| Clone Name | bastl43d03 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 73.8 bits (37), Expect = 4e-10 Identities = 42/44 (95%) Strand = Plus / Plus Query: 369 agcggngaggagctcctgaagaagatccggaagctggaggtggg 412 ||||| |||||||||||||||||||||||| ||||||||||||| Sbjct: 23094998 agcggcgaggagctcctgaagaagatccgggagctggaggtggg 23095041
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 73.8 bits (37), Expect = 4e-10 Identities = 42/44 (95%) Strand = Plus / Plus Query: 369 agcggngaggagctcctgaagaagatccggaagctggaggtggg 412 ||||| |||||||||||||||||||||||| ||||||||||||| Sbjct: 23023189 agcggcgaggagctcctgaagaagatccgggagctggaggtggg 23023232
>emb|AL928753.3|CNS08CBQ Oryza sativa chromosome 12, . BAC OSJNBb0076G11 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 135323 Score = 73.8 bits (37), Expect = 4e-10 Identities = 42/44 (95%) Strand = Plus / Minus Query: 369 agcggngaggagctcctgaagaagatccggaagctggaggtggg 412 ||||| |||||||||||||||||||||||| ||||||||||||| Sbjct: 83399 agcggcgaggagctcctgaagaagatccgggagctggaggtggg 83356
>ref|XM_510843.1| PREDICTED: Pan troglodytes LOC453949 (LOC453949), mRNA Length = 2647 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 2134 cctgaagaagatccgggagctggagg 2159
>gb|AY520817.1| Homo sapiens smooth muscle myosin heavy chain isoform SM2 (MYH11) mRNA, complete cds; alternatively spliced Length = 6886 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 3436 cctgaagaagatccgggagctggagg 3461
>gb|AY520816.1| Homo sapiens smooth muscle myosin heavy chain isoform SM1 (MYH11) mRNA, complete cds; alternatively spliced Length = 6847 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 3436 cctgaagaagatccgggagctggagg 3461
>gb|BC101677.1| Homo sapiens myosin, heavy polypeptide 11, smooth muscle, transcript variant SM2, mRNA (cDNA clone MGC:126726 IMAGE:8069183), complete cds Length = 5907 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 3398 cctgaagaagatccgggagctggagg 3423
>ref|NM_001040113.1| Homo sapiens myosin, heavy polypeptide 11, smooth muscle (MYH11), transcript variant SM2B, mRNA Length = 6942 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 3455 cctgaagaagatccgggagctggagg 3480
>ref|NM_002474.2| Homo sapiens myosin, heavy polypeptide 11, smooth muscle (MYH11), transcript variant SM1A, mRNA Length = 6882 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 3434 cctgaagaagatccgggagctggagg 3459
>ref|NM_001040114.1| Homo sapiens myosin, heavy polypeptide 11, smooth muscle (MYH11), transcript variant SM1B, mRNA Length = 6903 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 3455 cctgaagaagatccgggagctggagg 3480
>ref|NM_022844.2| Homo sapiens myosin, heavy polypeptide 11, smooth muscle (MYH11), transcript variant SM2A, mRNA Length = 6921 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 3434 cctgaagaagatccgggagctggagg 3459
>emb|BX936460.6| Zebrafish DNA sequence from clone CH211-69N2 in linkage group 9, complete sequence Length = 79327 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1 atggatggatagatagattcca 22 |||||||||||||||||||||| Sbjct: 56412 atggatggatagatagattcca 56433
>emb|X69292.1|HSSMMHC H.sapiens mRNA for smooth muscle myosin Length = 3320 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 55 cctgaagaagatccgggagctggagg 80
>emb|AL731791.16| Mouse DNA sequence from clone RP23-199A12 on chromosome X, complete sequence Length = 134389 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 349 aggtgctggggatggaatccag 370 |||||||||||||||||||||| Sbjct: 74295 aggtgctggggatggaatccag 74316
>emb|AL772200.10| Mouse DNA sequence from clone RP23-265N8 on chromosome X, complete sequence Length = 195289 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 349 aggtgctggggatggaatccag 370 |||||||||||||||||||||| Sbjct: 189777 aggtgctggggatggaatccag 189798
>emb|BX641087.1|HSM806904 Homo sapiens mRNA; cDNA DKFZp686D19237 (from clone DKFZp686D19237) Length = 1548 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 364 cctgaagaagatccgggagctggagg 389
>gb|AF001548.1|HUAF001548 Human Chromosome 16 BAC clone CIT987SK-A-815A9, complete sequence Length = 145831 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 97183 cctgaagaagatccgggagctggagg 97208
>gb|BC104906.1| Homo sapiens myosin, heavy polypeptide 11, smooth muscle, transcript variant SM2, mRNA (cDNA clone MGC:132566 IMAGE:8143909), complete cds Length = 5907 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 3398 cctgaagaagatccgggagctggagg 3423
