |||| |||| | ||||| |||||
Sbjct: 7678291 caaggtcatttaatgaacttgtt 7678269
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  363 bits (183), Expect = 3e-97
 Identities = 333/383 (86%)
 Strand = Plus / Minus

                                                                           
Query: 30      aaagaagctgttctccttcactatctgatacacttagacgaaaaggaagcagcctgttgt 89
               ||||||| | ||||||||| || ||||||||||| ||| ||||||| |||||||||||||
Sbjct: 7748738 aaagaagtttttctccttcgctctctgatacactcagaagaaaagggagcagcctgttgt 7748679

                                                                           
Query: 90      gtggaagtcagacgatgcacagaaggaagagatcatctggctccaacaaatgtggatatc 149
               ||||  ||||||| |||||||||||||||||||||||||||||||  ||||||| |||||
Sbjct: 7748678 gtgggggtcagacaatgcacagaaggaagagatcatctggctccagtaaatgtgcatatc 7748619

                                                                           
Query: 150     ttaaaaaatcttcccaaggcgagccactcttgggtgatagttgccatttttcttactcgt 209
               |||  || ||||||||| ||  ||||||||| | ||||||||| |||||| |||| || |
Sbjct: 7748618 ttacgaagtcttcccaaagcacgccactcttagatgatagttgtcattttgcttattcat 7748559

                                                                           
Query: 210     catttgattcagcaagcgagggagtttcaaccatatttggagaactagatttagaagctt 269
               |||||||||||||||| || | |||||| ||||| ||||||||| ||||||| |||||||
Sbjct: 7748558 catttgattcagcaagtgatgaagtttcgaccatctttggagaattagatttggaagctt 7748499

                                                                           
Query: 270     tgagccggttggatggcagaaggtggtcaagctgtaagagccaggatgggattgctttgc 329
               ||||| | ||||||||| ||||||||||||||||||| || ||||||||||||||  |||
Sbjct: 7748498 tgagcagattggatggccgaaggtggtcaagctgtaaaagtcaggatgggattgcactgc 7748439

                                                                           
Query: 330     cttccagtggagctgatcatgcagtttcagaccagagaagcttgagccagaagtaccgtc 389
               ||   ||||||||||||||||||||||| |||||||||||||||||||| || ||||| |
Sbjct: 7748438 ctatgagtggagctgatcatgcagtttcggaccagagaagcttgagccaaaaataccgac 7748379

                                      
Query: 390     caagatcatatcatgaaattgtt 412
               |||| |||| | ||||| |||||
Sbjct: 7748378 caaggtcatttaatgaacttgtt 7748356
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  101 bits (51), Expect = 2e-18
 Identities = 60/63 (95%)
 Strand = Plus / Minus

                                                                           
Query: 257     gatttagaagctttgagccggttggatggcagaaggtggtcaagctgtaagagccaggat 316
               ||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 5706118 gatttggaagctttgagccggttggatgggagaaggtggtcaagctgtaaaagccaggat 5706059

                  
Query: 317     ggg 319
               |||
Sbjct: 5706058 ggg 5706056



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                           
Query: 41      tctccttcactatctgatacacttagacgaaaaggaagcagcctgttgtgtggaagtcag 100
               ||||||||||| || |||| ||| ||| ||||||| ||| |||| || ||||| || |||
Sbjct: 5706334 tctccttcactgtcagatatactcagaagaaaaggtagcggcctattatgtgggagccag 5706275

                                        
Query: 101     acgatgcacagaaggaagagatcat 125
               ||  |||| || | |||||||||||
Sbjct: 5706274 acactgcataggaagaagagatcat 5706250



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 357     cagaccagagaagcttgagccagaagtac 385
               |||||| |||||| |||||||||||||||
Sbjct: 5706018 cagaccggagaagtttgagccagaagtac 5705990
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  101 bits (51), Expect = 2e-18
 Identities = 60/63 (95%)
 Strand = Plus / Minus

                                                                           
Query: 257     gatttagaagctttgagccggttggatggcagaaggtggtcaagctgtaagagccaggat 316
               ||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 5706111 gatttggaagctttgagccggttggatgggagaaggtggtcaagctgtaaaagccaggat 5706052

                  
Query: 317     ggg 319
               |||
Sbjct: 5706051 ggg 5706049



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                           
Query: 41      tctccttcactatctgatacacttagacgaaaaggaagcagcctgttgtgtggaagtcag 100
               ||||||||||| || |||| ||| ||| ||||||| ||| |||| || ||||| || |||
Sbjct: 5706327 tctccttcactgtcagatatactcagaagaaaaggtagcggcctattatgtgggagccag 5706268

