Clone Name | bastl43e02 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_469589.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2415 Score = 89.7 bits (45), Expect = 4e-15 Identities = 63/69 (91%) Strand = Plus / Plus Query: 210 gcagggcaacctcacctcgcgggcggatctcgcggggctctacacgctgcggggctcgct 269 |||||| |||||||| ||||||||||||||| ||||||||||| ||||||| |||||||| Sbjct: 102 gcaggggaacctcacgtcgcgggcggatctctcggggctctacgcgctgcgcggctcgct 161 Query: 270 ggggctgcg 278 |||||||| Sbjct: 162 cgggctgcg 170
>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map near C10769, complete sequence Length = 194856 Score = 89.7 bits (45), Expect = 4e-15 Identities = 63/69 (91%) Strand = Plus / Plus Query: 210 gcagggcaacctcacctcgcgggcggatctcgcggggctctacacgctgcggggctcgct 269 |||||| |||||||| ||||||||||||||| ||||||||||| ||||||| |||||||| Sbjct: 2597 gcaggggaacctcacgtcgcgggcggatctctcggggctctacgcgctgcgcggctcgct 2656 Query: 270 ggggctgcg 278 |||||||| Sbjct: 2657 cgggctgcg 2665 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Plus Query: 1 attgcttttaatttccctcccaattcc 27 ||||| ||||||||||||||||||||| Sbjct: 2347 attgcgtttaatttccctcccaattcc 2373
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 89.7 bits (45), Expect = 4e-15 Identities = 63/69 (91%) Strand = Plus / Minus Query: 210 gcagggcaacctcacctcgcgggcggatctcgcggggctctacacgctgcggggctcgct 269 |||||| |||||||| ||||||||||||||| ||||||||||| ||||||| |||||||| Sbjct: 29136694 gcaggggaacctcacgtcgcgggcggatctctcggggctctacgcgctgcgcggctcgct 29136635 Query: 270 ggggctgcg 278 |||||||| Sbjct: 29136634 cgggctgcg 29136626 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Minus Query: 1 attgcttttaatttccctcccaattcc 27 ||||| ||||||||||||||||||||| Sbjct: 29136944 attgcgtttaatttccctcccaattcc 29136918
>gb|AC137997.2| Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence Length = 91084 Score = 89.7 bits (45), Expect = 4e-15 Identities = 63/69 (91%) Strand = Plus / Plus Query: 210 gcagggcaacctcacctcgcgggcggatctcgcggggctctacacgctgcggggctcgct 269 |||||| |||||||| ||||||||||||||| ||||||||||| ||||||| |||||||| Sbjct: 34682 gcaggggaacctcacgtcgcgggcggatctctcggggctctacgcgctgcgcggctcgct 34741 Query: 270 ggggctgcg 278 |||||||| Sbjct: 34742 cgggctgcg 34750 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Plus Query: 1 attgcttttaatttccctcccaattcc 27 ||||| ||||||||||||||||||||| Sbjct: 34432 attgcgtttaatttccctcccaattcc 34458
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 89.7 bits (45), Expect = 4e-15 Identities = 63/69 (91%) Strand = Plus / Minus Query: 210 gcagggcaacctcacctcgcgggcggatctcgcggggctctacacgctgcggggctcgct 269 |||||| |||||||| ||||||||||||||| ||||||||||| ||||||| |||||||| Sbjct: 29228116 gcaggggaacctcacgtcgcgggcggatctctcggggctctacgcgctgcgcggctcgct 29228057 Query: 270 ggggctgcg 278 |||||||| Sbjct: 29228056 cgggctgcg 29228048 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Minus Query: 1 attgcttttaatttccctcccaattcc 27 ||||| ||||||||||||||||||||| Sbjct: 29228366 attgcgtttaatttccctcccaattcc 29228340
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 48.1 bits (24), Expect = 0.015 Identities = 24/24 (100%) Strand = Plus / Minus Query: 172 gcgctgctgctcgccgcgctggcg 195 |||||||||||||||||||||||| Sbjct: 1282462 gcgctgctgctcgccgcgctggcg 1282439 Score = 46.1 bits (23), Expect = 0.060 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 gcgctgctgctcgccgcgctggc 194 ||||||||||||||||||||||| Sbjct: 677051 gcgctgctgctcgccgcgctggc 677073 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 168 ggcggcgctgctgctcgccg 187 |||||||||||||||||||| Sbjct: 2262613 ggcggcgctgctgctcgccg 2262632
>ref|XM_464020.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1185 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Minus Query: 122 ggcggcggcgggagcaggcggtgatga 148 |||||||||||||| |||||||||||| Sbjct: 136 ggcggcggcgggagtaggcggtgatga 110
>emb|AL162502.17| Human DNA sequence from clone RP11-153G4 on chromosome 10 Contains the 5' end of the MLR2 gene for a novel protein (likely ortholog of mouse transcription factor MLR2), a high mobility group nucleosomal binding domain 4 (HMGN4)(NHC, HMG17L3, MGC5145) pseudogene and a CpG island, complete sequence Length = 163619 Score = 46.1 bits (23), Expect = 0.060 Identities = 23/23 (100%) Strand = Plus / Minus Query: 194 cgggggcggtgcgggggcagggc 216 ||||||||||||||||||||||| Sbjct: 58271 cgggggcggtgcgggggcagggc 58249
>gb|AC055874.8| Homo sapiens chromosome 15, clone RP11-489D6, complete sequence Length = 180647 Score = 46.1 bits (23), Expect = 0.060 Identities = 23/23 (100%) Strand = Plus / Plus Query: 189 gctggcgggggcggtgcgggggc 211 ||||||||||||||||||||||| Sbjct: 22400 gctggcgggggcggtgcgggggc 22422
>gb|AC067793.9| Homo sapiens chromosome 15, clone RP11-552D14, complete sequence Length = 189722 Score = 46.1 bits (23), Expect = 0.060 Identities = 23/23 (100%) Strand = Plus / Plus Query: 189 gctggcgggggcggtgcgggggc 211 ||||||||||||||||||||||| Sbjct: 175805 gctggcgggggcggtgcgggggc 175827
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Plus Query: 122 ggcggcggcgggagcaggcggtgatga 148 |||||||||||||| |||||||||||| Sbjct: 1720722 ggcggcggcgggagtaggcggtgatga 1720748 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Plus Query: 118 gagcggcggcggcgggagcaggcgg 142 |||||||||||||||||||| |||| Sbjct: 26942918 gagcggcggcggcgggagcaagcgg 26942942 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 168 ggcggcgctgctgctcgccgcgct 191 ||||||||||||||| |||||||| Sbjct: 30446455 ggcggcgctgctgctggccgcgct 30446478 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 20975265 gcggcggcggcgggagcagg 20975284 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 15309284 catggggagcggcggcggcg 15309303 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 117 ggagcggcggcggcgggagcaggc 140 |||||||||||||||| ||||||| Sbjct: 4353496 ggagcggcggcggcggcagcaggc 4353519 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 171 ggcgctgctgctcgccgcgc 190 |||||||||||||||||||| Sbjct: 778086 ggcgctgctgctcgccgcgc 778067
>dbj|AP004997.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0030G11 Length = 143943 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Plus Query: 122 ggcggcggcgggagcaggcggtgatga 148 |||||||||||||| |||||||||||| Sbjct: 38734 ggcggcggcgggagtaggcggtgatga 38760
>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence Length = 3363523 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 173 cgctgctgctcgccgcgctggc 194 |||||||||||||||||||||| Sbjct: 395097 cgctgctgctcgccgcgctggc 395076
>emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete genome; segment 11/29 Length = 313800 Score = 44.1 bits (22), Expect = 0.24 Identities = 28/30 (93%) Strand = Plus / Minus Query: 178 ctgctcgccgcgctggcgggggcggtgcgg 207 |||||||| ||| ||||||||||||||||| Sbjct: 29340 ctgctcgcagcggtggcgggggcggtgcgg 29311
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 44.1 bits (22), Expect = 0.24 Identities = 25/26 (96%) Strand = Plus / Minus Query: 171 ggcgctgctgctcgccgcgctggcgg 196 |||||||||| ||||||||||||||| Sbjct: 5134744 ggcgctgctgttcgccgcgctggcgg 5134719 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 168 ggcggcgctgctgctcgccg 187 |||||||||||||||||||| Sbjct: 2562479 ggcggcgctgctgctcgccg 2562498
