Clone Name | bastl45c06 |
---|---|
Clone Library Name | barley_pub |
>dbj|AK100439.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023089F03, full insert sequence Length = 3369 Score = 188 bits (95), Expect = 1e-44 Identities = 185/215 (86%) Strand = Plus / Plus Query: 258 ccgctgcagatagttttgacgccgggcagtacgccttcttcgagaaggagccgcgtgacg 317 |||| |||| || |||||| || ||||||||||||||||||| ||||||||| | || | Sbjct: 227 ccgccgcaggtaattttgatgctgggcagtacgccttcttcgggaaggagccactggagg 286 Query: 318 ggcccgagctaggttgcttggaggtcgacggcggccatggcaatggcggcggattcagcg 377 | | |||||| |||||||||||| | |||||| ||||||||||||| |||||||||| Sbjct: 287 gactcgagctcagttgcttggaggatggcggcggtgatggcaatggcggtggattcagcg 346 Query: 378 gggcagaaaatgggctgtaccgtctctcttcggttggagaagagattgacaatctaagta 437 || ||||| ||||||||||||| |||||||| ||||||||||||||||| ||||| |||| Sbjct: 347 ggccagaagatgggctgtaccggctctcttctgttggagaagagattgataatctgagta 406 Query: 438 acttgtcggacgtcgatgatcttgcgagcactttt 472 ||||||| || | ||||||||||||||||||||| Sbjct: 407 acttgtcagaaattgatgatcttgcgagcactttt 441 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 133 gctgccgccgccgccgctgct 153
>dbj|AK072195.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013151K20, full insert sequence Length = 3262 Score = 188 bits (95), Expect = 1e-44 Identities = 185/215 (86%) Strand = Plus / Plus Query: 258 ccgctgcagatagttttgacgccgggcagtacgccttcttcgagaaggagccgcgtgacg 317 |||| |||| || |||||| || ||||||||||||||||||| ||||||||| | || | Sbjct: 228 ccgccgcaggtaattttgatgctgggcagtacgccttcttcgggaaggagccactggagg 287 Query: 318 ggcccgagctaggttgcttggaggtcgacggcggccatggcaatggcggcggattcagcg 377 | | |||||| |||||||||||| | |||||| ||||||||||||| |||||||||| Sbjct: 288 gactcgagctcagttgcttggaggatggcggcggtgatggcaatggcggtggattcagcg 347 Query: 378 gggcagaaaatgggctgtaccgtctctcttcggttggagaagagattgacaatctaagta 437 || ||||| ||||||||||||| |||||||| ||||||||||||||||| ||||| |||| Sbjct: 348 ggccagaagatgggctgtaccggctctcttctgttggagaagagattgataatctgagta 407 Query: 438 acttgtcggacgtcgatgatcttgcgagcactttt 472 ||||||| || | ||||||||||||||||||||| Sbjct: 408 acttgtcagaaattgatgatcttgcgagcactttt 442 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 134 gctgccgccgccgccgctgct 154
>dbj|AK070157.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023046D01, full insert sequence Length = 3981 Score = 188 bits (95), Expect = 1e-44 Identities = 185/215 (86%) Strand = Plus / Plus Query: 258 ccgctgcagatagttttgacgccgggcagtacgccttcttcgagaaggagccgcgtgacg 317 |||| |||| || |||||| || ||||||||||||||||||| ||||||||| | || | Sbjct: 226 ccgccgcaggtaattttgatgctgggcagtacgccttcttcgggaaggagccactggagg 285 Query: 318 ggcccgagctaggttgcttggaggtcgacggcggccatggcaatggcggcggattcagcg 377 | | |||||| |||||||||||| | |||||| ||||||||||||| |||||||||| Sbjct: 286 gactcgagctcagttgcttggaggatggcggcggtgatggcaatggcggtggattcagcg 345 Query: 378 gggcagaaaatgggctgtaccgtctctcttcggttggagaagagattgacaatctaagta 437 || ||||| ||||||||||||| |||||||| ||||||||||||||||| ||||| |||| Sbjct: 346 ggccagaagatgggctgtaccggctctcttctgttggagaagagattgataatctgagta 405 Query: 438 acttgtcggacgtcgatgatcttgcgagcactttt 472 ||||||| || | ||||||||||||||||||||| Sbjct: 406 acttgtcagaaattgatgatcttgcgagcactttt 440 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 132 gctgccgccgccgccgctgct 152
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 135 bits (68), Expect = 1e-28 Identities = 137/160 (85%) Strand = Plus / Plus Query: 262 tgcagatagttttgacgccgggcagtacgccttcttcgagaaggagccgcgtgacgggcc 321 ||||| || |||||| || ||||||||||||||||||| ||||||||| | || || | Sbjct: 32427008 tgcaggtaattttgatgctgggcagtacgccttcttcgggaaggagccactggagggact 32427067 Query: 322 cgagctaggttgcttggaggtcgacggcggccatggcaatggcggcggattcagcggggc 381 |||||| |||||||||||| | |||||| ||||||||||||| |||||||||||| | Sbjct: 32427068 cgagctcagttgcttggaggatggcggcggtgatggcaatggcggtggattcagcgggcc 32427127 Query: 382 agaaaatgggctgtaccgtctctcttcggttggagaagag 421 |||| ||||||||||||| |||||||| |||||||||||| Sbjct: 32427128 agaagatgggctgtaccggctctcttctgttggagaagag 32427167 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 420 agattgacaatctaagtaacttgtcggacgtcgatgatcttgcgagcactttt 472 ||||||| ||||| ||||||||||| || | ||||||||||||||||||||| Sbjct: 32428468 agattgataatctgagtaacttgtcagaaattgatgatcttgcgagcactttt 32428520 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 159 gccgccgccgctgctactgttactgctgcta 189 ||||||||||||||| ||||| ||||||||| Sbjct: 24816579 gccgccgccgctgctgctgttgctgctgcta 24816549 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 148 tgccggctgccgccgccgccgc 169 |||||||||||||||||||||| Sbjct: 32540799 tgccggctgccgccgccgccgc 32540820 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 32426511 gctgccgccgccgccgctgct 32426531 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 20237286 gctgccgccgccgccgctgct 20237266 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 154 ctgccgccgccgccgctgct 173 |||||||||||||||||||| Sbjct: 40519362 ctgccgccgccgccgctgct 40519381 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 154 ctgccgccgccgccgctgct 173 |||||||||||||||||||| Sbjct: 35430572 ctgccgccgccgccgctgct 35430553 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 154 ctgccgccgccgccgctgct 173 |||||||||||||||||||| Sbjct: 33990422 ctgccgccgccgccgctgct 33990403 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 150 ccggctgccgccgccgccgc 169 |||||||||||||||||||| Sbjct: 25701344 ccggctgccgccgccgccgc 25701363 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgc 172 |||||||||||||||||||| Sbjct: 2084710 gctgccgccgccgccgctgc 2084691
>dbj|AP003106.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0665A11 Length = 166421 Score = 135 bits (68), Expect = 1e-28 Identities = 137/160 (85%) Strand = Plus / Plus Query: 262 tgcagatagttttgacgccgggcagtacgccttcttcgagaaggagccgcgtgacgggcc 321 ||||| || |||||| || ||||||||||||||||||| ||||||||| | || || | Sbjct: 14529 tgcaggtaattttgatgctgggcagtacgccttcttcgggaaggagccactggagggact 14588 Query: 322 cgagctaggttgcttggaggtcgacggcggccatggcaatggcggcggattcagcggggc 381 |||||| |||||||||||| | |||||| ||||||||||||| |||||||||||| | Sbjct: 14589 cgagctcagttgcttggaggatggcggcggtgatggcaatggcggtggattcagcgggcc 14648 Query: 382 agaaaatgggctgtaccgtctctcttcggttggagaagag 421 |||| ||||||||||||| |||||||| |||||||||||| Sbjct: 14649 agaagatgggctgtaccggctctcttctgttggagaagag 14688 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 420 agattgacaatctaagtaacttgtcggacgtcgatgatcttgcgagcactttt 472 ||||||| ||||| ||||||||||| || | ||||||||||||||||||||| Sbjct: 15989 agattgataatctgagtaacttgtcagaaattgatgatcttgcgagcactttt 16041 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 148 tgccggctgccgccgccgccgc 169 |||||||||||||||||||||| Sbjct: 128320 tgccggctgccgccgccgccgc 128341 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 14032 gctgccgccgccgccgctgct 14052
>dbj|AP003371.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1143G03 Length = 137770 Score = 135 bits (68), Expect = 1e-28 Identities = 137/160 (85%) Strand = Plus / Plus Query: 262 tgcagatagttttgacgccgggcagtacgccttcttcgagaaggagccgcgtgacgggcc 321 ||||| || |||||| || ||||||||||||||||||| ||||||||| | || || | Sbjct: 106505 tgcaggtaattttgatgctgggcagtacgccttcttcgggaaggagccactggagggact 106564 Query: 322 cgagctaggttgcttggaggtcgacggcggccatggcaatggcggcggattcagcggggc 381 |||||| |||||||||||| | |||||| ||||||||||||| |||||||||||| | Sbjct: 106565 cgagctcagttgcttggaggatggcggcggtgatggcaatggcggtggattcagcgggcc 106624 Query: 382 agaaaatgggctgtaccgtctctcttcggttggagaagag 421 |||| ||||||||||||| |||||||| |||||||||||| Sbjct: 106625 agaagatgggctgtaccggctctcttctgttggagaagag 106664 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 420 agattgacaatctaagtaacttgtcggacgtcgatgatcttgcgagcactttt 472 ||||||| ||||| ||||||||||| || | ||||||||||||||||||||| Sbjct: 107965 agattgataatctgagtaacttgtcagaaattgatgatcttgcgagcactttt 108017 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 106008 gctgccgccgccgccgctgct 106028
>dbj|AK102498.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033095B10, full insert sequence Length = 3458 Score = 97.6 bits (49), Expect = 3e-17 Identities = 82/93 (88%) Strand = Plus / Plus Query: 380 gcagaaaatgggctgtaccgtctctcttcggttggagaagagattgacaatctaagtaac 439 |||||| | ||||||||||| ||||| || ||||||||||||||||| ||||| |||||| Sbjct: 355 gcagaagaagggctgtaccggctctcctctgttggagaagagattgataatctgagtaac 414 Query: 440 ttgtcggacgtcgatgatcttgcgagcactttt 472 ||||| || | ||||||||||||||||||||| Sbjct: 415 ttgtccgatattgatgatcttgcgagcactttt 447 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 258 ccgctgcagatagttttgacgccgggcagtacgccttcttcgagaaggagccgcgtgacg 317 ||||| |||||| ||| || |||| ||||||| ||||||||| ||||||||| | || | Sbjct: 221 ccgctccagataatttcgatgccgcgcagtactccttcttcgggaaggagccactggagg 280 Query: 318 ggcccgagctaggttgcttggagg 341 ||| |||||| |||||||||||| Sbjct: 281 ggctcgagctcagttgcttggagg 304