>gb|AC003982.1|AC003982 Homo sapiens PAC clone 166H1 from 12q, complete sequence Length = 122302 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 269 ggagggtgggaggagctggcct 290 |||||||||||||||||||||| Sbjct: 95918 ggagggtgggaggagctggcct 95897
>emb|BX004809.15| Mouse DNA sequence from clone RP23-284G7 on chromosome X, complete sequence Length = 95892 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 349 aggtgctggggatggaatccag 370 |||||||||||||||||||||| Sbjct: 68099 aggtgctggggatggaatccag 68120
>dbj|AB020673.2| Homo sapiens mRNA for KIAA0866 protein, partial cds Length = 6846 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 3402 cctgaagaagatccgggagctggagg 3427
>gb|M77812.1|RABMHCP Rabbit myosin heavy chain mRNA, complete cds Length = 6644 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 3423 cctgaagaagatccgggagctggagg 3448
>dbj|D10667.1|HUMMHCAAA Homo sapiens mRNA for smooth muscle myosin heavy chain, partial cds Length = 3388 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctggagg 408 |||||||||||||||| ||||||||| Sbjct: 669 cctgaagaagatccgggagctggagg 694
>gb|AC153580.19| Mus musculus 6 BAC RP23-389F23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 180936 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 ggatctccggcaggaggattt 179 ||||||||||||||||||||| Sbjct: 57910 ggatctccggcaggaggattt 57930
>gb|AC147229.5| Mus musculus BAC clone RP23-236E9 from chromosome 19, complete sequence Length = 162400 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 70671 ggtgctggggatggaatccag 70691
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 263 agccgcggagggtgggaggag 283 ||||||||||||||||||||| Sbjct: 30596236 agccgcggagggtgggaggag 30596256
>emb|CT009708.6| Mouse DNA sequence from clone RP23-82F10 on chromosome 9, complete sequence Length = 247670 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 125488 ggtgctggggatggaatccag 125508
>gb|AC083858.3| Mus musculus strain C57BL6/J chromosome 5 clone RP23-423A22, complete sequence Length = 74718 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 4507 ggtgctggggatggaatccag 4487
>gb|AC024608.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-333I24, complete sequence Length = 215829 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 210956 ggtgctggggatggaatccag 210936
>gb|AC112151.3| Mus musculus BAC clone RP24-86M8 from 2, complete sequence Length = 216515 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 1750 ggtgctggggatggaatccag 1770
>ref|XM_857866.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 30 (LOC479836), mRNA Length = 6576 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3414 ctgaagaagatccgggagctggagg 3438
>ref|XM_857838.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 29 (LOC479836), mRNA Length = 6597 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3435 ctgaagaagatccgggagctggagg 3459
>ref|XM_857817.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 28 (LOC479836), mRNA Length = 6552 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3390 ctgaagaagatccgggagctggagg 3414
>ref|XM_857792.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 27 (LOC479836), mRNA Length = 6621 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3459 ctgaagaagatccgggagctggagg 3483
>ref|XM_857773.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 26 (LOC479836), mRNA Length = 6558 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3396 ctgaagaagatccgggagctggagg 3420
>ref|XM_857752.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 25 (LOC479836), mRNA Length = 6558 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3396 ctgaagaagatccgggagctggagg 3420
>ref|XM_857727.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 24 (LOC479836), mRNA Length = 6588 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3426 ctgaagaagatccgggagctggagg 3450
>ref|XM_857703.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 23 (LOC479836), mRNA Length = 6600 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3438 ctgaagaagatccgggagctggagg 3462
>ref|XM_857678.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 22 (LOC479836), mRNA Length = 6558 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3396 ctgaagaagatccgggagctggagg 3420