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome Length = 3052398 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 176 tgctgctcgccgcgctggcggg 197 |||||||||||||||||||||| Sbjct: 2101578 tgctgctcgccgcgctggcggg 2101599 Score = 44.1 bits (22), Expect = 0.24 Identities = 25/26 (96%) Strand = Plus / Minus Query: 171 ggcgctgctgctcgccgcgctggcgg 196 ||||||||||||||| |||||||||| Sbjct: 1859025 ggcgctgctgctcgctgcgctggcgg 1859000
>gb|BC070482.1| Homo sapiens high-mobility group box 3, mRNA (cDNA clone MGC:90319 IMAGE:6140626), complete cds Length = 827 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcaggcggtg 144 ||||||||||||||||| ||||||| Sbjct: 27 gcggcggcggcgggagcgggcggtg 3
>ref|XM_472395.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1068 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 168 ggcggcgctgctgctcgccgc 188 ||||||||||||||||||||| Sbjct: 24 ggcggcgctgctgctcgccgc 44
>ref|NM_191735.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 3462 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Minus Query: 118 gagcggcggcggcgggagcaggcgg 142 |||||||||||||||||| |||||| Sbjct: 146 gagcggcggcggcgggaggaggcgg 122
>ref|XM_472659.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 636 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcaggc 140 ||||||||||||||||||||| Sbjct: 230 gcggcggcggcgggagcaggc 210
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctggcggg 197 ||||||||||||||||||| ||||| Sbjct: 361116 cgctgctgctcgccgcgctcgcggg 361140
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome Length = 3345170 Score = 42.1 bits (21), Expect = 0.93 Identities = 27/29 (93%) Strand = Plus / Plus Query: 167 gggcggcgctgctgctcgccgcgctggcg 195 ||||||||||||||||||| | ||||||| Sbjct: 2208402 gggcggcgctgctgctcgcggggctggcg 2208430 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 172 gcgctgctgctcgccgcgctggcg 195 ||||||||||||| |||||||||| Sbjct: 2062446 gcgctgctgctcggcgcgctggcg 2062423
>ref|XM_418849.1| PREDICTED: Gallus gallus similar to LSM5 homolog, U6 small nuclear RNA associated (LOC420751), mRNA Length = 1176 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 115 ggggagcggcggcggcgggag 135 ||||||||||||||||||||| Sbjct: 103 ggggagcggcggcggcgggag 123
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 172 gcgctgctgctcgccgcgctg 192 ||||||||||||||||||||| Sbjct: 2214490 gcgctgctgctcgccgcgctg 2214510 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctggcggg 197 ||||||||||||||||||| ||||| Sbjct: 1091748 cgctgctgctcgccgcgctcgcggg 1091772 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 172 gcgctgctgctcgccgcgct 191 |||||||||||||||||||| Sbjct: 989141 gcgctgctgctcgccgcgct 989122
>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence Length = 574126 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 171 ggcgctgctgctcgccgcgct 191 ||||||||||||||||||||| Sbjct: 65672 ggcgctgctgctcgccgcgct 65692
>ref|XM_978515.1| PREDICTED: Mus musculus hypothetical protein LOC670012 (LOC670012), mRNA Length = 2368 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 ggcggcggcgggagcaggcgg 142 ||||||||||||||||||||| Sbjct: 2364 ggcggcggcgggagcaggcgg 2344
>ref|XM_982805.1| PREDICTED: Mus musculus hypothetical protein LOC675527 (LOC675527), mRNA Length = 2368 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 ggcggcggcgggagcaggcgg 142 ||||||||||||||||||||| Sbjct: 2364 ggcggcggcgggagcaggcgg 2344
>gb|AC122022.4| Mus musculus BAC clone RP24-372J5 from chromosome 5, complete sequence Length = 174861 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcaggcggtg 144 ||||||||||||| ||||||||||| Sbjct: 78918 gcggcggcggcggcagcaggcggtg 78894
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 172 gcgctgctgctcgccgcgctg 192 ||||||||||||||||||||| Sbjct: 2160162 gcgctgctgctcgccgcgctg 2160142 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctggcggg 197 ||||||||||||||||||| ||||| Sbjct: 972730 cgctgctgctcgccgcgctcgcggg 972754 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 172 gcgctgctgctcgccgcgct 191 |||||||||||||||||||| Sbjct: 831653 gcgctgctgctcgccgcgct 831634
>emb|AL606615.4|OSJN00048 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0086B14, complete sequence Length = 175698 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcaggc 140 ||||||||||||||||||||| Sbjct: 4386 gcggcggcggcgggagcaggc 4366
>emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073L04, complete sequence Length = 143301 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 168 ggcggcgctgctgctcgccgc 188 ||||||||||||||||||||| Sbjct: 20095 ggcggcgctgctgctcgccgc 20115
>emb|BX936384.22| Zebrafish DNA sequence from clone CH211-76M11 in linkage group 20 Contains seven novel genes and two CpG islands, complete sequence Length = 194634 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 ctccctcccccaattccagcc 53 ||||||||||||||||||||| Sbjct: 77451 ctccctcccccaattccagcc 77471
>emb|CR859415.1| Pongo pygmaeus mRNA; cDNA DKFZp469D136 (from clone DKFZp469D136) Length = 5143 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 118 gagcggcggcggcgggagcag 138 ||||||||||||||||||||| Sbjct: 72 gagcggcggcggcgggagcag 92
>dbj|AK127826.1| Homo sapiens cDNA FLJ45929 fis, clone PLACE7000266, weakly similar to Homo sapiens titin (TTN), transcript variant N2-B Length = 5062 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 118 gagcggcggcggcgggagcag 138 ||||||||||||||||||||| Sbjct: 5 gagcggcggcggcgggagcag 25
>ref|XM_680432.1| PREDICTED: Danio rerio similar to brain-enriched guanylate kinase-associated (LOC557378), partial mRNA Length = 927 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 ctccctcccccaattccagcc 53 ||||||||||||||||||||| Sbjct: 645 ctccctcccccaattccagcc 665
>gb|AC102416.5| Mus musculus chromosome 18, clone RP24-492H24, complete sequence Length = 190211 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 ggcggcggcgggagcaggcgg 142 ||||||||||||||||||||| Sbjct: 124699 ggcggcggcgggagcaggcgg 124679
>gb|AC034244.6| Homo sapiens chromosome 5 clone RP11-101B14, complete sequence Length = 182892 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 195 gggggcggtgcgggggcaggg 215 ||||||||||||||||||||| Sbjct: 151977 gggggcggtgcgggggcaggg 151997
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcaggc 140 ||||||||||||||||||||| Sbjct: 22400631 gcggcggcggcgggagcaggc 22400611 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 168 ggcggcgctgctgctcgccgc 188 ||||||||||||||||||||| Sbjct: 20289462 ggcggcgctgctgctcgccgc 20289482 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 32309679 gcggcggcggcgggagcagg 32309660
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 115 ggggagcggcggcggcgggag 135 ||||||||||||||||||||| Sbjct: 10716746 ggggagcggcggcggcgggag 10716726
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Plus Query: 118 gagcggcggcggcgggagcaggcgg 142 |||||||||||||||||| |||||| Sbjct: 29676122 gagcggcggcggcgggaggaggcgg 29676146 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 17428970 catggggagcggcggcggcg 17428989 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 117 ggagcggcggcggcgggagcaggc 140 |||||||||||||| ||||||||| Sbjct: 14603098 ggagcggcggcggccggagcaggc 14603121