>dbj|AK067500.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013111P10, full insert sequence Length = 3286 Score = 97.6 bits (49), Expect = 3e-17 Identities = 82/93 (88%) Strand = Plus / Plus Query: 380 gcagaaaatgggctgtaccgtctctcttcggttggagaagagattgacaatctaagtaac 439 |||||| | ||||||||||| ||||| || ||||||||||||||||| ||||| |||||| Sbjct: 363 gcagaagaagggctgtaccggctctcctctgttggagaagagattgataatctgagtaac 422 Query: 440 ttgtcggacgtcgatgatcttgcgagcactttt 472 ||||| || | ||||||||||||||||||||| Sbjct: 423 ttgtccgatattgatgatcttgcgagcactttt 455 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Plus Query: 264 cagatagttttgacgccgggcagtacgccttcttcgagaaggagccgcgtgacgggcccg 323 |||||| ||| || |||| ||||||| ||||||||| ||||||||| | || |||| || Sbjct: 235 cagataatttcgatgccgcgcagtaccccttcttcgggaaggagccactggaggggctcg 294 Query: 324 agctaggttgcttggagg 341 |||| |||||||||||| Sbjct: 295 agctcagttgcttggagg 312
>ref|NM_191402.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2292 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 420 agattgacaatctaagtaacttgtcggacgtcgatgatcttgcgagcactttt 472 ||||||| ||||| ||||||||||| || | ||||||||||||||||||||| Sbjct: 8 agattgataatctgagtaacttgtcagaaattgatgatcttgcgagcactttt 60
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 420 agattgacaatctaagtaacttgtcggacgtcgatgatcttgcgagcactttt 472 ||||||| ||||| ||||||||||| || | ||||||||||||||||||||| Sbjct: 18807457 agattgataatctgagtaacttgtccgatattgatgatcttgcgagcactttt 18807509 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 262 tgcagatagttttgacgccgggcagtacgccttcttcgagaaggagccgcgtgacgggcc 321 |||||||| ||| || |||| ||||||| ||||||||| ||||||||| | || |||| Sbjct: 18805957 tgcagataatttcgatgccgcgcagtactccttcttcgggaaggagccactggaggggct 18806016 Query: 322 cgagctaggttgcttggagg 341 |||||| |||||||||||| Sbjct: 18806017 cgagctcagttgcttggagg 18806036 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Plus Query: 380 gcagaaaatgggctgtaccgtctctcttcggttggagaagag 421 |||||| | ||||||||||| ||||| || |||||||||||| Sbjct: 18806087 gcagaagaagggctgtaccggctctcctctgttggagaagag 18806128 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 149 gccggctgccgccgccgccgc 169 ||||||||||||||||||||| Sbjct: 23010137 gccggctgccgccgccgccgc 23010117 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 19351021 gctgccgccgccgccgctgct 19351041 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgc 172 |||||||||||||||||||| Sbjct: 19483201 gctgccgccgccgccgctgc 19483182 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 157 ccgccgccgccgctgctact 176 |||||||||||||||||||| Sbjct: 10713345 ccgccgccgccgctgctact 10713364 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 150 ccggctgccgccgccgccgc 169 |||||||||||||||||||| Sbjct: 3564530 ccggctgccgccgccgccgc 3564511
>dbj|AP005497.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0071O21 Length = 158410 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 420 agattgacaatctaagtaacttgtcggacgtcgatgatcttgcgagcactttt 472 ||||||| ||||| ||||||||||| || | ||||||||||||||||||||| Sbjct: 150209 agattgataatctgagtaacttgtccgatattgatgatcttgcgagcactttt 150261 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 262 tgcagatagttttgacgccgggcagtacgccttcttcgagaaggagccgcgtgacgggcc 321 |||||||| ||| || |||| ||||||| ||||||||| ||||||||| | || |||| Sbjct: 148709 tgcagataatttcgatgccgcgcagtactccttcttcgggaaggagccactggaggggct 148768 Query: 322 cgagctaggttgcttggagg 341 |||||| |||||||||||| Sbjct: 148769 cgagctcagttgcttggagg 148788 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Plus Query: 380 gcagaaaatgggctgtaccgtctctcttcggttggagaagag 421 |||||| | ||||||||||| ||||| || |||||||||||| Sbjct: 148839 gcagaagaagggctgtaccggctctcctctgttggagaagag 148880
>dbj|AP007253.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0004O05 Length = 140513 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 420 agattgacaatctaagtaacttgtcggacgtcgatgatcttgcgagcactttt 472 ||||||| ||||| ||||||||||| || | ||||||||||||||||||||| Sbjct: 52932 agattgataatctgagtaacttgtccgatattgatgatcttgcgagcactttt 52984 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 262 tgcagatagttttgacgccgggcagtacgccttcttcgagaaggagccgcgtgacgggcc 321 |||||||| ||| || |||| ||||||| ||||||||| ||||||||| | || |||| Sbjct: 51432 tgcagataatttcgatgccgcgcagtactccttcttcgggaaggagccactggaggggct 51491 Query: 322 cgagctaggttgcttggagg 341 |||||| |||||||||||| Sbjct: 51492 cgagctcagttgcttggagg 51511 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Plus Query: 380 gcagaaaatgggctgtaccgtctctcttcggttggagaagag 421 |||||| | ||||||||||| ||||| || |||||||||||| Sbjct: 51562 gcagaagaagggctgtaccggctctcctctgttggagaagag 51603
>ref|XM_812978.1| Trypanosoma cruzi strain CL Brener serine/threonine protein kinase (Tc00.1047053511245.240) partial mRNA Length = 2235 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 158 cgccgccgccgctgctactgttactgctgc 187 |||||||||||||||||||||| ||||||| Sbjct: 144 cgccgccgccgctgctactgttgctgctgc 115
>gb|AC113586.14| Mus musculus chromosome 8, clone RP23-17D24, complete sequence Length = 206445 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||||| |||||||| Sbjct: 164815 gccgccgccgccgctgctgctgttgctgctgct 164783
>gb|AC112997.10| Mus musculus chromosome 8, clone RP24-484I6, complete sequence Length = 191413 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||||| |||||||| Sbjct: 166775 gccgccgccgccgctgctgctgttgctgctgct 166807
>gb|AC146798.2| Xenopus tropicalis chromosome CH216-140P23, complete sequence Length = 86848 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgctactg 177 ||||||||||||||||||||||||| Sbjct: 22565 gctgccgccgccgccgctgctactg 22589
>ref|XM_986444.1| PREDICTED: Mus musculus similar to neuregulin 1 isoform GGF2 (LOC671340), mRNA Length = 1029 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||||| |||||||| Sbjct: 105 gccgccgccgccgctgctgctgttgctgctgct 137
>ref|XM_985819.1| PREDICTED: Mus musculus similar to neuregulin 1 isoform GGF2 (LOC675891), mRNA Length = 1200 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||||| |||||||| Sbjct: 105 gccgccgccgccgctgctgctgttgctgctgct 137
>ref|XM_984911.1| PREDICTED: Mus musculus similar to neuregulin 1 isoform GGF2 (LOC666606), mRNA Length = 1029 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||||| |||||||| Sbjct: 105 gccgccgccgccgctgctgctgttgctgctgct 137
>emb|CT025301.2| Xenopus tropicalis finished cDNA, clone TNeu074e23 Length = 2755 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgctactg 177 ||||||||||||||||||||||||| Sbjct: 388 gctgccgccgccgccgctgctactg 364
>gb|U17694.1|CHU17694 Capra hircus N-acetylglucosamine 6-sulfatase mRNA, complete cds Length = 2499 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgctaggt 192 |||||||||||||||||| ||| | |||||||||||| Sbjct: 99 gccgccgccgccgctgcttctgctgctgctgctaggt 135
>gb|DQ205647.1| Eimeria tenella calmodulin-like domain protein kinase isoform 2 mRNA, complete cds Length = 2187 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgctactgttactgctgct 188 ||||||||||||||||||||| ||| | |||||||| Sbjct: 346 gctgccgccgccgccgctgctgctgctgctgctgct 381
>ref|XM_597482.2| PREDICTED: Bos taurus similar to immunoglobulin superfamily, member 8 (LOC519266), mRNA Length = 2312 Score = 48.1 bits (24), Expect = 0.026 Identities = 30/32 (93%) Strand = Plus / Plus Query: 155 tgccgccgccgccgctgctactgttactgctg 186 ||||||||||||||||||| |||||| ||||| Sbjct: 23 tgccgccgccgccgctgctgctgttaatgctg 54
>ref|NM_002968.1| Homo sapiens sal-like 1 (Drosophila) (SALL1), mRNA Length = 4668 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgctactgttactgctgct 188 ||||||||||||||||||||| ||| | |||||||| Sbjct: 492 gctgccgccgccgccgctgctgctgctgctgctgct 457
>emb|Y18265.1|HSY18265 Homo sapiens mRNA for zinc finger protein SALL1 Length = 4668 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgctactgttactgctgct 188 ||||||||||||||||||||| ||| | |||||||| Sbjct: 492 gctgccgccgccgccgctgctgctgctgctgctgct 457
>gb|AC009166.4| Homo sapiens chromosome 16 clone RP11-80B1, complete sequence Length = 174550 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgctactgttactgctgct 188 ||||||||||||||||||||| ||| | |||||||| Sbjct: 90431 gctgccgccgccgccgctgctgctgctgctgctgct 90396