>ref|XM_857656.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 21 (LOC479836), mRNA Length = 6558 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3396 ctgaagaagatccgggagctggagg 3420
>ref|XM_857628.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 20 (LOC479836), mRNA Length = 6597 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3435 ctgaagaagatccgggagctggagg 3459
>ref|XM_536963.2| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 1 (LOC479836), mRNA Length = 6279 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3117 ctgaagaagatccgggagctggagg 3141
>ref|XM_857578.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 19 (LOC479836), mRNA Length = 5945 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3483 ctgaagaagatccgggagctggagg 3507
>ref|XM_857554.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 18 (LOC479836), mRNA Length = 6579 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3417 ctgaagaagatccgggagctggagg 3441
>ref|XM_857531.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 17 (LOC479836), mRNA Length = 6684 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3522 ctgaagaagatccgggagctggagg 3546
>ref|XM_857511.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 16 (LOC479836), mRNA Length = 6708 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3546 ctgaagaagatccgggagctggagg 3570
>ref|XM_857488.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 15 (LOC479836), mRNA Length = 6585 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3423 ctgaagaagatccgggagctggagg 3447
>ref|XM_857461.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 14 (LOC479836), mRNA Length = 6600 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3438 ctgaagaagatccgggagctggagg 3462
>ref|XM_857438.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 13 (LOC479836), mRNA Length = 6603 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3441 ctgaagaagatccgggagctggagg 3465
>ref|XM_857414.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 12 (LOC479836), mRNA Length = 6600 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3438 ctgaagaagatccgggagctggagg 3462
>ref|XM_857386.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 11 (LOC479836), mRNA Length = 6588 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3426 ctgaagaagatccgggagctggagg 3450
>ref|XM_857361.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 10 (LOC479836), mRNA Length = 5939 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3477 ctgaagaagatccgggagctggagg 3501
>ref|XM_857335.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 9 (LOC479836), mRNA Length = 6663 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3501 ctgaagaagatccgggagctggagg 3525
>ref|XM_857303.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 8 (LOC479836), mRNA Length = 5897 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3435 ctgaagaagatccgggagctggagg 3459
>ref|XM_857275.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 7 (LOC479836), mRNA Length = 5984 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3522 ctgaagaagatccgggagctggagg 3546
>ref|XM_857247.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 6 (LOC479836), mRNA Length = 6420 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3258 ctgaagaagatccgggagctggagg 3282
>ref|XM_857198.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 4 (LOC479836), mRNA Length = 6615 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3414 ctgaagaagatccgggagctggagg 3438
>ref|XM_845671.1| PREDICTED: Canis familiaris similar to smooth muscle myosin heavy chain 11 isoform SM1, transcript variant 3 (LOC479836), mRNA Length = 6576 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 384 ctgaagaagatccggaagctggagg 408 ||||||||||||||| ||||||||| Sbjct: 3414 ctgaagaagatccgggagctggagg 3438
>gb|AC163214.4| Mus musculus chromosome 5, clone RP23-467O1, complete sequence Length = 200882 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 129847 ggtgctggggatggaatccag 129827
>gb|AC140023.13| Medicago truncatula clone mth2-32h4, complete sequence Length = 152468 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 182 tgctggttcttgctccatttt 202 ||||||||||||||||||||| Sbjct: 143677 tgctggttcttgctccatttt 143657