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome Length = 3304561 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 agcgccagcggccgggccgga 83 ||||||||||||||||||||| Sbjct: 735952 agcgccagcggccgggccgga 735972
>dbj|AK223599.1| Homo sapiens mRNA for factor for adipocyte differentiation 104 variant, clone: FCC131E05 Length = 3981 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 118 gagcggcggcggcgggagcag 138 ||||||||||||||||||||| Sbjct: 56 gagcggcggcggcgggagcag 76
>dbj|AP003408.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1131B07 Length = 109135 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Plus Query: 118 gagcggcggcggcgggagcaggcgg 142 |||||||||||||||||| |||||| Sbjct: 5853 gagcggcggcggcgggaggaggcgg 5877
>gb|AF274572.4| Homo sapiens chromosome X clone RP4-741O10 map q28, complete sequence Length = 126522 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcaggcggtg 144 ||||||||||||||||| ||||||| Sbjct: 12088 gcggcggcggcgggagcgggcggtg 12064
>gb|AC069259.14| Homo sapiens 3 BAC RP11-163H6 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 166530 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 118 gagcggcggcggcgggagcag 138 ||||||||||||||||||||| Sbjct: 107891 gagcggcggcggcgggagcag 107871
>gb|AF003626.2| Homo sapiens chromosome X clone ICRFXc104-M0525, LL0XNC01-C1233, ICRFXc104-C1284, Qc-3C1, LL0XNC01-B1439, LL0XNC01-220B3, LL0XNC01-57B6, Qc-12C11 map q28, complete sequence Length = 86834 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcaggcggtg 144 ||||||||||||||||| ||||||| Sbjct: 64635 gcggcggcggcgggagcgggcggtg 64611
>dbj|AP003410.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1142C05 Length = 151457 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Plus Query: 118 gagcggcggcggcgggagcaggcgg 142 |||||||||||||||||| |||||| Sbjct: 145942 gagcggcggcggcgggaggaggcgg 145966
>dbj|AP004037.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1001_D02 Length = 129081 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Plus Query: 118 gagcggcggcggcgggagcaggcgg 142 |||||||||||||||||||| |||| Sbjct: 121461 gagcggcggcggcgggagcaagcgg 121485
>dbj|AK109925.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-151-E12, full insert sequence Length = 3390 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 115 ggggagcggcggcggcgggag 135 ||||||||||||||||||||| Sbjct: 91 ggggagcggcggcggcgggag 111
>dbj|AK108406.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-142-G09, full insert sequence Length = 998 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcaggc 140 ||||||||||||||||||||| Sbjct: 416 gcggcggcggcgggagcaggc 396
>dbj|AK108077.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E01, full insert sequence Length = 1481 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 168 ggcggcgctgctgctcgccgc 188 ||||||||||||||||||||| Sbjct: 109 ggcggcgctgctgctcgccgc 129
>dbj|AK064204.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-104-E03, full insert sequence Length = 2282 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Minus Query: 118 gagcggcggcggcgggagcaggcgg 142 |||||||||||||||||||| |||| Sbjct: 255 gagcggcggcggcgggagcaagcgg 231
>emb|BX936423.12| Zebrafish DNA sequence from clone DKEY-174M14 in linkage group 20, complete sequence Length = 170767 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 ctccctcccccaattccagcc 53 ||||||||||||||||||||| Sbjct: 92655 ctccctcccccaattccagcc 92635
>emb|CR391917.19| Zebrafish DNA sequence from clone DKEY-97O8 in linkage group 1, complete sequence Length = 184212 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 ctccctcccccaattccagcc 53 ||||||||||||||||||||| Sbjct: 143616 ctccctcccccaattccagcc 143636
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 42.1 bits (21), Expect = 0.93 Identities = 27/29 (93%) Strand = Plus / Minus Query: 164 tctgggcggcgctgctgctcgccgcgctg 192 ||||| |||||||||||||||||| |||| Sbjct: 1918679 tctggacggcgctgctgctcgccgtgctg 1918651 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 172 gcgctgctgctcgccgcgctggcg 195 ||||||||||| |||||||||||| Sbjct: 382775 gcgctgctgctggccgcgctggcg 382752
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Minus Query: 177 gctgctcgccgcgctggcgggggcg 201 ||||||||||||||||| ||||||| Sbjct: 2557261 gctgctcgccgcgctggtgggggcg 2557237 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 187 gcgctggcgggggcggtgcg 206 |||||||||||||||||||| Sbjct: 763182 gcgctggcgggggcggtgcg 763163 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 169 gcggcgctgctgctcgccgcgctg 192 ||||||||||||||||||| |||| Sbjct: 161982 gcggcgctgctgctcgccgggctg 162005
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 115 ggggagcggcggcggcgggag 135 ||||||||||||||||||||| Sbjct: 10716445 ggggagcggcggcggcgggag 10716425
>emb|AL831795.4|CNS08CA8 Oryza sativa chromosome 12, . BAC OSJNBb0085N21 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 135105 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 115 ggggagcggcggcggcgggag 135 ||||||||||||||||||||| Sbjct: 81642 ggggagcggcggcggcgggag 81622
>emb|AL935287.15| Zebrafish DNA sequence from clone CH211-280O3, complete sequence Length = 174293 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 ctccctcccccaattccagcc 53 ||||||||||||||||||||| Sbjct: 120866 ctccctcccccaattccagcc 120846
>gb|BC012204.1| Homo sapiens fibronectin type III domain containing 3B, mRNA (cDNA clone IMAGE:3882800), complete cds Length = 949 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 118 gagcggcggcggcgggagcag 138 ||||||||||||||||||||| Sbjct: 25 gagcggcggcggcgggagcag 45
>gb|AC167663.3| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940143D9, complete sequence Length = 118759 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Plus Query: 176 tgctgctcgccgcgctggcgggggc 200 ||||| ||||||||||||||||||| Sbjct: 79845 tgctgttcgccgcgctggcgggggc 79869
>gb|AC167560.3| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940139D9, complete sequence Length = 118752 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Plus Query: 176 tgctgctcgccgcgctggcgggggc 200 ||||| ||||||||||||||||||| Sbjct: 79841 tgctgttcgccgcgctggcgggggc 79865
>gb|AC167664.4| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940124D9, complete sequence Length = 118889 Score = 42.1 bits (21), Expect = 0.93 Identities = 24/25 (96%) Strand = Plus / Minus Query: 176 tgctgctcgccgcgctggcgggggc 200 ||||| ||||||||||||||||||| Sbjct: 38910 tgctgttcgccgcgctggcgggggc 38886
>ref|XM_480169.1| Oryza sativa (japonica cultivar-group), mRNA Length = 231 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 167 gcggcggcggcgggagcagg 186
>ref|XM_474018.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2466 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 1079 gcggcggcggcgggagcagg 1098
>ref|XM_467614.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1889 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 168 ggcggcgctgctgctcgccgcgct 191 ||||||||||||||| |||||||| Sbjct: 176 ggcggcgctgctgctggccgcgct 199