>emb|BX931265.2| Gallus gallus finished cDNA, clone ChEST262j19 Length = 956 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Minus Query: 165 gccgctgctactgttactgctgct 188 |||||||||||||||||||||||| Sbjct: 78 gccgctgctactgttactgctgct 55
>gb|AC007498.7| Homo sapiens chromosome 16 clone RP11-424K7, complete sequence Length = 176248 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgctactgttactgctgct 188 ||||||||||||||||||||| ||| | |||||||| Sbjct: 61083 gctgccgccgccgccgctgctgctgctgctgctgct 61048
>emb|X98833.1|HSZPHSAL1 Homo sapiens SALL1 gene, exon 2-3, partial Length = 5914 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgctactgttactgctgct 188 ||||||||||||||||||||| ||| | |||||||| Sbjct: 599 gctgccgccgccgccgctgctgctgctgctgctgct 564
>gb|BC025223.1| Mus musculus RIKEN cDNA 9630044O09 gene, mRNA (cDNA clone MGC:32254 IMAGE:5010865), complete cds Length = 1213 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgctac 175 ||||||||||||||||||||||| Sbjct: 763 gctgccgccgccgccgctgctac 741
>gb|AC118414.9| Rattus norvegicus 3 BAC CH230-223K21 (Children's Hospital Oakland Research Institute) complete sequence Length = 217330 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 151 cggctgccgccgccgccgctgct 173 ||||||||||||||||||||||| Sbjct: 204489 cggctgccgccgccgccgctgct 204511
>ref|XM_955472.1| Neurospora crassa OR74A hypothetical protein (NCU05603.1) partial mRNA Length = 3201 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 154 ctgccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||||| ||| | |||||||| Sbjct: 3048 ctgccgccgccgccgctgctgctgctgctgctgct 3014
>ref|XM_325457.1| Neurospora crassa OR74A hypothetical protein (NCU05603.1) partial mRNA Length = 3201 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 154 ctgccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||||| ||| | |||||||| Sbjct: 3048 ctgccgccgccgccgctgctgctgctgctgctgct 3014
>ref|XM_502152.1| Yarrowia lipolytica CLIB122, YALI0C22770g predicted mRNA Length = 2766 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgctac 175 ||||||||||||||||||||||| Sbjct: 1786 gctgccgccgccgccgctgctac 1808
>ref|NM_058170.1| Homo sapiens olfactomedin 3 (OLFM3), mRNA Length = 3231 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Plus Query: 151 cggctgccgccgccgccgctgctactgttactgct 185 ||||||||||||| ||||||||| |||||| |||| Sbjct: 5 cggctgccgccgctgccgctgctgctgttattgct 39
>gb|BC022531.1| Homo sapiens olfactomedin 3, mRNA (cDNA clone MGC:26675 IMAGE:4812035), complete cds Length = 3231 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Plus Query: 151 cggctgccgccgccgccgctgctactgttactgct 185 ||||||||||||| ||||||||| |||||| |||| Sbjct: 5 cggctgccgccgctgccgctgctgctgttattgct 39
>dbj|AK095724.1| Homo sapiens cDNA FLJ38405 fis, clone FEBRA2008662, moderately similar to NEURONAL OLFACTOMEDIN-RELATED ER LOCALIZED PROTEIN PRECURSOR Length = 2257 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Plus Query: 151 cggctgccgccgccgccgctgctactgttactgct 185 ||||||||||||| ||||||||| |||||| |||| Sbjct: 43 cggctgccgccgctgccgctgctgctgttattgct 77
>gb|AF233061.1|AF233061 Yarrowia lipolytica protein kinase (CLA4) gene, complete cds Length = 4738 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgctac 175 ||||||||||||||||||||||| Sbjct: 2513 gctgccgccgccgccgctgctac 2535
>tpg|BK001429.1| TPA: TPA_exp: Homo sapiens NOELIN3 (OLFM3) gene, complete cds; alternatively spliced Length = 195421 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Plus Query: 151 cggctgccgccgccgccgctgctactgttactgct 185 ||||||||||||| ||||||||| |||||| |||| Sbjct: 918 cggctgccgccgctgccgctgctgctgttattgct 952
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 347 ggcggccatggcaatggcggcgg 369 ||||||||||||||||||||||| Sbjct: 869233 ggcggccatggcaatggcggcgg 869255
>dbj|AP002819.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0501G01 Length = 154561 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 159 gccgccgccgctgctactgttactgctgcta 189 ||||||||||||||| ||||| ||||||||| Sbjct: 39699 gccgccgccgctgctgctgttgctgctgcta 39669
>gb|BC091394.1| Rattus norvegicus RNA-binding region (RNP1, RRM) containing 2, mRNA (cDNA clone MGC:109490 IMAGE:7322533), complete cds Length = 2041 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgct 173 ||||||||||||||||||||||| Sbjct: 199 cggctgccgccgccgccgctgct 177
>gb|BC078917.1| Rattus norvegicus RNA-binding region (RNP1, RRM) containing 2, mRNA (cDNA clone IMAGE:7096440) Length = 2798 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgct 173 ||||||||||||||||||||||| Sbjct: 210 cggctgccgccgccgccgctgct 188
>emb|AL356280.21| Human DNA sequence from clone RP11-82O2 on chromosome 1 Contains the 5' end of the OLFM3 gene for olfactomedin 3 and a DNAJ family pseudogene, complete sequence Length = 173251 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgctactgttactgct 185 ||||||||||||| ||||||||| |||||| |||| Sbjct: 150604 cggctgccgccgctgccgctgctgctgttattgct 150570
>ref|NM_001013207.1| Rattus norvegicus RNA-binding region (RNP1, RRM) containing 2 (Rnpc2), mRNA Length = 2041 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgct 173 ||||||||||||||||||||||| Sbjct: 199 cggctgccgccgccgccgctgct 177
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica Length = 3272609 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgctac 175 ||||||||||||||||||||||| Sbjct: 3052374 gctgccgccgccgccgctgctac 3052352
>ref|XM_510935.1| PREDICTED: Pan troglodytes similar to Phosphorylase B kinase gamma catalytic chain, testis/liver isoform (PHK-gamma-T) (Phosphorylase kinase gamma subunit 2) (PSK-C3) (LOC454052), mRNA Length = 3816 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 972 ggctgccgccgccgccgctgct 993
>ref|XM_479790.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2049 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 1941 ggctgccgccgccgccgctgct 1962
>ref|NM_191423.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 630 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 tgccggctgccgccgccgccgc 169 |||||||||||||||||||||| Sbjct: 220 tgccggctgccgccgccgccgc 199
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Plus Query: 345 acggcggccatggcaatggcggcgga 370 |||||||||||||||| ||||||||| Sbjct: 2340547 acggcggccatggcaacggcggcgga 2340572 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 345 acggcggccatggcaatggcggcgg 369 |||||||||| |||||||||||||| Sbjct: 2340637 acggcggccacggcaatggcggcgg 2340661
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 345 acggcggccatggcaatggcggcgga 370 |||||||||||||||| ||||||||| Sbjct: 1155345 acggcggccatggcaacggcggcgga 1155320 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 345 acggcggccatggcaatggcggcgg 369 |||||||||| |||||||||||||| Sbjct: 1155255 acggcggccacggcaatggcggcgg 1155231
>gb|AC131656.3| Mus musculus BAC clone RP23-233K19 from chromosome 17, complete sequence Length = 184763 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 148 tgccggctgccgccgccgccgctgct 173 |||| ||||||||||||||||||||| Sbjct: 144872 tgcctgctgccgccgccgccgctgct 144847
>gb|BC060848.1| Homo sapiens midnolin, mRNA (cDNA clone IMAGE:30347756), partial cds Length = 3639 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgctactg 177 ||||||||||||| |||||||||||| Sbjct: 1721 ggctgccgccgcccccgctgctactg 1696
>ref|XR_002257.1| PREDICTED: Mus musculus similar to ribosomal protein L31 (LOC668832), mRNA Length = 946 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Plus Query: 148 tgccggctgccgccgccgccgctgct 173 |||| ||||||||||||||||||||| Sbjct: 680 tgcctgctgccgccgccgccgctgct 705
>gb|BC015089.2| Homo sapiens midnolin, mRNA (cDNA clone IMAGE:3958934), partial cds Length = 2425 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgctactg 177 ||||||||||||| |||||||||||| Sbjct: 431 ggctgccgccgcccccgctgctactg 406
>ref|XM_756466.1| Ustilago maydis 521 hypothetical protein (UM05412.1) partial mRNA Length = 1320 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Plus Query: 155 tgccgccgccgccgctgctactgttactgctgct 188 ||||||||||||||||||| ||| ||| |||||| Sbjct: 51 tgccgccgccgccgctgctgctgctaccgctgct 84
>gb|AC130215.3| Mus musculus BAC clone RP23-286E1 from 6, complete sequence Length = 168515 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 15600 cggctgccgccgccgccgctgc 15579
>emb|BX070319.1|CNS09QF7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 849 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 306 ggctgccgccgccgccgctgct 327
>emb|BX057772.1|CNS09GQO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 805 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 299 ggctgccgccgccgccgctgct 278