>gb|AC156496.10| Mus musculus chromosome 7, clone RP24-246N21, complete sequence Length = 143815 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 21243 ggtgctggggatggaatccag 21223
>gb|AC148238.4| Medicago truncatula clone mth2-4a11, complete sequence Length = 98424 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 182 tgctggttcttgctccatttt 202 ||||||||||||||||||||| Sbjct: 8028 tgctggttcttgctccatttt 8008
>emb|AL596382.12| Mouse DNA sequence from clone RP23-337J7 on chromosome 11, complete sequence Length = 225083 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 112507 ggtgctggggatggaatccag 112487
>emb|AL645526.14| Mouse DNA sequence from clone RP23-60F20 on chromosome 11 Contains the 5' end of the Pemt gene for phosphatidylethanolamine N-methyltransferase, the 5' end of the Rai1 gene for retinoic acid induced 1, a novel gene (4930412M03Rik) and three CpG islands, complete sequence Length = 143708 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 38912 ggtgctggggatggaatccag 38892
>gb|AC129312.6| Mus musculus BAC clone RP24-405K6 from chromosome 1, complete sequence Length = 197135 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 270 gagggtgggaggagctggcct 290 ||||||||||||||||||||| Sbjct: 53756 gagggtgggaggagctggcct 53736
>gb|AC091811.7| Oryza sativa chromosome 3 BAC OSJNBa0069E14 genomic sequence, complete sequence Length = 139872 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 263 agccgcggagggtgggaggag 283 ||||||||||||||||||||| Sbjct: 127809 agccgcggagggtgggaggag 127829
>gb|AC148986.5| Mus musculus BAC clone RP23-89A16 from chromosome 7, complete sequence Length = 243039 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 81809 ggtgctggggatggaatccag 81829
>emb|AL115327.1|CNS01CBR Botrytis cinerea strain T4 cDNA library Length = 780 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 1 atggatggatagatagattccaagt 25 |||||||||||||||||| |||||| Sbjct: 722 atggatggatagatagataccaagt 746
>emb|AL111501.1|CNS019DH Botrytis cinerea strain T4 cDNA library Length = 720 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 1 atggatggatagatagattccaagt 25 |||||||||||||||||| |||||| Sbjct: 583 atggatggatagatagataccaagt 607
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 263 agccgcggagggtgggaggag 283 ||||||||||||||||||||| Sbjct: 30687658 agccgcggagggtgggaggag 30687678
>gb|AF463758.1| Mus musculus strain C57BL/6J cytokine gene cluster, partial sequence Length = 15493 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 11066 ggtgctggggatggaatccag 11086
>gb|AF076998.1|AF076998 HIV-1 isolate VI961 from Democratic Republic of the Congo, complete genome Length = 8990 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 91 caaggatcttttttcttttcctgga 115 |||||||||||| |||||||||||| Sbjct: 8496 caaggatcttttgtcttttcctgga 8472
>emb|AL928733.14| Mouse DNA sequence from clone RP23-190O13 on chromosome 2, complete sequence Length = 110511 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 49044 ggtgctggggatggaatccag 49064
>gb|AC116521.15| Mus musculus chromosome 5, clone RP24-343N10, complete sequence Length = 169411 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 149050 ggtgctggggatggaatccag 149030
>gb|AC141883.4| Mus musculus BAC clone RP24-128P19 from 7, complete sequence Length = 189828 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 134334 ggtgctggggatggaatccag 134354
>emb|AL929165.9| Mouse DNA sequence from clone RP23-446D4 on chromosome 2, complete sequence Length = 181326 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 131516 ggtgctggggatggaatccag 131536
>gb|AC000399.1|AC000399 Genomic sequence from Mouse 9, complete sequence Length = 140554 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 110310 ggtgctggggatggaatccag 110290
>emb|AL627103.13| Mouse DNA sequence from clone RP23-414M10 on chromosome 4, complete sequence Length = 194995 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 351 gtgctggggatggaatccagc 371 ||||||||||||||||||||| Sbjct: 122677 gtgctggggatggaatccagc 122697
>emb|AL672180.11| Mouse DNA sequence from clone RP23-419G22 on chromosome X, complete sequence Length = 212659 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 96366 ggtgctggggatggaatccag 96346
>emb|AL671011.9| Mouse DNA sequence from clone RP23-95O23 on chromosome 4, complete sequence Length = 226950 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 350 ggtgctggggatggaatccag 370 ||||||||||||||||||||| Sbjct: 50889 ggtgctggggatggaatccag 50869