>ref|XM_466194.1| Oryza sativa (japonica cultivar-group), mRNA Length = 702 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 554 gcggcggcggcgggagcagg 573
>ref|XM_463861.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1521 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 171 ggcgctgctgctcgccgcgc 190 |||||||||||||||||||| Sbjct: 183 ggcgctgctgctcgccgcgc 202
>ref|XM_450010.1| Oryza sativa (japonica cultivar-group), mRNA Length = 246 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 88 catggggagcggcggcggcg 69
>ref|XM_518723.1| PREDICTED: Pan troglodytes similar to IBR domain containing 1; chromosome 6 open reading frame 172 (LOC462979), mRNA Length = 2214 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 260 ggggctcgctggggctgcgg 279 |||||||||||||||||||| Sbjct: 180 ggggctcgctggggctgcgg 199
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence Length = 3694126 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctggcgg 196 ||||||||||||||| |||||||| Sbjct: 1922761 cgctgctgctcgccgggctggcgg 1922784
>ref|XM_516440.1| PREDICTED: Pan troglodytes similar to ubiquinol-cytochrome c reductase core protein I (LOC460348), mRNA Length = 1809 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 119 agcggcggcggcgggagcaggcgg 142 |||||||||||||||||| ||||| Sbjct: 1688 agcggcggcggcgggagcgggcgg 1711
>gb|AC146937.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0004O15 map near R3342S, complete sequence Length = 140142 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 113 atggggagcggcggcggcgg 132 |||||||||||||||||||| Sbjct: 91757 atggggagcggcggcggcgg 91738
>gb|AC146948.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone P0782F03 map near S2137, complete sequence Length = 197516 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 ggagcggcggcggcgggagc 136 |||||||||||||||||||| Sbjct: 127904 ggagcggcggcggcgggagc 127923
>gb|AC134053.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0005H02, complete sequence Length = 144882 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 ggagcggcggcggcgggagc 136 |||||||||||||||||||| Sbjct: 18007 ggagcggcggcggcgggagc 17988
>gb|AC108224.6| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0038F07, complete sequence Length = 175703 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 ggagcggcggcggcgggagc 136 |||||||||||||||||||| Sbjct: 161906 ggagcggcggcggcgggagc 161887
>gb|AC136998.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0082P17, complete sequence Length = 157539 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 60339 catggggagcggcggcggcg 60320
>gb|AC134561.5| Mus musculus BAC clone RP24-111C16 from chromosome 8, complete sequence Length = 179978 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 119 agcggcggcggcgggagcaggcgg 142 |||||||||||||||||| ||||| Sbjct: 71590 agcggcggcggcgggagctggcgg 71567
>gb|AF413203.1| Zea mays cultivar A554 DWARF8 gene, partial cds Length = 2476 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 802 gcggcggcggcgggagcagg 821
>gb|AF413202.1| Zea mays cultivar N192 DWARF8 gene, partial cds Length = 2455 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 787 gcggcggcggcgggagcagg 806
>gb|AF413201.1| Zea mays cultivar A6 DWARF8 gene, partial cds Length = 2631 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 957 gcggcggcggcgggagcagg 976
>gb|AF413200.1| Zea mays cultivar Ky21 DWARF8 gene, partial cds Length = 2983 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 1309 gcggcggcggcgggagcagg 1328
>gb|AF413199.1| Zea mays cultivar IDS28 DWARF8 gene, partial cds Length = 2983 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 1309 gcggcggcggcgggagcagg 1328
>gb|AF413198.1| Zea mays cultivar B14A DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413197.1| Zea mays cultivar CML287 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413196.1| Zea mays cultivar KUI44 DWARF8 gene, partial cds Length = 2645 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 971 gcggcggcggcgggagcagg 990
>gb|AF413195.1| Zea mays cultivar NC296 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413194.1| Zea mays cultivar NC338 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413193.1| Zea mays cultivar CI187 DWARF8 gene, partial cds Length = 2633 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 959 gcggcggcggcgggagcagg 978
>gb|AF413192.1| Zea mays cultivar EP1 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413191.1| Zea mays cultivar CML247 DWARF8 gene, partial cds Length = 2635 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 961 gcggcggcggcgggagcagg 980
>gb|AF413190.1| Zea mays cultivar CML254 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413189.1| Zea mays cultivar B103 DWARF8 gene, partial cds Length = 2639 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 965 gcggcggcggcgggagcagg 984
>gb|AF413188.1| Zea mays cultivar KUI11 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413187.1| Zea mays cultivar Tzi10 DWARF8 gene, partial cds Length = 2639 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 965 gcggcggcggcgggagcagg 984
>gb|AF413186.1| Zea mays cultivar M37W DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413185.1| Zea mays cultivar NC300 DWARF8 gene, partial cds Length = 2605 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 931 gcggcggcggcgggagcagg 950
>gb|AF413184.1| Zea mays cultivar B97 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413183.1| Zea mays cultivar W153R DWARF8 gene, partial cds Length = 2620 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 946 gcggcggcggcgggagcagg 965
>gb|AF413182.1| Zea mays cultivar D940Y DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413181.1| Zea mays cultivar IA2132 DWARF8 gene, partial cds Length = 2619 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 945 gcggcggcggcgggagcagg 964
>gb|AF413180.1| Zea mays cultivar TZI8 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413179.1| Zea mays cultivar IL677A DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413178.1| Zea mays cultivar NC298 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413177.1| Zea mays cultivar SC55 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413176.1| Zea mays cultivar MO24W DWARF8 gene, partial cds Length = 2630 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 956 gcggcggcggcgggagcagg 975
>gb|AF413175.1| Zea mays cultivar CML261 DWARF8 gene, partial cds Length = 2623 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 949 gcggcggcggcgggagcagg 968
>gb|AF413174.1| Zea mays cultivar CML10 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413173.1| Zea mays cultivar A441 DWARF8 gene, partial cds Length = 2639 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 965 gcggcggcggcgggagcagg 984
>gb|AF413172.1| Zea mays cultivar F44 DWARF8 gene, partial cds Length = 2639 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 965 gcggcggcggcgggagcagg 984
>gb|AF413171.1| Zea mays cultivar GT112 DWARF8 gene, partial cds Length = 2633 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 959 gcggcggcggcgggagcagg 978