>emb|BX057771.1|CNS09GQN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 616 ggctgccgccgccgccgctgct 637
>emb|BX056851.1|CNS09G13 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 415 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 298 ggctgccgccgccgccgctgct 319
>emb|BX051342.1|CNS09BS2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC28CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 505 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 314 ggctgccgccgccgccgctgct 293
>emb|BX044800.1|CNS096QC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC18CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 371 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 304 ggctgccgccgccgccgctgct 283
>emb|BX041788.1|CNS094EO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC13BG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 452 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 309 ggctgccgccgccgccgctgct 288
>emb|BX040939.1|CNS093R3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC12AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 313 ggctgccgccgccgccgctgct 292
>emb|BX040435.1|CNS093D3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC11BB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 502 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 280 ggctgccgccgccgccgctgct 259
>emb|BX036297.1|CNS09065 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA8AD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 465 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 320 ggctgccgccgccgccgctgct 299
>emb|BX034675.1|CNS08YX3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50CG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 439 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 275 ggctgccgccgccgccgctgct 254
>emb|BX034934.1|CNS08Z4A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 853 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 750 ggctgccgccgccgccgctgct 771
>emb|BX033937.1|CNS08YCL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 313 ggctgccgccgccgccgctgct 292
>emb|BX030467.1|CNS08VO7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA45BH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 321 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 296 ggctgccgccgccgccgctgct 275
>emb|BX030105.1|CNS08VE5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44DH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 311 ggctgccgccgccgccgctgct 290
>emb|BX022368.1|CNS08PF8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 834 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 333 ggctgccgccgccgccgctgct 312
>emb|BX022756.1|CNS08PQ0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 445 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 298 ggctgccgccgccgccgctgct 277
>emb|BX022547.1|CNS08PK7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 477 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 295 ggctgccgccgccgccgctgct 274
>emb|BX022149.1|CNS08P95 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA32DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1020 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 923 ggctgccgccgccgccgctgct 944
>emb|BX020403.1|CNS08NWN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA30AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 448 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 303 ggctgccgccgccgccgctgct 282
>emb|BX017509.1|CNS08LO9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA26BH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 467 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 325 ggctgccgccgccgccgctgct 304
>emb|BX008450.1|CNS08EOM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA13DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 291 ggctgccgccgccgccgctgct 270
>emb|BX572604.1| Rhodopseudomonas palustris CGA009 complete genome; segment 12/16 Length = 348068 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 149 gccggctgccgccgccgccgct 170 |||||||||||||||||||||| Sbjct: 55512 gccggctgccgccgccgccgct 55491
>gb|BC094778.1| Homo sapiens midnolin, mRNA (cDNA clone MGC:104683 IMAGE:30342357), complete cds Length = 3354 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgctactg 177 ||||||||||||| |||||||||||| Sbjct: 1721 ggctgccgccgcccccgctgctactg 1696
>emb|AL512725.1|HSM802856 Homo sapiens genomic DNA; cDNA DKFZp547M072 (from clone DKFZp547M072) Length = 2791 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgctactg 177 ||||||||||||| |||||||||||| Sbjct: 1133 ggctgccgccgcccccgctgctactg 1108
>gb|AY118518.1| Drosophila melanogaster LD16638 full insert cDNA Length = 3458 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 431 cggctgccgccgccgccgctgc 410
>gb|AC010047.8| Drosophila melanogaster 3L BAC RP98-28E17 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 164201 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 76454 cggctgccgccgccgccgctgc 76433
>ref|NM_206270.1| Drosophila melanogaster encore CG10847-RA, transcript variant A (enc), mRNA Length = 7249 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 4272 cggctgccgccgccgccgctgc 4251
>ref|NM_080026.2| Drosophila melanogaster encore CG10847-RB, transcript variant B (enc), mRNA Length = 7234 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 4257 cggctgccgccgccgccgctgc 4236
>dbj|AK143969.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:F530008N18 product:Wiskott-Aldrich syndrome-like (human), full insert sequence Length = 4306 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 14 cggctgccgccgccgccgctgc 35
>dbj|AK144789.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730034O06 product:Wiskott-Aldrich syndrome-like (human), full insert sequence Length = 874 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 9 cggctgccgccgccgccgctgc 30
>dbj|AK014104.1| Mus musculus 13 days embryo head cDNA, RIKEN full-length enriched library, clone:3110031I02 product:similar to N-WASP PROTEIN [Mus musculus], full insert sequence Length = 1298 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 27 cggctgccgccgccgccgctgc 48
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 945853 ggctgccgccgccgccgctgct 945874 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 149 gccggctgccgccgccgccgc 169 ||||||||||||||||||||| Sbjct: 20577511 gccggctgccgccgccgccgc 20577531 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 150 ccggctgccgccgccgccgc 169 |||||||||||||||||||| Sbjct: 21273685 ccggctgccgccgccgccgc 21273666
>gb|AF305070.2|AF305070 Chlamydomonas reinhardtii DEAH-box RNA helicase (Mut6) mRNA, complete cds Length = 4299 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 156 gccgccgccgccgctgctactg 177 |||||||||||||||||||||| Sbjct: 819 gccgccgccgccgctgctactg 798
>gb|AC156446.2| Volvox carteri clone JGIAOBO-29H23, complete sequence Length = 31927 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 157 ccgccgccgccgctgctactgttactgctg 186 ||||||| ||||||||||||| |||||||| Sbjct: 19013 ccgccgctgccgctgctactgctactgctg 18984
>ref|NM_177401.4| Homo sapiens midnolin (MIDN), mRNA Length = 3812 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgctactg 177 ||||||||||||| |||||||||||| Sbjct: 1827 ggctgccgccgcccccgctgctactg 1802
>gb|AC004221.2|AC004221 Homo sapiens DNA from chromosome 19, cosmid R29144 (LLNLR-252D12) and overlapping PCR product, complete sequence Length = 42805 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgctactg 177 ||||||||||||| |||||||||||| Sbjct: 31948 ggctgccgccgcccccgctgctactg 31923
>gb|AC156445.2| Volvox carteri clone JGIAOBO-25P15, complete sequence Length = 31713 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 156 gccgccgccgccgctgctactg 177 |||||||||||||||||||||| Sbjct: 19049 gccgccgccgccgctgctactg 19028
>dbj|AP003295.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0695H10 Length = 136883 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 148 tgccggctgccgccgccgccgc 169 |||||||||||||||||||||| Sbjct: 3594 tgccggctgccgccgccgccgc 3615
>gb|AF243382.1|AF243382 Drosophila melanogaster cytoplasmic protein encore (enc) mRNA, complete cds Length = 6858 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 4251 cggctgccgccgccgccgctgc 4230
>dbj|AP004562.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0470F10 Length = 185294 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgct 173 |||||||||||||||||||||| Sbjct: 108591 ggctgccgccgccgccgctgct 108612
