ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl41h08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_191424.1| Oryza sativa (japonica cultivar-group), predic... 68 2e-08
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 60 6e-06
3dbj|AP003295.4| Oryza sativa (japonica cultivar-group) genomic D... 60 6e-06
4dbj|AP003106.1| Oryza sativa (japonica cultivar-group) genomic D... 60 6e-06
5ref|XM_527529.1| PREDICTED: Pan troglodytes similar to peptidylp... 42 1.3
6gb|BC097250.1| Danio rerio zgc:114203, mRNA (cDNA clone MGC:1142... 42 1.3
7ref|NM_138785.1| Homo sapiens chromosome 6 open reading frame 72... 42 1.3
8ref|NM_001030267.1| Danio rerio zgc:114203 (zgc:114203), mRNA 42 1.3
9gb|AY358952.1| Homo sapiens clone DNA60783 EGAP710 (UNQ710) mRNA... 42 1.3
10emb|AL078581.11|HSDJ12G14 Human DNA sequence from clone RP1-12G1... 42 1.3
11gb|BC014320.1| Homo sapiens chromosome 6 open reading frame 72, ... 42 1.3
12emb|CR595369.1| full-length cDNA clone CS0DI041YA22 of Placenta ... 42 1.3
13emb|CR595295.1| full-length cDNA clone CS0DB005YB15 of Neuroblas... 42 1.3
14gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 1.3
15gb|AC170875.2| Mus musculus BAC clone RP24-266D3 from chromosome... 40 5.1
16gb|AC166931.3| Mus musculus chromosome 8, clone wi1-2751F18, com... 40 5.1
17gb|AC102481.10| Mus musculus chromosome 1, clone RP24-427A3, com... 40 5.1
18ref|XM_509960.1| PREDICTED: Pan troglodytes similar to suppresso... 40 5.1
19ref|NM_187599.1| Oryza sativa (japonica cultivar-group), predic... 40 5.1
20gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 40 5.1
21gb|AC162446.2| Mus musculus chromosome 8, clone RP23-410L16, com... 40 5.1
22gb|AC164600.5| Mus musculus chromosome 1, clone RP23-366M5, comp... 40 5.1
23gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 5.1
24ref|XM_539418.2| PREDICTED: Canis familiaris similar to ocular d... 40 5.1
25emb|Z69885.1|CET04C10 Caenorhabditis elegans Cosmid T04C10, comp... 40 5.1
26gb|AC107226.2| Oryza sativa (japonica cultivar-group) chromosome... 40 5.1
27gb|AC102031.7| Mus musculus chromosome 3, clone RP23-14C8, compl... 40 5.1
28emb|AL160398.27| Human DNA sequence from clone RP11-15N12 on chr... 40 5.1
29emb|BX569689.1| Synechococcus sp. WH8102 complete genome; segmen... 40 5.1
30emb|BX649493.8| Zebrafish DNA sequence from clone CH211-226H23 i... 40 5.1
31gb|DQ397852.1| Cenarchaeum symbiosum clone C15D08, complete sequ... 40 5.1
32gb|DQ397850.1| Cenarchaeum symbiosum clone C09B07, complete sequ... 40 5.1
33gb|DQ397849.1| Cenarchaeum symbiosum clone C08E01, complete sequ... 40 5.1
34dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.1
35gb|AC104698.2| Homo sapiens BAC clone RP11-517F1 from 2, complet... 40 5.1
36gb|AC007058.2|AC007058 Homo sapiens chromosome 14 clone containi... 40 5.1
37dbj|AK104423.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.1
38dbj|AK070170.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.1
39emb|AJ307029.1|BTA307029 Bos taurus partial COL1A1 gene for pro ... 40 5.1
40emb|AL139316.5|CNS01DXH Human chromosome 14 DNA sequence BAC R-6... 40 5.1
41gb|AF031421.1|HSLGALS3S1 Homo sapiens galectin 3 (LGALS3) gene, ... 40 5.1 
>ref|NM_191424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 3327

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 134 atggtgactcctcgcgcccccgagccgccgccgcaggaccaggatgaggagatgctggtg 193
           |||||||| || ||||| |||||||  | || ||||||||||||||||||||||||||||
Sbjct: 1   atggtgaccccgcgcgcacccgagctcctgcagcaggaccaggatgaggagatgctggtg 60

             
Query: 194 cc 195
           ||
Sbjct: 61  cc 62
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                              
Query: 166      gcaggaccaggatgaggagatgctggtgcc 195
                ||||||||||||||||||||||||||||||
Sbjct: 32562599 gcaggaccaggatgaggagatgctggtgcc 32562570
to top
>dbj|AP003295.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0695H10
          Length = 136883