>gb|AF413170.1| Zea mays cultivar K55 DWARF8 gene, partial cds Length = 2639 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 965 gcggcggcggcgggagcagg 984
>gb|AF413169.1| Zea mays cultivar N28HT DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413168.1| Zea mays cultivar NC250 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413167.1| Zea mays cultivar CML333 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413166.1| Zea mays cultivar KUI2007 DWARF8 gene, partial cds Length = 2639 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 965 gcggcggcggcgggagcagg 984
>gb|AF413165.1| Zea mays cultivar CML277 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413164.1| Zea mays cultivar B84 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413163.1| Zea mays cultivar CML281 DWARF8 gene, partial cds Length = 2645 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 971 gcggcggcggcgggagcagg 990
>gb|AF413162.1| Zea mays cultivar B73 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413161.1| Zea mays cultivar B37 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413160.1| Zea mays cultivar A272 DWARF8 gene, partial cds Length = 2639 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 965 gcggcggcggcgggagcagg 984
>gb|AF413159.1| Zea mays cultivar CML5 DWARF8 gene, partial cds Length = 2641 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 967 gcggcggcggcgggagcagg 986
>gb|AF413158.1| Zea mays cultivar NC320 DWARF8 gene, partial cds Length = 2633 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 959 gcggcggcggcgggagcagg 978
>gb|AF413157.1| Zea mays cultivar Tzi18 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413156.1| Zea mays cultivar NC348 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413155.1| Zea mays cultivar A632 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413154.1| Zea mays cultivar B104 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413153.1| Zea mays cultivar B68 DWARF8 gene, partial cds Length = 2637 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 963 gcggcggcggcgggagcagg 982
>gb|AF413152.1| Zea mays cultivar KUI3 DWARF8 gene, partial cds Length = 2639 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 965 gcggcggcggcgggagcagg 984
>gb|AF413151.1| Zea mays cultivar SA24 DWARF8 gene, partial cds Length = 2633 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 959 gcggcggcggcgggagcagg 978
>gb|AF413150.1| Zea mays cultivar T232 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413149.1| Zea mays cultivar W117HT DWARF8 gene, partial cds Length = 2616 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 942 gcggcggcggcgggagcagg 961
>gb|AF413148.1| Zea mays cultivar SG18 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413147.1| Zea mays cultivar NC350 DWARF8 gene, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 964 gcggcggcggcgggagcagg 983
>gb|AF413146.1| Zea mays cultivar NC352 DWARF8 gene, partial cds Length = 2423 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 749 gcggcggcggcgggagcagg 768
>gb|AF413145.1| Zea mays cultivar F2 DWARF8 gene, partial cds Length = 2431 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 757 gcggcggcggcgggagcagg 776
>gb|AF413144.1| Zea mays cultivar NC304 DWARF8 gene, partial cds Length = 2591 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 917 gcggcggcggcgggagcagg 936
>gb|AF413143.1| Zea mays cultivar ND246 DWARF8 gene, partial cds Length = 2577 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 903 gcggcggcggcgggagcagg 922
>gb|AF413142.1| Zea mays cultivar MS153 DWARF8 gene, partial cds Length = 2624 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 950 gcggcggcggcgggagcagg 969
>gb|AF413140.1| Zea mays cultivar CML258 DWARF8 gene, partial cds Length = 2657 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 983 gcggcggcggcgggagcagg 1002
>gb|AF413139.1| Zea mays cultivar NC354 DWARF8 gene, partial cds Length = 2657 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 983 gcggcggcggcgggagcagg 1002
>gb|AF413138.1| Zea mays cultivar Q6199 DWARF8 gene, partial cds Length = 2657 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 983 gcggcggcggcgggagcagg 1002
>gb|AF413137.1| Zea mays cultivar I137TN DWARF8 gene, partial cds Length = 2649 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 975 gcggcggcggcgggagcagg 994
>gb|AF413136.1| Zea mays cultivar KUI21 DWARF8 gene, partial cds Length = 2654 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 980 gcggcggcggcgggagcagg 999
>gb|AF413132.1| Zea mays cultivar SC213 DWARF8 gene, partial cds Length = 2654 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 980 gcggcggcggcgggagcagg 999
>gb|AF413131.1| Zea mays cultivar TX601 DWARF8 gene, partial cds Length = 2653 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 979 gcggcggcggcgggagcagg 998
>gb|AF413128.1| Zea mays cultivar KUI43 DWARF8 gene, partial cds Length = 2426 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 752 gcggcggcggcgggagcagg 771
>gb|AF413127.1| Zea mays cultivar M162W DWARF8 gene, partial cds Length = 2458 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 784 gcggcggcggcgggagcagg 803
>gb|AF413126.1| Zea mays cultivar Mo17 DWARF8 gene, partial cds Length = 2631 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 957 gcggcggcggcgggagcagg 976
>gb|AF413125.1| Zea mays cultivar 38-11 DWARF8 gene, partial cds Length = 2624 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 950 gcggcggcggcgggagcagg 969
>gb|AF413124.1| Zea mays cultivar W182B DWARF8 gene, partial cds Length = 2611 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 937 gcggcggcggcgggagcagg 956
>gb|AF413123.1| Zea mays cultivar C103 DWARF8 gene, partial cds Length = 2556 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 882 gcggcggcggcgggagcagg 901
>gb|AF413122.1| Zea mays cultivar OH7B DWARF8 gene, partial cds Length = 2611 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 937 gcggcggcggcgggagcagg 956
>gb|AF413121.1| Zea mays cultivar CM105 DWARF8 gene, partial cds Length = 2413 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 745 gcggcggcggcgggagcagg 764
>gb|AF413120.1| Zea mays cultivar OH43 DWARF8 gene, partial cds Length = 2377 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 709 gcggcggcggcgggagcagg 728
>gb|AF413119.1| Zea mays cultivar P39 DWARF8 gene, partial cds Length = 2932 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 1264 gcggcggcggcgggagcagg 1283
>gb|AF413118.1| Zea mays cultivar F2834T DWARF8 gene, partial cds Length = 2972 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 1304 gcggcggcggcgggagcagg 1323
>gb|AF413117.1| Zea mays cultivar CMV3 DWARF8 gene, partial cds Length = 2972 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 1304 gcggcggcggcgggagcagg 1323
>gb|AF413116.1| Zea mays cultivar F7 DWARF8 gene, partial cds Length = 2972 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 1304 gcggcggcggcgggagcagg 1323
>gb|AF413115.1| Zea mays cultivar CM174 DWARF8 gene, partial cds Length = 2972 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 1304 gcggcggcggcgggagcagg 1323
