>gb|AY596621.1| Saccharum officinarum clone SCJFRZ1007E03, complete sequence
          Length = 1068

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 60 gagcgagtactactagtact 79
          ||||||||||||||||||||
Sbjct: 3  gagcgagtactactagtact 22

>gb|AC073583.19| Homo sapiens Xp BAC RP11-483M24 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 179187

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 238   tgcttcctcgcccacttttc 257
             ||||||||||||||||||||
Sbjct: 53683 tgcttcctcgcccacttttc 53664

>emb|AL645570.13| Mouse DNA sequence from clone RP23-377H12 on chromosome 11 Contains two
              novel genes, the 3' end of the Meis1 gene for myeloid
              ecotropic viral integration site 1 and two CpG islands,
              complete sequence
          Length = 190198

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 203    caattttgtctcggaagaat 222
              ||||||||||||||||||||
Sbjct: 101837 caattttgtctcggaagaat 101818

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 58      cggagcgagtactactagta 77
               ||||||||||||||||||||
Sbjct: 1992846 cggagcgagtactactagta 1992827

>dbj|AP005620.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0680F05
          Length = 185495

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     cggagcgagtactactagta 77
              ||||||||||||||||||||
Sbjct: 118044 cggagcgagtactactagta 118025


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,641,016
Number of Sequences: 3902068
Number of extensions: 2641016
Number of successful extensions: 48180
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48150
Number of HSP's gapped (non-prelim): 30
length of query: 414
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 392
effective length of database: 17,147,199,772
effective search space: 6721702310624
effective search space used: 6721702310624
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)