>gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete genome
          Length = 2056416

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 1      aaattcatccagcgagcgagggcgc 25
              |||||||||||||||||||||||||
Sbjct: 142852 aaattcatccagcgagcgagggcgc 142828

>ref|XM_474133.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1407

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 55  cccgatccgcttccgcccgtggccg 79
           |||||||||| ||||||||||||||
Sbjct: 387 cccgatccgcgtccgcccgtggccg 411

>ref|XM_549364.2| PREDICTED: Canis familiaris similar to Neural cell adhesion
           molecule L1 precursor (N-CAM L1) (CD171 antigen)
           (LOC492244), mRNA
          Length = 3771

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 101 actcgctgggcagcgaccggc 121
           |||||||||||||||||||||
Sbjct: 947 actcgctgggcagcgaccggc 967

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 55       cccgatccgcttccgcccgtggccg 79
                |||||||||| ||||||||||||||
Sbjct: 33173486 cccgatccgcgtccgcccgtggccg 33173462

>emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0212B02, complete
             sequence
          Length = 118971

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 55    cccgatccgcttccgcccgtggccg 79
             |||||||||| ||||||||||||||
Sbjct: 63965 cccgatccgcgtccgcccgtggccg 63941

>emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0059K02,
             complete sequence
          Length = 165745

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 55    cccgatccgcttccgcccgtggccg 79
             |||||||||| ||||||||||||||
Sbjct: 56135 cccgatccgcgtccgcccgtggccg 56111

>gb|CP000321.1| Nitrobacter hamburgensis X14 plasmid 2, complete sequence
          Length = 188318

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 10    cagcgagcgagggcgccctctccg 33
             ||||| ||||||||||||||||||
Sbjct: 85167 cagcgggcgagggcgccctctccg 85144

>gb|AE008921.2| Uncultured proteobacterium clone EBAC000-60D04 complete sequence
          Length = 103420

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    ccgatccgcttccgcccgtg 75
             ||||||||||||||||||||
Sbjct: 76242 ccgatccgcttccgcccgtg 76261

>emb|AL837515.9| Zebrafish DNA sequence from clone CH211-261F22 in linkage group 5,
              complete sequence
          Length = 153980

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 84     tttcctccccccgcttcact 103
              ||||||||||||||||||||
Sbjct: 151629 tttcctccccccgcttcact 151610


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,174,974
Number of Sequences: 3902068
Number of extensions: 1174974
Number of successful extensions: 33828
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33800
Number of HSP's gapped (non-prelim): 28
length of query: 250
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 228
effective length of database: 17,147,199,772
effective search space: 3909561548016
effective search space used: 3909561548016
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)