>gb|AF413114.1| Zea mays cultivar CM7 DWARF8 gene, partial cds Length = 2967 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 1302 gcggcggcggcgggagcagg 1321
>gb|AF413113.1| Zea mays cultivar I29 DWARF8 gene, partial cds Length = 2978 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 1304 gcggcggcggcgggagcagg 1323
>gb|AF413112.1| Zea mays cultivar A619 DWARF8 gene, partial cds Length = 2971 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 1303 gcggcggcggcgggagcagg 1322
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 169 gcggcgctgctgctcgccgcgctg 192 ||||| |||||||||||||||||| Sbjct: 805158 gcggccctgctgctcgccgcgctg 805181
>gb|L23982.1|HUMCOL7A1X Homo sapiens collagen type VII (COL7A1) gene, promoter region and complete cds Length = 36631 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 119 agcggcggcggcgggagcaggcgg 142 |||||||||||||||||| ||||| Sbjct: 3725 agcggcggcggcgggagcgggcgg 3748
>gb|BC066165.1| Mus musculus wingless-type MMTV integration site 9A, mRNA (cDNA clone MGC:76532 IMAGE:30435371), complete cds Length = 3306 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 85 cgctgctgctcgccgcgctg 104
>ref|XM_845102.1| PREDICTED: Canis familiaris similar to Homeobox protein DLX-2, transcript variant 1 (LOC607779), mRNA Length = 1005 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 gcatggggagcggcggcggc 130 |||||||||||||||||||| Sbjct: 755 gcatggggagcggcggcggc 774
>ref|XM_855787.1| PREDICTED: Canis familiaris similar to Homeobox protein DLX-2, transcript variant 2 (LOC607779), mRNA Length = 939 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 gcatggggagcggcggcggc 130 |||||||||||||||||||| Sbjct: 689 gcatggggagcggcggcggc 708
>gb|AC134923.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBb0030I07, complete sequence Length = 122733 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 112320 catggggagcggcggcggcg 112301
>gb|AY203946.1| Homo sapiens LP7097 mRNA, complete cds Length = 2141 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcaggcggtgatg 147 |||||||||||||||| |||||| |||| Sbjct: 195 gcggcggcggcgggaggaggcggcgatg 222
>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome Length = 2462499 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 177 gctgctcgccgcgctggcgg 196 |||||||||||||||||||| Sbjct: 893315 gctgctcgccgcgctggcgg 893334
>emb|Z83851.17|HS989H11 Human DNA sequence from clone CTA-989H11 on chromosome 22q13.1-13.2, complete sequence Length = 118831 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 192 ggcgggggcggtgcgggggcaggg 215 ||||||||||| |||||||||||| Sbjct: 11801 ggcgggggcggggcgggggcaggg 11824
>emb|AL360269.21| Human DNA sequence from clone RP11-192I3 on chromosome 1 Contains the WNT9A gene for wingless-type MMTV integration site family, member 9A and a CpG island, complete sequence Length = 141703 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 94426 cgctgctgctcgccgcgctg 94407
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 176 tgctgctcgccgcgctggcg 195 |||||||||||||||||||| Sbjct: 3855466 tgctgctcgccgcgctggcg 3855447 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 gctgctgctcgccgcgctgg 193 |||||||||||||||||||| Sbjct: 865236 gctgctgctcgccgcgctgg 865217
>emb|AL355296.12| Human DNA sequence from clone RP11-510H23 on chromosome 6 Contains parts of 3 novel genes and a CpG island, complete sequence Length = 159110 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 260 ggggctcgctggggctgcgg 279 |||||||||||||||||||| Sbjct: 94697 ggggctcgctggggctgcgg 94716
>gb|AC134265.6| Rattus norvegicus 13 BAC CH230-151K3 (Children's Hospital Oakland Research Institute) complete sequence Length = 209981 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 11 atttccctcccaattccatc 30 |||||||||||||||||||| Sbjct: 185388 atttccctcccaattccatc 185369
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence Length = 2726152 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 ctgctgctcgccgcgctggc 194 |||||||||||||||||||| Sbjct: 1293937 ctgctgctcgccgcgctggc 1293918
>emb|AL121789.38|HSJ493H23 Human DNA sequence from clone RP3-493H23 on chromosome 6q26-27 Contains the 5' end of the PDE10A gene for phosphodiesterase 10A and a CpG island, complete sequence Length = 74227 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcaggcggtgatg 147 |||||||||||||||| |||||| |||| Sbjct: 67725 gcggcggcggcgggaggaggcggcgatg 67698
>emb|AL022476.2|HS323M22 Human DNA sequence from clone RP3-323M22 on chromosome 22, complete sequence Length = 194523 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 agcgccagcggccgggccggagca 86 ||||||||||||||||| |||||| Sbjct: 144661 agcgccagcggccgggcaggagca 144684
>gb|AC121252.4| Homo sapiens chromosome 3 clone RP11-148G20, complete sequence Length = 105166 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 119 agcggcggcggcgggagcaggcgg 142 |||||||||||||||||| ||||| Sbjct: 33747 agcggcggcggcgggagcgggcgg 33724
>emb|X60063.1|GDJUNDG G.domesticus junD gene Length = 2988 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 115 ggggagcggcggcggcgggagcaggcgg 142 ||||||||||||| ||||||| |||||| Sbjct: 1826 ggggagcggcggccgcgggaggaggcgg 1853
>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome Length = 5064019 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 ggcggcggcgggagcaggcg 141 |||||||||||||||||||| Sbjct: 2624990 ggcggcggcgggagcaggcg 2624971
>emb|AL713994.15| Mouse DNA sequence from clone RP23-378H5 on chromosome 11 Contains the 5' end of the Arf-1 gene for ADP-ribosylation factor 1, the Wnt3a gene for wingless-related MMTV integration site 3A, the Wnt9a gene for wingless-type MMTV integration site 9A, two novel genes, the 5' end of a novel gene and five CpG islands, complete sequence Length = 225396 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 79888 cgctgctgctcgccgcgctg 79907
>emb|BX572605.1| Rhodopseudomonas palustris CGA009 complete genome; segment 13/16 Length = 349746 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 168 ggcggcgctgctgctcgccgcgct 191 |||| ||||||||||||||||||| Sbjct: 43776 ggcgccgctgctgctcgccgcgct 43753
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 169 gcggcgctgctgctcgccgcgctg 192 ||||| |||||||||||||||||| Sbjct: 2125423 gcggccctgctgctcgccgcgctg 2125446
>emb|AL606444.3|OSJN00019 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043L09, complete sequence Length = 159502 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 79262 gcggcggcggcgggagcagg 79243
>gb|DQ351275.1| Streptomyces sp. NRRL 30748 meridamycin biosynthetic gene cluster and flanking regions Length = 116831 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 173 cgctgctgctcgccgcgctggcgg 196 ||||| |||||||||||||||||| Sbjct: 5504 cgctggtgctcgccgcgctggcgg 5481
>gb|AC157561.10| Mus musculus chromosome 7, clone RP23-356A20, complete sequence Length = 232927 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 ggcgggggcggtgcgggggc 211 |||||||||||||||||||| Sbjct: 222697 ggcgggggcggtgcgggggc 222678