>gb|BC058642.1| Mus musculus Wiskott-Aldrich syndrome-like (human), mRNA (cDNA clone IMAGE:6405128), partial cds Length = 919 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 33 cggctgccgccgccgccgctgc 54
>gb|BT021245.1| Drosophila melanogaster RE64082 full insert cDNA Length = 7282 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 4263 cggctgccgccgccgccgctgc 4242
>dbj|AK062308.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-101-B02, full insert sequence Length = 597 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 tgccggctgccgccgccgccgc 169 |||||||||||||||||||||| Sbjct: 166 tgccggctgccgccgccgccgc 145
>gb|AC153635.4| Mus musculus 6 BAC RP23-392I2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 189373 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 13556 cggctgccgccgccgccgctgc 13577
>emb|Y13036.1|RNY13036 Rattus norvegicus ncx1 gene, exon 1a, 1b and 1c Length = 3544 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Plus Query: 148 tgccggctgccgccgccgccgctgct 173 |||| ||||||||||||||||||||| Sbjct: 2978 tgcctgctgccgccgccgccgctgct 3003
>gb|AE003479.3| Drosophila melanogaster chromosome 3L, section 13 of 83 of the complete sequence Length = 309958 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 152080 cggctgccgccgccgccgctgc 152059
>ref|NM_028459.1| Mus musculus Wiskott-Aldrich syndrome-like (human) (Wasl), mRNA Length = 4325 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 9 cggctgccgccgccgccgctgc 30
>gb|U95138.1|RNU95138 Rattus norvegicus Na+-Ca+ exchanger (NCX1) gene, exon 1-Kc and exon 1-Br Length = 3301 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Plus Query: 148 tgccggctgccgccgccgccgctgct 173 |||| ||||||||||||||||||||| Sbjct: 3032 tgcctgctgccgccgccgccgctgct 3057
>gb|BC055045.1| Mus musculus Wiskott-Aldrich syndrome-like (human), mRNA (cDNA clone MGC:62799 IMAGE:6489610), complete cds Length = 4325 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 151 cggctgccgccgccgccgctgc 172 |||||||||||||||||||||| Sbjct: 9 cggctgccgccgccgccgctgc 30
>emb|BX088552.1|CNS09S4T Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6) clone CITB-248O2 of library Caltech CITB-BAC from chromosome 11 of Mus musculus (mouse) Length = 190320 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 158 cgccgccgccgctgctactgttactgctgc 187 |||||||||||| ||||||| ||||||||| Sbjct: 91430 cgccgccgccgccgctactgctactgctgc 91401
>gb|BC086481.1| Mus musculus putative neuronal cell adhesion molecule, mRNA (cDNA clone MGC:103399 IMAGE:6505546), complete cds Length = 3140 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||| ||| ||||| |||||||| Sbjct: 288 gccgccgccgccgccgctgctgttgctgctgct 320
>ref|XM_466052.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2352 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 357 gctgccgccgccgccgctgct 337
>ref|XM_466504.1| Oryza sativa (japonica cultivar-group), mRNA Length = 858 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 149 gccggctgccgccgccgccgc 169 ||||||||||||||||||||| Sbjct: 39 gccggctgccgccgccgccgc 19
>ref|XM_527451.1| PREDICTED: Pan troglodytes similar to Serine/threonine-protein kinase 17A (DAP kinase-related apoptosis-inducing protein kinase 1) (LOC472072), mRNA Length = 1272 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 gtgccggctgccgccgccgcc 167 ||||||||||||||||||||| Sbjct: 342 gtgccggctgccgccgccgcc 362
>ref|XM_517882.1| PREDICTED: Pan troglodytes similar to small conductance calcium-activated potassium channel protein 2 isoform a; apamin-sensitive small-conductance Ca2+-activated potassium channel (LOC462006), mRNA Length = 2181 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 589 gctgccgccgccgccgctgct 609
>ref|NM_191401.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 561 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 492 gctgccgccgccgccgctgct 472
>ref|NM_193333.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1074 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 789 gctgccgccgccgccgctgct 809
>ref|NM_018715.1| Homo sapiens regulator of chromosome condensation 2 (RCC2), mRNA Length = 4114 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgctactg 177 |||||||||||||| |||||||||| Sbjct: 385 gctgccgccgccgctgctgctactg 361
>ref|XM_513117.1| PREDICTED: Pan troglodytes similar to RCC1-like (LOC456531), mRNA Length = 1986 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgctactg 177 |||||||||||||| |||||||||| Sbjct: 309 gctgccgccgccgctgctgctactg 285
>gb|BC042067.1| Homo sapiens IQ motif and Sec7 domain 3, mRNA (cDNA clone IMAGE:5729820) Length = 1168 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 148 tgccggctgccgccgccgccgctgc 172 ||||||||||| ||||||||||||| Sbjct: 543 tgccggctgccaccgccgccgctgc 519
>gb|AC144742.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0052F16, complete sequence Length = 162082 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgc 172 ||||||||||||||||||||| Sbjct: 118344 ggctgccgccgccgccgctgc 118324
>gb|BT019686.1| Synthetic construct Homo sapiens insulin-like growth factor binding protein 2, 36kDa mRNA, partial cds Length = 987 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 33 gctgccgccgccgccgctgct 53
>ref|NM_008988.1| Mus musculus putative neuronal cell adhesion molecule (Punc), mRNA Length = 3146 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||| ||| ||||| |||||||| Sbjct: 304 gccgccgccgccgccgctgctgttgctgctgct 336
>gb|CP000081.1| Leishmania major chromosome 35, complete sequence Length = 2090491 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 gtgccggctgccgccgccgcc 167 ||||||||||||||||||||| Sbjct: 409323 gtgccggctgccgccgccgcc 409303
>gb|U92992.1|HSU92992 Homo sapiens clone DT1P1A11 mRNA, CAG repeat region Length = 1225 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 51 gctgccgccgccgccgctgct 31
>gb|AC138005.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0038O16, complete sequence Length = 37350 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 25291 gctgccgccgccgccgctgct 25271
>gb|AC138002.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0011I07 map S10207, complete sequence Length = 123847 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 122675 gctgccgccgccgccgctgct 122655
>gb|BC092223.1| Mus musculus cDNA sequence BC036313, mRNA (cDNA clone IMAGE:6854578), with apparent retained intron Length = 4877 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 62 gctgccgccgccgccgctgct 42
>gb|AC091724.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0004E08, complete sequence Length = 158294 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 115764 gctgccgccgccgccgctgct 115784
>gb|AC147460.1| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNAb0050G15, complete sequence Length = 126156 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 108020 gctgccgccgccgccgctgct 108000
>gb|AC007890.6| Drosophila melanogaster clone BACR02G21, complete sequence Length = 171563 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 100903 gctgccgccgccgccgctgct 100923
>gb|BT015211.1| Drosophila melanogaster RE48574 full insert cDNA Length = 4276 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 3559 gctgccgccgccgccgctgct 3539
>ref|XM_873521.1| PREDICTED: Bos taurus similar to N-acetylglucosamine-6-sulfatase precursor (G6S) (Glucosamine-6-sulfatase), transcript variant 2 (LOC512444), mRNA Length = 4250 Score = 42.1 bits (21), Expect = 1.6 Identities = 33/37 (89%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgctaggt 192 ||||||||||| |||||| ||| | |||||||||||| Sbjct: 84 gccgccgccgctgctgctgctgctgctgctgctaggt 120 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||| | |||||||| Sbjct: 81 gccgccgccgccgctgctgctgctgctgctgct 113
>ref|XM_589961.2| PREDICTED: Bos taurus similar to N-acetylglucosamine-6-sulfatase precursor (G6S) (Glucosamine-6-sulfatase), transcript variant 1 (LOC512444), mRNA Length = 4247 Score = 42.1 bits (21), Expect = 1.6 Identities = 33/37 (89%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgctaggt 192 ||||||||||| |||||| ||| | |||||||||||| Sbjct: 84 gccgccgccgctgctgctgctgctgctgctgctaggt 120 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||| | |||||||| Sbjct: 81 gccgccgccgccgctgctgctgctgctgctgct 113
>ref|XM_359815.1| Magnaporthe grisea 70-15 hypothetical protein (MG04962.4) partial mRNA Length = 1917 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 303 aggagccgcgtgacgggcccg 323 ||||||||||||||||||||| Sbjct: 1391 aggagccgcgtgacgggcccg 1371