                                        
Query: 101     acgatgcacagaaggaagagatcat 125
               ||  |||| || | |||||||||||
Sbjct: 5706267 acactgcataggaagaagagatcat 5706243



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 357     cagaccagagaagcttgagccagaagtac 385
               |||||| |||||| |||||||||||||||
Sbjct: 5706011 cagaccggagaagtttgagccagaagtac 5705983
to top
>emb|AL954853.5|CNS08CD7 Oryza sativa chromosome 12, . BAC OSJNBb0071I17 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 159056

 Score =  101 bits (51), Expect = 2e-18
 Identities = 60/63 (95%)
 Strand = Plus / Minus

                                                                         
Query: 257   gatttagaagctttgagccggttggatggcagaaggtggtcaagctgtaagagccaggat 316
             ||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 60641 gatttggaagctttgagccggttggatgggagaaggtggtcaagctgtaaaagccaggat 60582

                
Query: 317   ggg 319
             |||
Sbjct: 60581 ggg 60579



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                         
Query: 41    tctccttcactatctgatacacttagacgaaaaggaagcagcctgttgtgtggaagtcag 100
             ||||||||||| || |||| ||| ||| ||||||| ||| |||| || ||||| || |||
Sbjct: 60857 tctccttcactgtcagatatactcagaagaaaaggtagcggcctattatgtgggagccag 60798

                                      
Query: 101   acgatgcacagaaggaagagatcat 125
             ||  |||| || | |||||||||||
Sbjct: 60797 acactgcataggaagaagagatcat 60773



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 357   cagaccagagaagcttgagccagaagtac 385
             |||||| |||||| |||||||||||||||
Sbjct: 60541 cagaccggagaagtttgagccagaagtac 60513
to top
>emb|BX545915.7| Zebrafish DNA sequence from clone DKEY-41B16 in linkage group 3, complete
              sequence
          Length = 192468

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 341    gctgatcatgcagtttcagac 361
              |||||||||||||||||||||
Sbjct: 100384 gctgatcatgcagtttcagac 100364
to top
>gb|AC091453.2| Mus musculus chromosome X clones RP21-19N11, RP21-667A15, RP21-395M8
              complete sequence
          Length = 350000

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 78     gcagcctgttgtgtggaagt 97
              ||||||||||||||||||||
Sbjct: 213118 gcagcctgttgtgtggaagt 213137
to top
>gb|AY825832.1| Anopheles gambiae isolate S13 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825831.1| Anopheles gambiae isolate S13 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825830.1| Anopheles gambiae isolate S12 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825829.1| Anopheles gambiae isolate S12 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825828.1| Anopheles gambiae isolate S11 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 517

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 433 tattccatattggtcaaagg 452
to top
>gb|AY825827.1| Anopheles gambiae isolate S11 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 517

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 433 tattccatattggtcaaagg 452
to top
>gb|AY825826.1| Anopheles gambiae isolate S10 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825825.1| Anopheles gambiae isolate S10 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825824.1| Anopheles gambiae isolate S9 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 485

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 445 tattccatattggtcaaagg 464
to top
>gb|AY825823.1| Anopheles gambiae isolate S9 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 485

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 445 tattccatattggtcaaagg 464
to top
>gb|AY825822.1| Anopheles gambiae isolate S8 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 480

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 434 tattccatattggtcaaagg 453
to top
>gb|AY825821.1| Anopheles gambiae isolate S8 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 480

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 434 tattccatattggtcaaagg 453
to top
>gb|AY825820.1| Anopheles gambiae isolate S7 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825819.1| Anopheles gambiae isolate S7 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825818.1| Anopheles gambiae isolate S6 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825817.1| Anopheles gambiae isolate S6 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825816.1| Anopheles gambiae isolate S5 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 488

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 433 tattccatattggtcaaagg 452
to top
>gb|AY825815.1| Anopheles gambiae isolate S5 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 488

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 433 tattccatattggtcaaagg 452
to top
>gb|AY825814.1| Anopheles gambiae isolate S4 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 508

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825813.1| Anopheles gambiae isolate S4 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 508

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825812.1| Anopheles gambiae isolate S3 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825811.1| Anopheles gambiae isolate S3 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825810.1| Anopheles gambiae isolate S2 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 508

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825809.1| Anopheles gambiae isolate S2 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 508

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825808.1| Anopheles gambiae isolate S1 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 516