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                           
Query: 166   gcaggaccaggatgaggagatgctggtgcc 195
             ||||||||||||||||||||||||||||||
Sbjct: 25394 gcaggaccaggatgaggagatgctggtgcc 25365
to top
>dbj|AP003106.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0665A11
          Length = 166421

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                            
Query: 166    gcaggaccaggatgaggagatgctggtgcc 195
              ||||||||||||||||||||||||||||||
Sbjct: 150120 gcaggaccaggatgaggagatgctggtgcc 150091
to top
>ref|XM_527529.1| PREDICTED: Pan troglodytes similar to peptidylprolyl isomerase-like
           4; serologically defined breast cancer antigen NY-BR-18;
           PPIase; cyclophilin-type peptidyl-prolyl cis-trans
           isomerase (LOC472150), mRNA
          Length = 2313

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 147 gcgcccccgagccgccgccgc 167
           |||||||||||||||||||||
Sbjct: 354 gcgcccccgagccgccgccgc 334
to top
>gb|BC097250.1| Danio rerio zgc:114203, mRNA (cDNA clone MGC:114203 IMAGE:7433540),
           complete cds
          Length = 1752

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 agccgccgccgcaggaccagg 176
           |||||||||||||||||||||
Sbjct: 443 agccgccgccgcaggaccagg 463
to top
>ref|NM_138785.1| Homo sapiens chromosome 6 open reading frame 72 (C6orf72), mRNA
          Length = 1143

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 147 gcgcccccgagccgccgccgc 167
           |||||||||||||||||||||
Sbjct: 110 gcgcccccgagccgccgccgc 130
to top
>ref|NM_001030267.1| Danio rerio zgc:114203 (zgc:114203), mRNA
          Length = 1752

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 agccgccgccgcaggaccagg 176
           |||||||||||||||||||||
Sbjct: 443 agccgccgccgcaggaccagg 463
to top
>gb|AY358952.1| Homo sapiens clone DNA60783 EGAP710 (UNQ710) mRNA, complete cds
          Length = 1215

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 147 gcgcccccgagccgccgccgc 167
           |||||||||||||||||||||
Sbjct: 224 gcgcccccgagccgccgccgc 244
to top
>emb|AL078581.11|HSDJ12G14 Human DNA sequence from clone RP1-12G14 on chromosome 6q24.1-25.2
             Contains the 5' end of the PPIL4 gene for peptidylprolyl
             isomerase (cyclophilin)-like 4 (HDCME13P ), a novel gene
             (LOC116254), a ribosomal protein S18 (RPS18) pseudogene,
             the KATNA1 gene for katanin p60 (ATPase-containing)
             subunit A 1, three novel genes and two CpG islands,
             complete sequence
          Length = 102019

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 147   gcgcccccgagccgccgccgc 167
             |||||||||||||||||||||
Sbjct: 43108 gcgcccccgagccgccgccgc 43128
to top
>gb|BC014320.1| Homo sapiens chromosome 6 open reading frame 72, mRNA (cDNA clone
           MGC:22821 IMAGE:3686673), complete cds
          Length = 1143

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 147 gcgcccccgagccgccgccgc 167
           |||||||||||||||||||||
Sbjct: 110 gcgcccccgagccgccgccgc 130
to top
>emb|CR595369.1| full-length cDNA clone CS0DI041YA22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1183

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 147 gcgcccccgagccgccgccgc 167
           |||||||||||||||||||||
Sbjct: 142 gcgcccccgagccgccgccgc 162
to top
>emb|CR595295.1| full-length cDNA clone CS0DB005YB15 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1070

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 147 gcgcccccgagccgccgccgc 167
           |||||||||||||||||||||
Sbjct: 74  gcgcccccgagccgccgccgc 94
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 147   gcgcccccgagccgccgccgc 167
             |||||||||||||||||||||
Sbjct: 80730 gcgcccccgagccgccgccgc 80710
to top
>gb|AC170875.2| Mus musculus BAC clone RP24-266D3 from chromosome 3, complete sequence
          Length = 155248

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 341   cactctgatgtttttgttgt 360
             ||||||||||||||||||||
Sbjct: 99096 cactctgatgtttttgttgt 99077
to top
>gb|AC166931.3| Mus musculus chromosome 8, clone wi1-2751F18, complete sequence
          Length = 44136