>gb|AC148870.2| Chlamydomonas reinhardtii clone cr-13O11, complete sequence Length = 56858 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 50133 gctgccgccgccgccgctgct 50153
>ref|XM_413936.1| PREDICTED: Gallus gallus similar to transducin-like enhancer protein 3; transducin-like enhancer of split 3 (LOC415568), mRNA Length = 4668 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 3406 gctgccgccgccgccgctgct 3426
>ref|XM_881638.1| PREDICTED: Bos taurus similar to fibrosin 1, transcript variant 4 (LOC615050), mRNA Length = 2364 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgc 172 ||||||||||||||||||||| Sbjct: 1270 ggctgccgccgccgccgctgc 1290 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgc 172 |||||||||||||||||||| Sbjct: 1307 gctgccgccgccgccgctgc 1326
>ref|XM_881630.1| PREDICTED: Bos taurus similar to fibrosin 1, transcript variant 3 (LOC615050), mRNA Length = 1787 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgc 172 ||||||||||||||||||||| Sbjct: 693 ggctgccgccgccgccgctgc 713 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgc 172 |||||||||||||||||||| Sbjct: 730 gctgccgccgccgccgctgc 749
>ref|XM_881616.1| PREDICTED: Bos taurus similar to fibrosin 1, transcript variant 2 (LOC615050), mRNA Length = 2164 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgc 172 ||||||||||||||||||||| Sbjct: 1070 ggctgccgccgccgccgctgc 1090 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgc 172 |||||||||||||||||||| Sbjct: 1107 gctgccgccgccgccgctgc 1126
>ref|XM_868400.1| PREDICTED: Bos taurus similar to fibrosin 1, transcript variant 1 (LOC615050), mRNA Length = 2131 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgc 172 ||||||||||||||||||||| Sbjct: 1070 ggctgccgccgccgccgctgc 1090 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgc 172 |||||||||||||||||||| Sbjct: 1107 gctgccgccgccgccgctgc 1126
>ref|XM_363264.1| Magnaporthe grisea 70-15 hypothetical protein (MG01190.4) partial mRNA Length = 1260 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgc 172 ||||||||||||||||||||| Sbjct: 1123 ggctgccgccgccgccgctgc 1103
>ref|XM_584526.2| PREDICTED: Bos taurus similar to CG11136-PA (LOC507842), mRNA Length = 1147 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 ||||||||||||||||| ||| |||||||||| Sbjct: 190 gccgccgccgccgctgcagctgctactgctgct 222
>gb|BC004312.1| Homo sapiens insulin-like growth factor binding protein 2, 36kDa, mRNA (cDNA clone MGC:10918 IMAGE:3627826), complete cds Length = 1440 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 127 gctgccgccgccgccgctgct 147
>ref|XM_951659.1| Neurospora crassa OR74A hypothetical protein (NCU01475.1) partial mRNA Length = 1068 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||| | |||||||| Sbjct: 313 gccgccgccgccgctgctgctgctgctgctgct 281
>ref|XM_953520.1| Neurospora crassa OR74A hypothetical protein (NCU07568.1) partial mRNA Length = 1122 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgc 172 ||||||||||||||||||||| Sbjct: 600 ggctgccgccgccgccgctgc 580
>gb|BC004457.1| Homo sapiens ankyrin repeat and KH domain containing 1, transcript variant 3, mRNA (cDNA clone IMAGE:2819955), complete cds Length = 2139 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 291 gctgccgccgccgccgctgct 271
>gb|BC012769.1| Homo sapiens insulin-like growth factor binding protein 2, 36kDa, mRNA (cDNA clone MGC:16256 IMAGE:3689990), complete cds Length = 1428 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 127 gctgccgccgccgccgctgct 147
>gb|BC073215.1| Xenopus laevis cDNA clone MGC:80502 IMAGE:5156883, complete cds Length = 2487 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 689 gctgccgccgccgccgctgct 709
>ref|XM_327853.1| Neurospora crassa OR74A hypothetical protein (NCU07568.1) partial mRNA Length = 1122 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgc 172 ||||||||||||||||||||| Sbjct: 600 ggctgccgccgccgccgctgc 580
>ref|XM_327913.1| Neurospora crassa OR74A hypothetical protein (NCU01475.1) partial mRNA Length = 1068 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||| | |||||||| Sbjct: 313 gccgccgccgccgctgctgctgctgctgctgct 281
>ref|NM_000597.2| Homo sapiens insulin-like growth factor binding protein 2, 36kDa (IGFBP2), mRNA Length = 1439 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 153 gctgccgccgccgccgctgct 173
>gb|AC135430.2| Oryza sativa (japonica cultivar-group) chromosome 5 PAC clone P0671E09, complete sequence Length = 158472 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 155 tgccgccgccgccgctgctac 175 ||||||||||||||||||||| Sbjct: 100279 tgccgccgccgccgctgctac 100299
>gb|AC124417.5| Mus musculus BAC clone RP24-313G11 from chromosome 18, complete sequence Length = 181811 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 39677 gctgccgccgccgccgctgct 39657 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgc 172 |||||||||||||||||||| Sbjct: 39534 gctgccgccgccgccgctgc 39553
>gb|BC115990.1| Bos taurus cDNA clone MGC:137372 IMAGE:8173627, complete cds Length = 4346 Score = 42.1 bits (21), Expect = 1.6 Identities = 33/37 (89%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgctaggt 192 ||||||||||| |||||| ||| | |||||||||||| Sbjct: 164 gccgccgccgctgctgctgctgctgctgctgctaggt 200 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||| | |||||||| Sbjct: 161 gccgccgccgccgctgctgctgctgctgctgct 193
>ref|NM_198187.2| Homo sapiens astrotactin 2 (ASTN2), transcript variant 3, mRNA Length = 4768 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 224 gctgccgccgccgccgctgct 244
>ref|NM_198186.2| Homo sapiens astrotactin 2 (ASTN2), transcript variant 2, mRNA Length = 4756 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 224 gctgccgccgccgccgctgct 244
>ref|NM_014010.3| Homo sapiens astrotactin 2 (ASTN2), transcript variant 1, mRNA Length = 4606 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 224 gctgccgccgccgccgctgct 244
>gb|BC065378.1| Homo sapiens serine/threonine kinase 24 (STE20 homolog, yeast), transcript variant 2, mRNA (cDNA clone MGC:71165 IMAGE:6598075), complete cds Length = 2636 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 154 ctgccgccgccgccgctgctactgttactgctg 186 |||||||||||||||||||| | | |||||||| Sbjct: 73 ctgccgccgccgccgctgctgccgctactgctg 41
>gb|BC035578.1| Homo sapiens serine/threonine kinase 24 (STE20 homolog, yeast), transcript variant 2, mRNA (cDNA clone MGC:45338 IMAGE:5539375), complete cds Length = 2640 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 154 ctgccgccgccgccgctgctactgttactgctg 186 |||||||||||||||||||| | | |||||||| Sbjct: 77 ctgccgccgccgccgctgctgccgctactgctg 45
>gb|AY438141.1| Drosophila melanogaster isolate sonoma_isoline_119 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438140.1| Drosophila melanogaster isolate sonoma_isoline_117 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438139.1| Drosophila melanogaster isolate sonoma_isoline_107 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438138.1| Drosophila melanogaster isolate sonoma_isoline_106 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438137.1| Drosophila melanogaster isolate sonoma_isoline_094 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438136.1| Drosophila melanogaster isolate sonoma_isoline_087 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438135.1| Drosophila melanogaster isolate sonoma_isoline_086 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438134.1| Drosophila melanogaster isolate sonoma_isoline_085 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438133.1| Drosophila melanogaster isolate sonoma_isoline_081 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438132.1| Drosophila melanogaster isolate sonoma_isoline_074 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438131.1| Drosophila melanogaster isolate sonoma_isoline_073 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438130.1| Drosophila melanogaster isolate sonoma_isoline_064 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438129.1| Drosophila melanogaster isolate sonoma_isoline_061 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438128.1| Drosophila melanogaster isolate sonoma_isoline_059 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438127.1| Drosophila melanogaster isolate sonoma_isoline_055 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438126.1| Drosophila melanogaster isolate sonoma_isoline_054 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438125.1| Drosophila melanogaster isolate sonoma_isoline_053 