>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence
          Length = 574126

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 28     gaactcgccaccttccatga 47
              ||||||||||||||||||||
Sbjct: 142029 gaactcgccaccttccatga 142010

>ref|XM_981750.1| PREDICTED: Mus musculus hypothetical protein LOC544864 (LOC544864),
           mRNA
          Length = 3627

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 183 ggtctgaggagccgcgtgct 202
           ||||||||||||||||||||
Sbjct: 622 ggtctgaggagccgcgtgct 603

>ref|XM_974939.1| PREDICTED: Mus musculus hypothetical protein LOC544864 (LOC544864),
           mRNA
          Length = 3627

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 183 ggtctgaggagccgcgtgct 202
           ||||||||||||||||||||
Sbjct: 622 ggtctgaggagccgcgtgct 603

>dbj|AK172326.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830201G14 product:E3 ligase for inhibin
           receptor homolog [Homo sapiens], full insert sequence
          Length = 2282

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 183 ggtctgaggagccgcgtgct 202
           ||||||||||||||||||||
Sbjct: 86  ggtctgaggagccgcgtgct 105

>gb|AC157213.2| Mus musculus BAC clone RP23-157N5 from chromosome 12, complete sequence
          Length = 211304

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 183    ggtctgaggagccgcgtgct 202
              ||||||||||||||||||||
Sbjct: 133485 ggtctgaggagccgcgtgct 133504

>gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta H, complete genome
          Length = 1751377

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 68      agaataccgccacttccatg 87
               ||||||||||||||||||||
Sbjct: 1517330 agaataccgccacttccatg 1517349


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,061,016
Number of Sequences: 3902068
Number of extensions: 1061016
Number of successful extensions: 56467
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56442
Number of HSP's gapped (non-prelim): 25
length of query: 214
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 192
effective length of database: 17,147,199,772
effective search space: 3292262356224
effective search space used: 3292262356224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)