>gb|AC025783.10| Oryza sativa chromosome 10 BAC OSJNBa0001O14 genomic sequence, complete sequence Length = 178022 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 tggggagcggcggcggcggg 133 |||||||||||||||||||| Sbjct: 118280 tggggagcggcggcggcggg 118261
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 176 tgctgctcgccgcgctggcg 195 |||||||||||||||||||| Sbjct: 3953298 tgctgctcgccgcgctggcg 3953317
>gb|AC117414.3| Homo sapiens 3 BAC RP11-48F14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 143721 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 cagcccacactctcagcgcc 68 |||||||||||||||||||| Sbjct: 87159 cagcccacactctcagcgcc 87140
>ref|NM_137035.1| Drosophila melanogaster Myb-interacting protein 120 CG6061-RA (mip120), mRNA Length = 3463 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 171 ggcgctgctgctcgccgcgctggc 194 |||||||||||||||||| ||||| Sbjct: 1860 ggcgctgctgctcgccgcactggc 1837
>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII, complete sequence Length = 1476513 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gcggcggcgggagcaggcgg 142 |||||||||||||||||||| Sbjct: 382764 gcggcggcgggagcaggcgg 382783
>dbj|AK087490.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130305L02 product:WNT14 homolog [Homo sapiens], full insert sequence Length = 3325 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 99 cgctgctgctcgccgcgctg 118
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 169 gcggcgctgctgctcgccgcgctg 192 ||||| |||||||||||||||||| Sbjct: 1699803 gcggccctgctgctcgccgcgctg 1699826
>ref|NM_139298.2| Mus musculus wingless-type MMTV integration site 9A (Wnt9a), mRNA Length = 3318 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 96 cgctgctgctcgccgcgctg 115
>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome Length = 2909809 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 ctgctgctcgccgcgctggc 194 |||||||||||||||||||| Sbjct: 1016563 ctgctgctcgccgcgctggc 1016582
>gb|AC091634.1|AC091634 Drosophila melanogaster, chromosome 2R, region 50A-50B, BAC clone BACR36J03, complete sequence Length = 159065 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 171 ggcgctgctgctcgccgcgctggc 194 |||||||||||||||||| ||||| Sbjct: 113664 ggcgctgctgctcgccgcactggc 113687
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 113 atggggagcggcggcggcgg 132 |||||||||||||||||||| Sbjct: 27630216 atggggagcggcggcggcgg 27630235 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 26650062 catggggagcggcggcggcg 26650043 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 ggagcggcggcggcgggagc 136 |||||||||||||||||||| Sbjct: 19443355 ggagcggcggcggcgggagc 19443336 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 ggagcggcggcggcgggagc 136 |||||||||||||||||||| Sbjct: 8047176 ggagcggcggcggcgggagc 8047195
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 tggggagcggcggcggcggg 133 |||||||||||||||||||| Sbjct: 20855881 tggggagcggcggcggcggg 20855862
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 9997408 catggggagcggcggcggcg 9997427 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 9988899 catggggagcggcggcggcg 9988918 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 963930 catggggagcggcggcggcg 963949
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 3238443 gcggcggcggcgggagcagg 3238462
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 tggggagcggcggcggcggg 133 |||||||||||||||||||| Sbjct: 807684 tggggagcggcggcggcggg 807665
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 tggggagcggcggcggcggg 133 |||||||||||||||||||| Sbjct: 29374665 tggggagcggcggcggcggg 29374646 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 21416983 gcggcggcggcgggagcagg 21416964 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 14821813 catggggagcggcggcggcg 14821794
>dbj|AB041798.2| Homo sapiens HSPDE10A gene for phosphodiesterase 10A1 (PDE10A1), phosphodiesterase 10A7 (PDE10A7), partial cds Length = 19594 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcaggcggtgatg 147 |||||||||||||||| |||||| |||| Sbjct: 443 gcggcggcggcgggaggaggcggcgatg 470
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 177 gctgctcgccgcgctggcgg 196 |||||||||||||||||||| Sbjct: 6342935 gctgctcgccgcgctggcgg 6342954
>gb|AE004901.1| Pseudomonas aeruginosa PAO1, section 462 of 529 of the complete genome Length = 12399 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 169 gcggcgctgctgctcgccgcgctggcgg 196 |||||||||||| |||||||| |||||| Sbjct: 9592 gcggcgctgctgttcgccgcggtggcgg 9619
>gb|AC004916.2|AC004916 Homo sapiens PAC clone RP5-891L14 from 7p22, complete sequence Length = 129014 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 107138 cgctgctgctcgccgcgctg 107157
>ref|NM_003395.1| Homo sapiens wingless-type MMTV integration site family, member 9A (WNT9A), mRNA Length = 1631 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 64 cgctgctgctcgccgcgctg 83
>ref|XM_220556.3| PREDICTED: Rattus norvegicus wingless-type MMTV integration site 9A (predicted) (Wnt9a_predicted), mRNA Length = 1471 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 425 cgctgctgctcgccgcgctg 444
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 177 gctgctcgccgcgctggcgg 196 |||||||||||||||||||| Sbjct: 350691 gctgctcgccgcgctggcgg 350710
>gb|AC005923.2| Homo sapiens 3 PAC RP4-751E10 (Roswell Park Cancer Institute Human PAC Library) complete sequence Length = 88326 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 119 agcggcggcggcgggagcaggcgg 142 |||||||||||||||||| ||||| Sbjct: 75181 agcggcggcggcgggagcgggcgg 75204
>emb|AL929021.13| Mouse DNA sequence from clone RP23-89H14 on chromosome 2, complete sequence Length = 181549 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 195 gggggcggtgcgggggcagg 214 |||||||||||||||||||| Sbjct: 68298 gggggcggtgcgggggcagg 68279
>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0507H06 Length = 136351 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 82362 catggggagcggcggcggcg 82381
>dbj|AP005709.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0646B04 Length = 178896 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 128057 catggggagcggcggcggcg 128076
>dbj|AP003621.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0621D05 Length = 180250 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 tggggagcggcggcggcggg 133 |||||||||||||||||||| Sbjct: 85546 tggggagcggcggcggcggg 85527
>dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0036E06 Length = 137926 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 171 ggcgctgctgctcgccgcgc 190 |||||||||||||||||||| Sbjct: 56217 ggcgctgctgctcgccgcgc 56198
>dbj|AP005128.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0466E03 Length = 138343 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 26712 catggggagcggcggcggcg 26731 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 18203 catggggagcggcggcggcg 18222
>dbj|AP004840.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0544B02 Length = 156339 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 117 ggagcggcggcggcgggagcaggc 140 |||||||||||||||| ||||||| Sbjct: 37060 ggagcggcggcggcggcagcaggc 37083