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438124.1| Drosophila melanogaster isolate sonoma_isoline_048 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438123.1| Drosophila melanogaster isolate sonoma_isoline_045 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438122.1| Drosophila melanogaster isolate sonoma_isoline_040 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438121.1| Drosophila melanogaster isolate sonoma_isoline_038 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438120.1| Drosophila melanogaster isolate sonoma_isoline_036 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438119.1| Drosophila melanogaster isolate sonoma_isoline_034 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438118.1| Drosophila melanogaster isolate sonoma_isoline_033 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438117.1| Drosophila melanogaster isolate sonoma_isoline_032 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438116.1| Drosophila melanogaster isolate sonoma_isoline_024 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438115.1| Drosophila melanogaster isolate sonoma_isoline_023 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438114.1| Drosophila melanogaster isolate sonoma_isoline_022 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438113.1| Drosophila melanogaster isolate sonoma_isoline_016 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438112.1| Drosophila melanogaster isolate sonoma_isoline_014 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438111.1| Drosophila melanogaster isolate sonoma_isoline_013 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438110.1| Drosophila melanogaster isolate sonoma_isoline_008 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438109.1| Drosophila melanogaster isolate sonoma_isoline_007 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438108.1| Drosophila melanogaster isolate sonoma_isoline_006 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438107.1| Drosophila melanogaster isolate sonoma_isoline_005 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438106.1| Drosophila melanogaster isolate sonoma_isoline_004 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438105.1| Drosophila melanogaster isolate sonoma_isoline_003 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY438104.1| Drosophila melanogaster isolate sonoma_isoline_002 delta protein gene, exon 6 and partial cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 934 gctgccgccgccgccgctgct 914
>gb|AY437235.1|AY437230S6 Drosophila melanogaster isolate sonoma_isofemale_058 delta protein gene, exon 6 and complete cds Length = 3898 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1393 gctgccgccgccgccgctgct 1373
>gb|AY437229.1|AY437224S6 Drosophila melanogaster isolate sonoma_isofemale_116 delta protein gene, exon 6 and complete cds Length = 3897 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1393 gctgccgccgccgccgctgct 1373
>gb|AY437223.1|AY437218S6 Drosophila melanogaster isolate sonoma_isofemale_101 delta protein gene, exon 6 and complete cds Length = 3898 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1399 gctgccgccgccgccgctgct 1379
>gb|AY437217.1|AY437212S6 Drosophila melanogaster isolate sonoma_isofemale_111 delta protein gene, exon 6 and complete cds Length = 3900 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1393 gctgccgccgccgccgctgct 1373
>gb|AY437211.1|AY437206S6 Drosophila melanogaster isolate sonoma_isofemale_097 delta protein gene, exon 6 and complete cds Length = 3900 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1393 gctgccgccgccgccgctgct 1373
>gb|AY437205.1|AY437200S6 Drosophila melanogaster isolate sonoma_isofemale_095 delta protein gene, exon 6 and complete cds Length = 3897 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1393 gctgccgccgccgccgctgct 1373
>gb|AY437199.1|AY437194S6 Drosophila melanogaster isolate sonoma_isofemale_051 delta protein gene, exon 6 and complete cds Length = 3891 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1393 gctgccgccgccgccgctgct 1373
>gb|AY437193.1|AY437188S6 Drosophila melanogaster isolate sonoma_isofemale_050 delta protein gene, exon 6 and complete cds Length = 3897 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1399 gctgccgccgccgccgctgct 1379
>gb|AY437187.1|AY437182S6 Drosophila melanogaster isolate sonoma_isofemale_046 delta protein gene, exon 6 and complete cds Length = 3900 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1399 gctgccgccgccgccgctgct 1379
>gb|AY437181.1|AY437176S6 Drosophila melanogaster isolate sonoma_isofemale_039 delta protein gene, exon 6 and complete cds Length = 3904 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1399 gctgccgccgccgccgctgct 1379
>gb|AY437175.1|AY437170S6 Drosophila melanogaster isolate sonoma_isofemale_031 delta protein gene, exon 6 and complete cds Length = 3897 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1393 gctgccgccgccgccgctgct 1373
>gb|AY437169.1|AY437164S6 Drosophila melanogaster isolate sonoma_isofemale_019 delta protein gene, exon 6 and complete cds Length = 3891 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1393 gctgccgccgccgccgctgct 1373
>gb|AY437163.1|AY437158S6 Drosophila melanogaster isolate sonoma_isofemale_017 delta protein gene, exon 6 and complete cds Length = 3894 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1393 gctgccgccgccgccgctgct 1373
>gb|AY437157.1|AY437152S6 Drosophila melanogaster isolate sonoma_isofemale_010 delta protein gene, exon 6 and complete cds Length = 3897 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1393 gctgccgccgccgccgctgct 1373
>gb|AY437151.1|AY437146S6 Drosophila melanogaster isolate sonoma_isofemale_015 delta protein gene, exon 6 and complete cds Length = 3886 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1393 gctgccgccgccgccgctgct 1373
>gb|AY437145.1|AY437140S6 Drosophila melanogaster isolate sonoma_isofemale_009 delta protein gene, exon 6 and complete cds Length = 3892 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1393 gctgccgccgccgccgctgct 1373
>gb|AC110235.13| Mus musculus chromosome 9, clone RP23-100M12, complete sequence Length = 220755 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||| ||| ||||| |||||||| Sbjct: 24968 gccgccgccgccgccgctgctgttgctgctgct 25000
>gb|AC159002.2| Mus musculus BAC clone RP23-203D7 from chromosome 14, complete sequence Length = 181842 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 66811 gctgccgccgccgccgctgct 66831
>ref|XM_916661.2| PREDICTED: Mus musculus MYC-associated zinc finger protein (purine-binding transcription factor), transcript variant 5 (Maz), mRNA Length = 2709 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1706 gctgccgccgccgccgctgct 1686
>ref|XM_001001063.1| PREDICTED: Mus musculus carboxypeptidase D (Cpd), mRNA Length = 8701 Score = 42.1 bits (21), Expect = 1.6 Identities = 33/37 (89%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgctactgttactgctgcta 189 |||||||||||| |||||||| ||| | ||||||||| Sbjct: 54 gctgccgccgccaccgctgctgctgctgctgctgcta 90
>ref|XM_984835.1| PREDICTED: Mus musculus MYC-associated zinc finger protein (purine-binding transcription factor) (Maz), mRNA Length = 1690 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1414 gctgccgccgccgccgctgct 1394
>ref|XM_001002765.1| PREDICTED: Mus musculus MYC-associated zinc finger protein (purine-binding transcription factor) (Maz), mRNA Length = 2862 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1859 gctgccgccgccgccgctgct 1839
>ref|XM_543874.2| PREDICTED: Canis familiaris similar to synArfGEF (LOC486747), mRNA Length = 3612 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 148 tgccggctgccgccgccgccgctgc 172 ||||||||||| ||||||||||||| Sbjct: 724 tgccggctgccaccgccgccgctgc 700
>ref|XM_542944.2| PREDICTED: Canis familiaris similar to SRY-box containing gene 12 (LOC485820), mRNA Length = 1076 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 149 gccggctgccgccgccgccgc 169 ||||||||||||||||||||| Sbjct: 427 gccggctgccgccgccgccgc 407
>ref|XM_838107.1| Leishmania major strain Friedlin hypothetical protein (LMJ_1023) partial mRNA Length = 5637 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 gtgccggctgccgccgccgcc 167 ||||||||||||||||||||| Sbjct: 2085 gtgccggctgccgccgccgcc 2065
>gb|AF521883.1| Homo sapiens multiple ankyrin repeats single KH domain protein isoform 2 mRNA, complete cds, alternatively spliced Length = 8246 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 252 gctgccgccgccgccgctgct 232