>emb|AL606930.13| Mouse DNA sequence from clone RP23-131D5 on chromosome 4, complete sequence Length = 133741 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 273 ggtgggaggagctggccttgg 293 ||||||||||||||||||||| Sbjct: 11612 ggtgggaggagctggccttgg 11632
>gb|AC163640.5| Mus musculus BAC clone RP24-182L3 from chromosome 16, complete sequence Length = 168350 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 151115 atggatggatagatagattc 151096
>gb|DQ223117.1| Alasmidonta heterodon microsatellite AheB104 sequence Length = 381 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 253 atggatggatagatagattc 234
>gb|AC103612.5| Mus musculus chromosome 5, clone RP24-455E13, complete sequence Length = 152420 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 31691 atggatggatagatagattc 31710
>gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold Length = 1743090 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 397 ggaagctggaggtgggccag 416 |||||||||||||||||||| Sbjct: 820203 ggaagctggaggtgggccag 820222
>gb|AC105080.8| Mus musculus chromosome 3, clone RP24-313N2, complete sequence Length = 195212 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 351 gtgctggggatggaatccag 370 |||||||||||||||||||| Sbjct: 161935 gtgctggggatggaatccag 161916
>gb|AC160961.3| Mus musculus BAC clone RP24-288N19 from chromosome 16, complete sequence Length = 157144 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 4593 atggatggatagatagattc 4574
>ref|XM_612582.2| PREDICTED: Bos taurus non-muscle myosin heavy chain (LOC404108), partial mRNA Length = 6279 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctgga 406 |||||||||||||||| ||||||| Sbjct: 2371 cctgaagaagatccgggagctgga 2394
>ref|XM_608513.2| PREDICTED: Bos taurus similar to smooth muscle myosin heavy chain 11 isoform SM1 (LOC530050), partial mRNA Length = 5243 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 383 cctgaagaagatccggaagctgga 406 |||||||||||||||| ||||||| Sbjct: 2076 cctgaagaagatccgggagctgga 2099
>gb|AC165278.4| Mus musculus chromosome 15, clone RP23-250O18, complete sequence Length = 187758 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 348 caggtgctggggatggaatc 367 |||||||||||||||||||| Sbjct: 156296 caggtgctggggatggaatc 156277
>gb|AC139571.2| Mus musculus BAC clone RP24-73K9 from chromosome 15, complete sequence Length = 210089 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 275 tgggaggagctggccttgga 294 |||||||||||||||||||| Sbjct: 142832 tgggaggagctggccttgga 142851
>ref|XM_847213.1| PREDICTED: Canis familiaris similar to sphingosine kinase type 1-interacting protein (LOC609866), mRNA Length = 4983 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 188 ttcttgctccattttgagcc 207 |||||||||||||||||||| Sbjct: 1521 ttcttgctccattttgagcc 1502
>gb|AC124390.4| Mus musculus BAC clone RP24-434C11 from chromosome 12, complete sequence Length = 162663 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 351 gtgctggggatggaatccag 370 |||||||||||||||||||| Sbjct: 8896 gtgctggggatggaatccag 8877
>gb|AC125315.4| Mus musculus BAC clone RP24-370B21 from chromosome 19, complete sequence Length = 155192 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 47959 atggatggatagatagattc 47940
>ref|XM_541685.2| PREDICTED: Canis familiaris similar to Nephrin precursor (Renal glomerulus-specific cell adhesion receptor) (LOC484571), mRNA Length = 4117 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 257 cccaggagccgcggagggtg 276 |||||||||||||||||||| Sbjct: 1472 cccaggagccgcggagggtg 1491
>gb|AC139356.17| Medicago truncatula clone mth2-12c11, complete sequence Length = 120921 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 89 agcaaggatcttttttcttt 108 |||||||||||||||||||| Sbjct: 112397 agcaaggatcttttttcttt 112416
>emb|AL691497.8| Human DNA sequence from clone RP11-542C10 on chromosome 1 Contains putative novel transcript, complete sequence Length = 174648 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 atcttttttcttttcctgga 115 |||||||||||||||||||| Sbjct: 153847 atcttttttcttttcctgga 153828
>gb|AC024382.7| Homo sapiens chromosome 8, clone RP11-351C8, complete sequence Length = 193599 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 gaagccaagaacagctccctccca 88 |||| ||||||||||||||||||| Sbjct: 154952 gaaggcaagaacagctccctccca 154975