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 434 tattccatattggtcaaagg 453
to top
>gb|AY825807.1| Anopheles gambiae isolate S1 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 516

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 434 tattccatattggtcaaagg 453
to top
>gb|AY825806.1| Anopheles gambiae isolate M17 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825805.1| Anopheles gambiae isolate M17 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825804.1| Anopheles gambiae isolate M15 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825803.1| Anopheles gambiae isolate M15 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825802.1| Anopheles gambiae isolate M11 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825801.1| Anopheles gambiae isolate M11 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825800.1| Anopheles gambiae isolate M10 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 512

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 429 tattccatattggtcaaagg 448
to top
>gb|AY825799.1| Anopheles gambiae isolate M10 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 512

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 429 tattccatattggtcaaagg 448
to top
>gb|AY825798.1| Anopheles gambiae isolate M9 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825797.1| Anopheles gambiae isolate M9 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825796.1| Anopheles gambiae isolate M8 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 524

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 433 tattccatattggtcaaagg 452
to top
>gb|AY825795.1| Anopheles gambiae isolate M8 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 524

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 433 tattccatattggtcaaagg 452
to top
>gb|AY825794.1| Anopheles gambiae isolate M7 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 510

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 428 tattccatattggtcaaagg 447
to top
>gb|AY825793.1| Anopheles gambiae isolate M7 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 510

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 428 tattccatattggtcaaagg 447
to top
>gb|AY825792.1| Anopheles gambiae isolate M6 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 462

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825791.1| Anopheles gambiae isolate M6 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 462

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825790.1| Anopheles gambiae isolate M5 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825789.1| Anopheles gambiae isolate M5 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825788.1| Anopheles gambiae isolate M4 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825787.1| Anopheles gambiae isolate M4 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825786.1| Anopheles gambiae isolate M3 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825785.1| Anopheles gambiae isolate M3 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825784.1| Anopheles gambiae isolate M2 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825783.1| Anopheles gambiae isolate M2 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825782.1| Anopheles gambiae isolate M1 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825781.1| Anopheles gambiae isolate M1 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>emb|Z74039.1|CEK03B8 Caenorhabditis elegans Cosmid K03B8, complete sequence
          Length = 29132

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 38    tgttctccttcactatctga 57
             ||||||||||||||||||||
Sbjct: 10654 tgttctccttcactatctga 10635
to top
>emb|CR762488.16| Zebrafish DNA sequence from clone DKEY-266J7 in linkage group 18,
             complete sequence
          Length = 154489

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 342   ctgatcatgcagtttcagac 361
             ||||||||||||||||||||
Sbjct: 24293 ctgatcatgcagtttcagac 24312
to top
>emb|CR391930.9| Zebrafish DNA sequence from clone CH211-154B16 in linkage group 15,
              complete sequence
          Length = 175972

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 342    ctgatcatgcagtttcagac 361
              ||||||||||||||||||||
Sbjct: 100151 ctgatcatgcagtttcagac 100170
to top
>gb|AC008620.12| Homo sapiens chromosome 5 clone CTB-14A14, complete sequence
          Length = 124713

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 134   aacaaatgtggatatcttaa 153
             ||||||||||||||||||||
Sbjct: 66127 aacaaatgtggatatcttaa 66108
to top
>emb|AL663082.5| Mouse DNA sequence from clone RP23-327G1 on chromosome 11 Contains the
             3' end of the Ankfy1 gene for ankyrin repeat and FYVE
             domain containing 1, a new gene, the gene for a novel ZZ
             type zinc finger domain containing protein, the 5' end of
             the Atp2a3 gene for ubiquitous Ca++ transporting ATPase
             and two CpG islands, complete sequence
          Length = 243654

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 363   agagaagcttgagccagaag 382
             ||||||||||||||||||||
Sbjct: 43566 agagaagcttgagccagaag 43547
to top
>emb|BX649363.11| Zebrafish DNA sequence from clone CH211-13C3 in linkage group 21,
              complete sequence
          Length = 196451

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 342    ctgatcatgcagtttcagac 361
              ||||||||||||||||||||
Sbjct: 113399 ctgatcatgcagtttcagac 113418
to top
>emb|AL596064.3| Zebrafish DNA sequence from clone BUSM1-55K10 in linkage group 17,
            complete sequence
          Length = 12264

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 342  ctgatcatgcagtttcagac 361
            ||||||||||||||||||||
Sbjct: 9743 ctgatcatgcagtttcagac 9762
to top
>emb|CR394561.8| Zebrafish DNA sequence from clone CH211-28G14 in linkage group 17,
             complete sequence
          Length = 154908