>gb|AF521882.1| Homo sapiens multiple ankyrin repeats single KH domain protein isoform 1 mRNA, complete cds, alternatively spliced Length = 8120 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 252 gctgccgccgccgccgctgct 232
>ref|XM_542822.2| PREDICTED: Canis familiaris similar to procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 isoform b precursor (LOC485702), mRNA Length = 2438 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||| | |||||||| Sbjct: 30 gccgccgccgccgctgctgctgctgctgctgct 62
>ref|XM_751354.1| Ustilago maydis 521 hypothetical protein (UM00300.1) partial mRNA Length = 3360 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 337 gctgccgccgccgccgctgct 357
>ref|XM_752444.1| Ustilago maydis 521 hypothetical protein (UM01390.1) partial mRNA Length = 1554 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||| | |||||||| Sbjct: 772 gccgccgccgccgctgctgctgctgctgctgct 804 Score = 40.1 bits (20), Expect = 6.4 Identities = 32/36 (88%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgctactgttactgctgct 188 ||||||||||||||||| ||| ||| | |||||||| Sbjct: 766 gctgccgccgccgccgccgctgctgctgctgctgct 801
>ref|XM_744422.1| Aspergillus fumigatus Af293 allergen Asp F4 (Afu2g03830) partial mRNA Length = 969 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 152 ggctgccgccgccgccgctgctact 176 ||||||||||||||||||| ||||| Sbjct: 237 ggctgccgccgccgccgcttctact 261
>ref|XM_744558.1| Aspergillus fumigatus Af293 anaphase-promoting complex subunit ApcB (Afu2g05210) partial mRNA Length = 2685 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 152 ggctgccgccgccgccgctgc 172 ||||||||||||||||||||| Sbjct: 2448 ggctgccgccgccgccgctgc 2428
>ref|XM_800334.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053508213.30) partial mRNA Length = 840 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgctactg 177 |||||||||||||| |||||||||| Sbjct: 148 gctgccgccgccgctgctgctactg 172
>gb|AC122863.4| Mus musculus BAC clone RP23-142A14 from chromosome 7, complete sequence Length = 226601 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 163845 gctgccgccgccgccgctgct 163865
>ref|XM_806059.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053510073.70) partial mRNA Length = 1041 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 151 cggctgccgccgccgccgctgctactgtt 179 |||||||||||||||| |||||| ||||| Sbjct: 244 cggctgccgccgccgctgctgctgctgtt 216
>emb|CR937048.1|RN139I21 Rattus norvegicus chromosome 1 BAC CH230-139I21, complete sequence Length = 212885 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||| | |||||||| Sbjct: 72347 gccgccgccgccgctgctgctgctgctgctgct 72379
>gb|BC004758.1| Mus musculus MYC-associated zinc finger protein (purine-binding transcription factor), mRNA (cDNA clone IMAGE:3154686), containing frame-shift errors Length = 2152 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 1164 gctgccgccgccgccgctgct 1144
>ref|XM_547577.2| PREDICTED: Canis familiaris similar to Atrial natriuretic peptide receptor A precursor (ANP-A) (ANPRA) (GC-A) (Guanylate cyclase) (NPR-A) (Atrial natriuretic peptide A-type receptor) (LOC490455), mRNA Length = 3460 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||| | |||||||| Sbjct: 316 gccgccgccgccgctgctgctgctgctgctgct 348
>ref|XM_537042.2| PREDICTED: Canis familiaris similar to cadherin EGF LAG seven-pass G-type receptor 2, transcript variant 1 (LOC479916), mRNA Length = 10534 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||||||| ||| | |||||||| Sbjct: 87 gccgccgccgccgctgctgctgctgctgctgct 119
>emb|CR685205.2|CNS0FRNL Tetraodon nigroviridis full-length cDNA Length = 1950 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 149 gccggctgccgccgccgccgc 169 ||||||||||||||||||||| Sbjct: 1002 gccggctgccgccgccgccgc 982
>gb|BC053057.1| Mus musculus putative neuronal cell adhesion molecule, mRNA (cDNA clone MGC:62345 IMAGE:5698028), complete cds Length = 3198 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||| ||| ||||| |||||||| Sbjct: 281 gccgccgccgccgccgctgctgttgctgctgct 313
>gb|AY398667.1| Homo sapiens insulin-like growth factor binding protein 2, 36kDa (IGFBP2) gene, complete cds Length = 34956 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 2147 gctgccgccgccgccgctgct 2167
>ref|XM_851175.1| PREDICTED: Canis familiaris similar to Pro-neuregulin-2 precursor (Pro-NRG2), transcript variant 4 (LOC487158), mRNA Length = 2765 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 165 gctgccgccgccgccgctgct 145
>ref|XM_544286.2| PREDICTED: Canis familiaris similar to Pro-neuregulin-2 precursor (Pro-NRG2), transcript variant 1 (LOC487158), mRNA Length = 2747 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 165 gctgccgccgccgccgctgct 145
>ref|XM_843380.1| PREDICTED: Canis familiaris similar to Pro-neuregulin-2 precursor (Pro-NRG2), transcript variant 2 (LOC487158), mRNA Length = 2789 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 165 gctgccgccgccgccgctgct 145
>ref|XM_851046.1| PREDICTED: Canis familiaris similar to Pro-neuregulin-2 precursor (Pro-NRG2), transcript variant 3 (LOC487158), mRNA Length = 2771 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 165 gctgccgccgccgccgctgct 145
>gb|BT001713.1| Drosophila melanogaster RE67722 full insert cDNA Length = 3336 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 2361 gctgccgccgccgccgctgct 2341
>gb|AC161366.6| Mus musculus BAC clone RP24-230D17 from chromosome 9, complete sequence Length = 155733 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 |||||||||||||| ||| ||||| |||||||| Sbjct: 18999 gccgccgccgccgccgctgctgttgctgctgct 18967
>emb|CR759789.8| Zebrafish DNA sequence from clone CH211-153M1, complete sequence Length = 165831 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 169 ctgctactgttactgctgcta 189 ||||||||||||||||||||| Sbjct: 110842 ctgctactgttactgctgcta 110862
>ref|NM_019903.3| Homo sapiens adducin 3 (gamma) (ADD3), transcript variant 2, mRNA Length = 4195 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 35 gctgccgccgccgccgctgct 55
>emb|AL390252.9| Human DNA sequence from clone RP11-297O4 on chromosome 1 Contains the CELSR2 gene for cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila), the gene for differential display and activated by p53 (DDA3), the gene for novel protein similar to Myosin-binding protein H (MyBP-H) (H-protein) (LOC343263), the SORT1 gene for sortilin 1 and the 3' end of the PSMA5 gene for proteasome (prosome, macropain) subunit, alpha type, 5, complete sequence Length = 169241 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 156 gccgccgccgccgctgctactgttactgctgct 188 ||||||||||| |||||| ||||| |||||||| Sbjct: 3368 gccgccgccgctgctgctgctgttgctgctgct 3400
>emb|AL390056.7| Human DNA sequence from clone RP3-493I16 on chromosome 6 Contains the 5' end of the RAB3IP2 gene for RAB3 interacting protein 2 and a CpG island, complete sequence Length = 62390 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 25823 gctgccgccgccgccgctgct 25843
>emb|AL358792.24| Human DNA sequence from clone RP11-280M4 on chromosome 9 Contains the 5' end of the ASTN2 gene for astrotactin2 (KIAA0364) and a CpG island, complete sequence Length = 166931 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 gctgccgccgccgccgctgct 173 ||||||||||||||||||||| Sbjct: 126763 gctgccgccgccgccgctgct 126743
>emb|AL356423.15| Human DNA sequence from clone RP11-295B17 on chromosome 13 Contains the 5' end of the STK24 gene for serine/threonine kinase 24, a novel gene, a novel pseudogene, a cytochrome c pseudogene, a calmodulin 2 (CALM2) pseudogene and a CpG island, complete sequence Length = 174041 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 154 ctgccgccgccgccgctgctactgttactgctg 186 |||||||||||||||||||| | | |||||||| Sbjct: 78703 ctgccgccgccgccgctgctgccgctactgctg 78735 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,771,670 Number of Sequences: 3902068 Number of extensions: 3771670 Number of successful extensions: 245605 Number of sequences better than 10.0: 975 Number of HSP's better than 10.0 without gapping: 999 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 225275 Number of HSP's gapped (non-prelim): 19966 length of query: 472 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 450 effective length of database: 17,147,199,772 effective search space: 7716239897400 effective search space used: 7716239897400 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)