>gb|AC130003.3| Homo sapiens 3 BAC RP11-705F7 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 129812 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 52684 atggatggatagatagattc 52703
>emb|BX064339.1|CNS09LT3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 870 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ccggcaggaggatttggtgctggt 188 ||||||||||||| |||||||||| Sbjct: 116 ccggcaggaggatgtggtgctggt 93
>gb|AC182435.3| Mus musculus chromosome 8, clone wi1-1119F24, complete sequence Length = 37516 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 351 gtgctggggatggaatccag 370 |||||||||||||||||||| Sbjct: 22824 gtgctggggatggaatccag 22843
>emb|BX032893.1|CNS08XJL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49AC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 772 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ccggcaggaggatttggtgctggt 188 ||||||||||||| |||||||||| Sbjct: 90 ccggcaggaggatgtggtgctggt 67
>emb|BX030441.1|CNS08VNH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA45BG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ccggcaggaggatttggtgctggt 188 ||||||||||||| |||||||||| Sbjct: 85 ccggcaggaggatgtggtgctggt 62
>emb|BX020588.1|CNS08O1S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA30BC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ccggcaggaggatttggtgctggt 188 ||||||||||||| |||||||||| Sbjct: 110 ccggcaggaggatgtggtgctggt 87
>emb|BX012879.1|CNS08I3N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA2BE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 890 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ccggcaggaggatttggtgctggt 188 ||||||||||||| |||||||||| Sbjct: 90 ccggcaggaggatgtggtgctggt 67
>gb|AC117806.11| Mus musculus chromosome 15, clone RP24-566D14, complete sequence Length = 194925 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 348 caggtgctggggatggaatc 367 |||||||||||||||||||| Sbjct: 15188 caggtgctggggatggaatc 15169
>emb|CR392008.7| Zebrafish DNA sequence from clone DKEY-97G11 in linkage group 5, complete sequence Length = 68693 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 5143 atggatggatagatagattc 5162
>emb|AL607131.15| Mouse DNA sequence from clone RP23-372H19 on chromosome 13 Contains the Agtr1a gene for angiotensin receptor 1a, a novel pseudogene and a CpG island, complete sequence Length = 172871 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 350 ggtgctggggatggaatcca 369 |||||||||||||||||||| Sbjct: 6211 ggtgctggggatggaatcca 6230
>emb|CR855279.1| Human DNA sequence from clone XX-NCIH2171_16D15, complete sequence Length = 122131 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 gaagccaagaacagctccctccca 88 |||| ||||||||||||||||||| Sbjct: 35637 gaaggcaagaacagctccctccca 35660
>gb|AC093903.3| Homo sapiens BAC clone RP11-733C7 from 4, complete sequence Length = 161280 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 97 tcttttttcttttcctggat 116 |||||||||||||||||||| Sbjct: 140598 tcttttttcttttcctggat 140617
>gb|AC106878.3| Homo sapiens BAC clone RP11-648O9 from 4, complete sequence Length = 135342 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 93 aggatcttttttcttttcct 112 |||||||||||||||||||| Sbjct: 50535 aggatcttttttcttttcct 50516
>gb|AF325177.1| Mus musculus BAC470L12 sequence Length = 205602 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 351 gtgctggggatggaatccag 370 |||||||||||||||||||| Sbjct: 26222 gtgctggggatggaatccag 26203
>gb|AC008494.8| Homo sapiens chromosome 5 clone CTC-428G20, complete sequence Length = 181800 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 269 ggagggtgggaggagctggc 288 |||||||||||||||||||| Sbjct: 99084 ggagggtgggaggagctggc 99065
>gb|AC094095.2| Homo sapiens chromosome 5 clone RP11-115D4, complete sequence Length = 162282 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 269 ggagggtgggaggagctggc 288 |||||||||||||||||||| Sbjct: 152404 ggagggtgggaggagctggc 152385
>gb|AC151520.3| Medicago truncatula chromosome 2 BAC clone mte1-34o12, complete sequence Length = 105113 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 89 agcaaggatcttttttcttt 108 |||||||||||||||||||| Sbjct: 6773 agcaaggatcttttttcttt 6792