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 342   ctgatcatgcagtttcagac 361
             ||||||||||||||||||||
Sbjct: 37321 ctgatcatgcagtttcagac 37340
to top
>gb|DQ420644.1| Saccharomycopsis fibuligera beta-actin gene, partial cds
          Length = 846

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 131 tccaacaaatgtggatatct 150
           ||||||||||||||||||||
Sbjct: 34  tccaacaaatgtggatatct 15
to top
>gb|AC161237.8| Mus musculus chromosome 3, clone RP23-307M9, complete sequence
          Length = 206004

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 356    tcagaccagagaagcttgagccag 379
              ||||||||| ||||||||||||||
Sbjct: 106368 tcagaccagggaagcttgagccag 106345
to top
>emb|BX510347.9| Zebrafish DNA sequence from clone DKEY-5E14 in linkage group 5,
            complete sequence
          Length = 13288

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 342  ctgatcatgcagtttcagac 361
            ||||||||||||||||||||
Sbjct: 2369 ctgatcatgcagtttcagac 2350
to top
>emb|CR450244.2| Zebrafish DNA sequence from clone CH211-196O21 in linkage group 4,
             complete sequence
          Length = 21058

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 342   ctgatcatgcagtttcagac 361
             ||||||||||||||||||||
Sbjct: 10139 ctgatcatgcagtttcagac 10120
to top
>emb|BX255943.6| Zebrafish DNA sequence from clone CH211-246M13 in linkage group 2,
             complete sequence
          Length = 155032

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 342   ctgatcatgcagtttcagac 361
             ||||||||||||||||||||
Sbjct: 76947 ctgatcatgcagtttcagac 76966
to top
>emb|BX294169.10| Zebrafish DNA sequence from clone DKEY-151N15 in linkage group 5,
            complete sequence
          Length = 73230

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 342  ctgatcatgcagtttcagac 361
            ||||||||||||||||||||
Sbjct: 2370 ctgatcatgcagtttcagac 2351
to top
>gb|AC008178.3| Homo sapiens BAC clone RP11-551O2 from 2, complete sequence
          Length = 113367

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    aaaggggagtaaacaaagaa 35
             ||||||||||||||||||||
Sbjct: 16976 aaaggggagtaaacaaagaa 16995
to top
>gb|AC122716.2| Homo sapiens chromosome 5 clone RP11-567A12, complete sequence
          Length = 171057

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 247    tggagaactagatttagaag 266
              ||||||||||||||||||||
Sbjct: 124813 tggagaactagatttagaag 124832
to top
>emb|BX294379.5| Zebrafish DNA sequence from clone DKEY-7A20 in linkage group 1,
             complete sequence
          Length = 214290

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 342   ctgatcatgcagtttcagac 361
             ||||||||||||||||||||
Sbjct: 27154 ctgatcatgcagtttcagac 27135
to top
>emb|AL928945.5| Zebrafish DNA sequence from clone BUSM1-203G9 in linkage group 1,
             complete sequence
          Length = 84710

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 342   ctgatcatgcagtttcagac 361
             ||||||||||||||||||||
Sbjct: 75802 ctgatcatgcagtttcagac 75783
to top
>ref|XM_318286.2| Anopheles gambiae str. PEST ENSANGP00000001755
           (ENSANGG00000001474), partial mRNA
          Length = 1371

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 1   tattccatattggtcaaagg 20
           ||||||||||||||||||||
Sbjct: 261 tattccatattggtcaaagg 242
to top
>emb|AL590151.8| Zebrafish DNA sequence from clone RP71-46J2 in linkage group 14,
             complete sequence
          Length = 137129

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 342   ctgatcatgcagtttcagac 361
             ||||||||||||||||||||
Sbjct: 89466 ctgatcatgcagtttcagac 89485
to top
>emb|AL805924.5| Mouse DNA sequence from clone RP23-329M9 on chromosome X, complete
             sequence
          Length = 222134

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 78    gcagcctgttgtgtggaagt 97
             ||||||||||||||||||||
Sbjct: 80800 gcagcctgttgtgtggaagt 80819


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,598,678
Number of Sequences: 3902068
Number of extensions: 4598678
Number of successful extensions: 76340
Number of sequences better than 10.0: 81
Number of HSP's better than 10.0 without gapping: 81
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76169
Number of HSP's gapped (non-prelim): 171
length of query: 412
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 390
effective length of database: 17,147,199,772
effective search space: 6687407911080
effective search space used: 6687407911080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top