>gb|AF506522.2| Streptomyces hygroscopicus AHBA biosynthetic gene cluster, partial
             sequence
          Length = 22131

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 81    cggaggaggcggcggttgctcggc 104
             ||||||||||||||||||||||||
Sbjct: 11140 cggaggaggcggcggttgctcggc 11163



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 81   cggaggaggcggcggttgctcggc 104
            ||||||||| ||||||||||||||
Sbjct: 4574 cggaggaggaggcggttgctcggc 4597

>dbj|AK128712.1| Homo sapiens cDNA FLJ46879 fis, clone UTERU3015011, highly  similar
           to Paxillin
          Length = 4132

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 70  ggcagaggagccggaggaggcggcgg 95
           |||||||||||||| |||||||||||
Sbjct: 334 ggcagaggagccggcggaggcggcgg 359

>gb|AC004263.1|AC004263 Homo sapiens PAC clone 278C19 from 12q, complete sequence
          Length = 106921

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 70    ggcagaggagccggaggaggcggcgg 95
             |||||||||||||| |||||||||||
Sbjct: 24674 ggcagaggagccggcggaggcggcgg 24649

>dbj|AB209034.1| Homo sapiens mRNA for Paxillin variant protein
          Length = 5457

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 70   ggcagaggagccggaggaggcggcgg 95
            |||||||||||||| |||||||||||
Sbjct: 1967 ggcagaggagccggcggaggcggcgg 1992

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 295     cgccggccccggcctcgccac 315
               |||||||||||||||||||||
Sbjct: 3142845 cgccggccccggcctcgccac 3142865

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 57     cggcgcggcgaccggcagagg 77
              |||||||||||||||||||||
Sbjct: 439270 cggcgcggcgaccggcagagg 439250

>ref|XM_421225.1| PREDICTED: Gallus gallus similar to Striatin 3 (Cell-cycle
          autoantigen SG2NA) (S/G2 antigen) (LOC423308), mRNA
          Length = 2769

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 76 ggagccggaggaggcggcgg 95
          ||||||||||||||||||||
Sbjct: 16 ggagccggaggaggcggcgg 35

>ref|XM_426003.1| PREDICTED: Gallus gallus similar to eomesodermin; t box, brain,
          2; eomesodermin (Xenopus laevis) homolog (LOC428443),
          mRNA
          Length = 2064

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 76 ggagccggaggaggcggcgg 95
          ||||||||||||||||||||
Sbjct: 70 ggagccggaggaggcggcgg 89

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 178     gtgtggtgcgggccgacgatggca 201
               ||||||||| ||||||||||||||
Sbjct: 3654917 gtgtggtgctggccgacgatggca 3654894

>gb|AY328023.1|AY328003S21 Symbiont bacterium of Paederus fuscipes putative isocitrate
             dehydrogenase kinase/phosphatase gene, partial cds; and
             putative dioxygenase, putative pederin biosynthesis mixed
             type I polyketide synthase/nonribosomal peptide synthetase
             gene cluster, hypothetical protein, putative RNA
             methylase, hypothetical protein, and putative aldehyde
             dehydrogenase genes, complete cds
          Length = 75778

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 53    cacccggcgcggcgaccggc 72
             ||||||||||||||||||||
Sbjct: 42000 cacccggcgcggcgaccggc 41981

>ref|XM_542191.2| PREDICTED: Canis familiaris similar to Histone-lysine
            N-methyltransferase, H3 lysine-79 specific (Histone
            H3-K79 methyltransferase) (H3-K79-HMTase) (DOT1-like
            protein) (LOC485073), mRNA
          Length = 6539

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 298  cggccccggcctcgccacgg 317
            ||||||||||||||||||||
Sbjct: 4557 cggccccggcctcgccacgg 4576

>gb|AY128463.1| Drosophila melanogaster RE18773 full insert cDNA
          Length = 5617

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 70   ggcagaggagccggaggagg 89
            ||||||||||||||||||||
Sbjct: 1721 ggcagaggagccggaggagg 1740

>gb|AC093192.2| Drosophila melanogaster 3L BAC RP98-48J18 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 166862

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    ggcagaggagccggaggagg 89
             ||||||||||||||||||||
Sbjct: 13810 ggcagaggagccggaggagg 13829

>gb|AC010564.7| Drosophila melanogaster 3L BAC RP98-27O1 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 196594

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 70     ggcagaggagccggaggagg 89
              ||||||||||||||||||||
Sbjct: 184232 ggcagaggagccggaggagg 184251

>ref|NM_206232.1| Drosophila melanogaster CG7852-RC, transcript variant C (CG7852),
            mRNA
          Length = 5600

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 70   ggcagaggagccggaggagg 89
            ||||||||||||||||||||
Sbjct: 1721 ggcagaggagccggaggagg 1740

>ref|NM_167890.1| Drosophila melanogaster CG7852-RB, transcript variant B (CG7852),
            mRNA
          Length = 5385

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 70   ggcagaggagccggaggagg 89
            ||||||||||||||||||||
Sbjct: 1725 ggcagaggagccggaggagg 1744

>ref|NM_139363.1| Drosophila melanogaster CG7852-RA, transcript variant A (CG7852),
            mRNA
          Length = 5381

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 70   ggcagaggagccggaggagg 89
            ||||||||||||||||||||
Sbjct: 1721 ggcagaggagccggaggagg 1740

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 176     aggtgtggtgcgggccgacg 195
               ||||||||||||||||||||
Sbjct: 2672869 aggtgtggtgcgggccgacg 2672850

>gb|AC004971.3| Homo sapiens PAC clone RP5-1125K23 from 7, complete sequence
          Length = 123253

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 295    cgccggccccggcctcgccacggc 318
              |||||||||||||||| |||||||
Sbjct: 122670 cgccggccccggcctccccacggc 122647

>gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome I,
              complete sequence
          Length = 691920

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 76     ggagccggaggaggcggcgg 95
              ||||||||||||||||||||
Sbjct: 481400 ggagccggaggaggcggcgg 481419

>gb|AF521897.1| Streptomyces hygroscopicus ansamycin biosynthesis gene cluster,
            partial sequence
          Length = 6567

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 81   cggaggaggcggcggttgctcggc 104
            ||||||||| ||||||||||||||
Sbjct: 4571 cggaggaggaggcggttgctcggc 4594

>ref|NM_207970.1| Eremothecium gossypii AAR076Cp (AAR076C), mRNA
          Length = 660

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 76  ggagccggaggaggcggcgg 95
           ||||||||||||||||||||
Sbjct: 444 ggagccggaggaggcggcgg 425

>gb|AE003472.1| Drosophila melanogaster chromosome 3L, section 6 of 83 of the
            complete sequence
          Length = 303191

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 70   ggcagaggagccggaggagg 89
            ||||||||||||||||||||
Sbjct: 5197 ggcagaggagccggaggagg 5216

>gb|AC004333.1|AC004333 Drosophila melanogaster DNA sequence (P1 DS05969 (D229)), complete
             sequence
          Length = 63178

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    ggcagaggagccggaggagg 89
             ||||||||||||||||||||
Sbjct: 27957 ggcagaggagccggaggagg 27938


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 970,147
Number of Sequences: 3902068
Number of extensions: 970147
Number of successful extensions: 29213
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29016
Number of HSP's gapped (non-prelim): 197
length of query: 342
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 320
effective length of database: 17,147,199,772
effective search space: 5487103927040
effective search space used: 5487103927040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)