>dbj|AP003444.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1164G11 Length = 142699 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 117 ggagcggcggcggcgggagcaggc 140 |||||||||||||| ||||||||| Sbjct: 84475 ggagcggcggcggccggagcaggc 84498
>dbj|AP005456.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0513E02 Length = 141477 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 51483 gcggcggcggcgggagcagg 51464
>dbj|AP003761.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0018H04 Length = 142053 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 tggggagcggcggcggcggg 133 |||||||||||||||||||| Sbjct: 137463 tggggagcggcggcggcggg 137444
>dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0514H03 Length = 167230 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 117 ggagcggcggcggcgggagcaggc 140 |||||||||||||| ||||||||| Sbjct: 162411 ggagcggcggcggccggagcaggc 162434
>dbj|AP005928.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBb0031F23 Length = 128090 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 37086 catggggagcggcggcggcg 37067
>dbj|AP004802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0640D01 Length = 164996 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 132897 catggggagcggcggcggcg 132878
>dbj|AP004876.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0470G10 Length = 145419 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 98737 gcggcggcggcgggagcagg 98756
>dbj|AP005860.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1134_E08 Length = 153002 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 1623 catggggagcggcggcggcg 1642
>dbj|AP005724.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0017I18 Length = 146304 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 144346 catggggagcggcggcggcg 144365
>dbj|AP005696.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0063K04 Length = 158792 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 catggggagcggcggcggcg 131 |||||||||||||||||||| Sbjct: 120405 catggggagcggcggcggcg 120424
>dbj|AP005751.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0072H09 Length = 160541 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 168 ggcggcgctgctgctcgccgcgct 191 ||||||||||||||| |||||||| Sbjct: 127315 ggcggcgctgctgctggccgcgct 127338
>dbj|AP004888.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0617A09 Length = 134804 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 168 ggcggcgctgctgctcgccgcgct 191 ||||||||||||||| |||||||| Sbjct: 52503 ggcggcgctgctgctggccgcgct 52526
>gb|AY888609.1| Synthetic construct Homo sapiens clone FLH117699.01X wingless-type MMTV integration site family member 9A (WNT9A) mRNA, complete cds Length = 1098 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 53 cgctgctgctcgccgcgctg 72
>gb|AY891253.1| Synthetic construct Homo sapiens clone FLH117695.01L wingless-type MMTV integration site family member 9A (WNT9A) mRNA, partial cds Length = 1098 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 53 cgctgctgctcgccgcgctg 72
>dbj|AP004090.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1399_H05 Length = 147670 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 171 ggcgctgctgctcgccgcgc 190 |||||||||||||||||||| Sbjct: 134981 ggcgctgctgctcgccgcgc 134962
>dbj|AK121962.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108B06, full insert sequence Length = 1410 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 ggagcggcggcggcgggagc 136 |||||||||||||||||||| Sbjct: 364 ggagcggcggcggcgggagc 383
>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0438H08 Length = 148626 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 16010 gcggcggcggcgggagcagg 16029
>emb|AJ242530.1|ZMA242530 Zea mays partial d8 gene for gibberellin response modulator Length = 1890 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gcggcggcggcgggagcagg 139 |||||||||||||||||||| Sbjct: 70 gcggcggcggcgggagcagg 89
>emb|AJ011616.1|ZMA011616 Zea mays mRNA for SBP-domain protein 3 Length = 2059 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 109 aggcatggggagcggcggcggcgg 132 ||||||||| |||||||||||||| Sbjct: 508 aggcatgggcagcggcggcggcgg 485
>dbj|AK131041.1| Homo sapiens cDNA FLJ29007 fis, clone STM04662, highly similar to WNT-14 protein precursor Length = 1735 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 96 cgctgctgctcgccgcgctg 115
>gb|AY893791.1| Synthetic construct Homo sapiens clone FLH053361.01L wingless-type MMTV integration site family member 9A (WNT9A) mRNA, partial cds Length = 1098 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 53 cgctgctgctcgccgcgctg 72
>gb|AY893346.1| Synthetic construct Homo sapiens clone FLH053364.01X wingless-type MMTV integration site family member 9A (WNT9A) mRNA, complete cds Length = 1098 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 53 cgctgctgctcgccgcgctg 72
>emb|AJ334461.1|HSA334461 Homo sapiens genomic sequence surrounding NotI site, clone NL1-HD16R Length = 815 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 116 cgctgctgctcgccgcgctg 135
>emb|AJ334354.1|HSA334354 Homo sapiens genomic sequence surrounding NotI site, clone NR1-XL5R Length = 695 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 117 cgctgctgctcgccgcgctg 136
>emb|AJ335030.1|HSA335030 Homo sapiens genomic sequence surrounding NotI site, clone NL1-VH19R Length = 859 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 116 cgctgctgctcgccgcgctg 135
>dbj|AK101253.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033032F08, full insert sequence Length = 1889 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 168 ggcggcgctgctgctcgccgcgct 191 ||||||||||||||| |||||||| Sbjct: 176 ggcggcgctgctgctggccgcgct 199
>emb|AJ332015.1|HSA332015 Homo sapiens genomic sequence surrounding NotI site, clone NL3-CK16R Length = 741 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 116 cgctgctgctcgccgcgctg 135
>emb|AJ327619.1|HSA327619 Homo sapiens genomic sequence surrounding NotI site, clone NR1-CD3R Length = 738 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 116 cgctgctgctcgccgcgctg 135
>ref|NM_211561.1| Eremothecium gossypii AGL168Wp (AGL168W), mRNA Length = 555 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gcggcggcgggagcaggcgg 142 |||||||||||||||||||| Sbjct: 462 gcggcggcgggagcaggcgg 481
>gb|BC111960.1| Homo sapiens wingless-type MMTV integration site family, member 9A, mRNA (cDNA clone MGC:138165 IMAGE:8327428), complete cds Length = 1240 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgctgctgctcgccgcgctg 192 |||||||||||||||||||| Sbjct: 141 cgctgctgctcgccgcgctg 160 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,754,955 Number of Sequences: 3902068 Number of extensions: 2754955 Number of successful extensions: 98439 Number of sequences better than 10.0: 264 Number of HSP's better than 10.0 without gapping: 279 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 91284 Number of HSP's gapped (non-prelim): 7155 length of query: 282 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 260 effective length of database: 17,147,199,772 effective search space: 4458271940720 effective search space used: 4458271940720 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)