>gb|AC156643.2| Mus musculus BAC clone RP23-192O3 from chromosome 12, complete sequence Length = 197420 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 351 gtgctggggatggaatccag 370 |||||||||||||||||||| Sbjct: 96248 gtgctggggatggaatccag 96267
>dbj|AK076907.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930547L11 product:retinitis pigmentosa 2 homolog, full insert sequence Length = 1615 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 347 tcaggtgctggggatggaatccag 370 ||||||||||||||||||| |||| Sbjct: 1211 tcaggtgctggggatggaacccag 1234
>gb|AC013416.4|AC013416 Homo sapiens BAC clone CTD-2522F11 from 7, complete sequence Length = 117927 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 341 tgctggtcaggtgctgggga 360 |||||||||||||||||||| Sbjct: 41314 tgctggtcaggtgctgggga 41333
>gb|AC146920.3| Otolemur garnettii clone CH256-154N14, complete sequence Length = 163387 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 397 ggaagctggaggtgggccag 416 |||||||||||||||||||| Sbjct: 94399 ggaagctggaggtgggccag 94418
>emb|BX284110.16| Zebrafish DNA sequence from clone DKEYP-67D7 in linkage group 10, complete sequence Length = 179798 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 121989 atggatggatagatagattc 122008
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 agattccaagtttccaaccc 34 |||||||||||||||||||| Sbjct: 7291409 agattccaagtttccaaccc 7291428
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 gattccaagtttccaacccc 35 |||||||||||||||||||| Sbjct: 29988395 gattccaagtttccaacccc 29988414
>gb|AC102799.9| Homo sapiens chromosome 17, clone CTD-2248E4, complete sequence Length = 122132 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 240 gagcggcctttcgagctccc 259 |||||||||||||||||||| Sbjct: 26502 gagcggcctttcgagctccc 26521
>gb|AC154310.2| Mus musculus BAC clone RP23-358E14 from chromosome 13, complete sequence Length = 176209 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 cagaagccaagaacagctcc 82 |||||||||||||||||||| Sbjct: 62965 cagaagccaagaacagctcc 62946
>emb|BX934363.1| Gallus gallus finished cDNA, clone ChEST668a11 Length = 1270 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 376 aggagctcctgaagaagatc 395 |||||||||||||||||||| Sbjct: 880 aggagctcctgaagaagatc 899
>dbj|AP003453.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0480C01 Length = 151100 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 gattccaagtttccaacccc 35 |||||||||||||||||||| Sbjct: 132953 gattccaagtttccaacccc 132972
>gb|AF289667.1|AF289667 Mus musculus GTF2IRD1 and CYLN2 genes, complete cds Length = 201605 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 351 gtgctggggatggaatccag 370 |||||||||||||||||||| Sbjct: 36940 gtgctggggatggaatccag 36959
>gb|AF289666.1|AF289666 Mus musculus GTF2I and GTF2IRD1 genes, partial cds Length = 130665 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 351 gtgctggggatggaatccag 370 |||||||||||||||||||| Sbjct: 123287 gtgctggggatggaatccag 123306
>gb|AE014133.1| Streptococcus mutans UA159, complete genome Length = 2030921 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 46 tacttgtttgctccacgcag 65 |||||||||||||||||||| Sbjct: 841383 tacttgtttgctccacgcag 841364
>emb|BX548006.10| Zebrafish DNA sequence from clone DKEY-127P11, complete sequence Length = 158134 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 151472 atggatggatagatagattc 151491
>gb|AC008585.4|AC008585 Homo sapiens chromosome 5 clone CTC-568C6, complete sequence Length = 86152 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 269 ggagggtgggaggagctggc 288 |||||||||||||||||||| Sbjct: 35926 ggagggtgggaggagctggc 35907
>dbj|AP004736.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0062A09 Length = 173541 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 agattccaagtttccaaccc 34 |||||||||||||||||||| Sbjct: 25372 agattccaagtttccaaccc 25391
>emb|BX005057.8| Zebrafish DNA sequence from clone DKEY-12L12 in linkage group 24, complete sequence Length = 238625 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 326 gattctggctcacgctgctg 345 |||||||||||||||||||| Sbjct: 9689 gattctggctcacgctgctg 9708
>ref|XM_312784.2| Anopheles gambiae str. PEST ENSANGP00000020450 (ENSANGG00000017961), mRNA Length = 1700 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 165 ccggcaggaggatttggtgctggt 188 ||||||||||||| |||||||||| Sbjct: 1603 ccggcaggaggatgtggtgctggt 1626
