>emb|CR974457.17| Mouse DNA sequence from clone RP23-319E15 on chromosome 17, complete
             sequence
          Length = 124639

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     ccgtccctctggtctacctc 28
             ||||||||||||||||||||
Sbjct: 53628 ccgtccctctggtctacctc 53609

>gb|AF050157.1|MMHC135G15 Mus musculus major histocompatibility locus class II region: major
             histocompatibility protein class II alpha chain (IAalpha)
             and major histocompatibility protein class II beta chain
             (IEbeta) genes, complete cds; butyrophilin-like (NG9),
             butyrophilin-like (NG10), hypothetical protein (NG8), and
             butyrophilin-like (NG11) genes, partial cds; NG12
             pseudogene, partial sequence; and hypothetical
             butyrophilin-like protein (NG13) gene, partial cds
          Length = 245439

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     ccgtccctctggtctacctc 28
             ||||||||||||||||||||
Sbjct: 94796 ccgtccctctggtctacctc 94777

>ref|XM_788855.1| PREDICTED: Strongylocentrotus purpuratus similar to dynein, axonemal,
            heavy polypeptide 3 (LOC589206), partial mRNA
          Length = 2967

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 34   aagccacacccccagtgag 52
            |||||||||||||||||||
Sbjct: 1735 aagccacacccccagtgag 1717

>emb|BX572093.1| Prochlorococcus marinus MED4 complete genome; segment 4/5
          Length = 348986

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     aaggcggaggaaaaataaa 72
              |||||||||||||||||||
Sbjct: 114390 aaggcggaggaaaaataaa 114408

>emb|AL445623.2|HS315I14 Homo sapiens chromosome 9 BAC RP11-315I14, complete sequence
          Length = 198637

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 59     ggaggaaaaataaattata 77
              |||||||||||||||||||
Sbjct: 119757 ggaggaaaaataaattata 119775

>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026
          Length = 2324132

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 13      ccctctggtctacctcgag 31
               |||||||||||||||||||
Sbjct: 1396605 ccctctggtctacctcgag 1396587

>gb|AC020616.7| Mus musculus strain C57BL/6J clone RP23-3A24, complete sequence
          Length = 191243

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 59    ggaggaaaaataaattatacccg 81
             |||||||||||||||| ||||||
Sbjct: 96916 ggaggaaaaataaattttacccg 96938

>emb|CR388140.8| Zebrafish DNA sequence from clone CH211-190G11, complete sequence
          Length = 160541

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 59    ggaggaaaaataaattata 77
             |||||||||||||||||||
Sbjct: 13575 ggaggaaaaataaattata 13593

>emb|AL845426.9| Mouse DNA sequence from clone RP23-289M11 on chromosome 2, complete
             sequence
          Length = 181434

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 59    ggaggaaaaataaattatacccg 81
             |||||||||||||||| ||||||
Sbjct: 26966 ggaggaaaaataaattttacccg 26988

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 78     cccggaaaaggacaaacga 96
              |||||||||||||||||||
Sbjct: 611868 cccggaaaaggacaaacga 611886


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,970,116
Number of Sequences: 3902068
Number of extensions: 1970116
Number of successful extensions: 122853
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 122814
Number of HSP's gapped (non-prelim): 39
length of query: 129
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 108
effective length of database: 17,151,101,840
effective search space: 1852318998720
effective search space used: 1852318998720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)