>gb|AC144364.3| Didelphis virginiana clone LB3-157N2, complete sequence Length = 140935 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 35801 atggatggatagatagattc 35820
>gb|AC005040.2|AC005040 Homo sapiens BAC clone RP11-519H15 from 2, complete sequence Length = 189949 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 99 ttttttcttttcctggattt 118 |||||||||||||||||||| Sbjct: 19310 ttttttcttttcctggattt 19291
>gb|AC154311.2| Mus musculus BAC clone RP23-359C9 from 16, complete sequence Length = 194103 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 351 gtgctggggatggaatccag 370 |||||||||||||||||||| Sbjct: 70063 gtgctggggatggaatccag 70082
>emb|BX649256.12| Zebrafish DNA sequence from clone DKEYP-92A5 in linkage group 22, complete sequence Length = 128446 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 14459 atggatggatagatagattc 14478
>emb|BX957285.9| Zebrafish DNA sequence from clone CH211-160M18 in linkage group 10, complete sequence Length = 156078 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 tagatagattccaagtttcc 29 |||||||||||||||||||| Sbjct: 111515 tagatagattccaagtttcc 111534
>emb|AL049869.6|CNS0000P Human chromosome 14 DNA sequence BAC R-973N13 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 195840 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 ggatcttttttcttttcctg 113 |||||||||||||||||||| Sbjct: 67781 ggatcttttttcttttcctg 67800
>gb|AC172623.3| Mus musculus chromosome 8, clone RP23-478A9, complete sequence Length = 182316 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 351 gtgctggggatggaatccag 370 |||||||||||||||||||| Sbjct: 2951 gtgctggggatggaatccag 2932
>gb|AC151602.4| Mus musculus BAC clone RP23-218K15 from chromosome 7, complete sequence Length = 249504 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 351 gtgctggggatggaatccag 370 |||||||||||||||||||| Sbjct: 173209 gtgctggggatggaatccag 173190
>dbj|AP003155.1| Mus musculus genomic DNA, chromosome 16q clone:RP21-567F3, complete sequences Length = 157385 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 28114 atggatggatagatagattc 28095
>emb|CR456623.14| Zebrafish DNA sequence from clone DKEY-100N10 in linkage group 12, complete sequence Length = 167475 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 51657 atggatggatagatagattc 51676
>emb|AL837524.9| Zebrafish DNA sequence from clone DKEY-50P8, complete sequence Length = 202158 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 41733 atggatggatagatagattc 41752
>emb|CT009728.8| Mouse DNA sequence from clone RP23-57I20 on chromosome 13, complete sequence Length = 202072 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 cagaagccaagaacagctcc 82 |||||||||||||||||||| Sbjct: 34938 cagaagccaagaacagctcc 34957
>gb|U21942.1|SMU21942 Streptococcus mutans galactokinase, galactose-1-P-uridyl transferase and UDP-galactose 4-epimerase genes, complete cds Length = 5259 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 46 tacttgtttgctccacgcag 65 |||||||||||||||||||| Sbjct: 3280 tacttgtttgctccacgcag 3261
>gb|AC167419.4| Mus musculus BAC clone RP24-359H20 from chromosome 5, complete sequence Length = 179790 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 351 gtgctggggatggaatccag 370 |||||||||||||||||||| Sbjct: 77748 gtgctggggatggaatccag 77767
>gb|DP000023.1| Didelphis virginiana target 1 genomic scaffold Length = 1751794 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 atggatggatagatagattc 20 |||||||||||||||||||| Sbjct: 35801 atggatggatagatagattc 35820
>emb|AL928578.6| Mouse DNA sequence from clone RP23-33L19 on chromosome 2, complete sequence Length = 190906 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 351 gtgctggggatggaatccag 370 |||||||||||||||||||| Sbjct: 28105 gtgctggggatggaatccag 28086 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,009,769 Number of Sequences: 3902068 Number of extensions: 6009769 Number of successful extensions: 155658 Number of sequences better than 10.0: 150 Number of HSP's better than 10.0 without gapping: 150 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 155081 Number of HSP's gapped (non-prelim): 576 length of query: 416 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 394 effective length of database: 17,147,199,772 effective search space: 6755996710168 effective search space used: 6755996710168 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)