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 127   catgaccatggtgactcctc 146
             ||||||||||||||||||||
Sbjct: 22624 catgaccatggtgactcctc 22643
to top
>gb|AC102481.10| Mus musculus chromosome 1, clone RP24-427A3, complete sequence
          Length = 145973

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 297  catggaagattgaaagtata 316
            ||||||||||||||||||||
Sbjct: 1812 catggaagattgaaagtata 1793
to top
>ref|XM_509960.1| PREDICTED: Pan troglodytes similar to suppressor of cytokine
            signaling 4; suppressor of cytokine signaling 7; SH2
            domain containing SOCS box protein (LOC452919), mRNA
          Length = 3772

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 151  ccccgagccgccgccgcagg 170
            ||||||||||||||||||||
Sbjct: 2052 ccccgagccgccgccgcagg 2033
to top
>ref|NM_187599.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1020

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 154 cgagccgccgccgcaggacc 173
           ||||||||||||||||||||
Sbjct: 613 cgagccgccgccgcaggacc 594
to top
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 65      cccgcggcgatcgtcgacgc 84
               ||||||||||||||||||||
Sbjct: 2544568 cccgcggcgatcgtcgacgc 2544587
to top
>gb|AC162446.2| Mus musculus chromosome 8, clone RP23-410L16, complete sequence
          Length = 197906

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 127  catgaccatggtgactcctc 146
            ||||||||||||||||||||
Sbjct: 4517 catgaccatggtgactcctc 4536
to top
>gb|AC164600.5| Mus musculus chromosome 1, clone RP23-366M5, complete sequence
          Length = 191581

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 297   catggaagattgaaagtata 316
             ||||||||||||||||||||
Sbjct: 61232 catggaagattgaaagtata 61251
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 154     cgagccgccgccgcaggacc 173
               ||||||||||||||||||||
Sbjct: 6514083 cgagccgccgccgcaggacc 6514102
to top
>ref|XM_539418.2| PREDICTED: Canis familiaris similar to ocular
           development-associated gene (LOC482301), mRNA
          Length = 1237

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 148 cgcccccgagccgccgccgc 167
           ||||||||||||||||||||
Sbjct: 504 cgcccccgagccgccgccgc 485
to top
>emb|Z69885.1|CET04C10 Caenorhabditis elegans Cosmid T04C10, complete sequence
          Length = 20958

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 344  tctgatgtttttgttgtcgg 363
            ||||||||||||||||||||
Sbjct: 2756 tctgatgtttttgttgtcgg 2737
to top
>gb|AC107226.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0081P02, complete sequence
          Length = 162425

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   cgagccgccgccgcaggacc 173
             ||||||||||||||||||||
Sbjct: 56845 cgagccgccgccgcaggacc 56864
to top
>gb|AC102031.7| Mus musculus chromosome 3, clone RP23-14C8, complete sequence
          Length = 181179

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 341    cactctgatgtttttgttgt 360
              ||||||||||||||||||||
Sbjct: 166542 cactctgatgtttttgttgt 166561
to top
>emb|AL160398.27| Human DNA sequence from clone RP11-15N12 on chromosome 6 Contains the
             5' end of the gene for the possible ortholog of R.
             norvegicus ion transporter protein (NRITP), complete
             sequence
          Length = 134995

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 339   tccactctgatgtttttgtt 358
             ||||||||||||||||||||
Sbjct: 41535 tccactctgatgtttttgtt 41516
to top
>emb|BX569689.1| Synechococcus sp. WH8102 complete genome; segment 1/7
          Length = 348764

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 158    ccgccgccgcaggaccagga 177
              ||||||||||||||||||||
Sbjct: 214687 ccgccgccgcaggaccagga 214668
to top
>emb|BX649493.8| Zebrafish DNA sequence from clone CH211-226H23 in linkage group 2,
              complete sequence
          Length = 175551

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 272    cctgatgcatcaacttccagattt 295
              |||||||||||||||||| |||||
Sbjct: 148086 cctgatgcatcaacttcctgattt 148063
to top
>gb|DQ397852.1| Cenarchaeum symbiosum clone C15D08, complete sequence
          Length = 38754

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 63    gccccgcggcgatcgtcgac 82
             ||||||||||||||||||||
Sbjct: 24468 gccccgcggcgatcgtcgac 24449
to top
>gb|DQ397850.1| Cenarchaeum symbiosum clone C09B07, complete sequence
          Length = 40824

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 63    gccccgcggcgatcgtcgac 82
             ||||||||||||||||||||
Sbjct: 19012 gccccgcggcgatcgtcgac 19031
to top
>gb|DQ397849.1| Cenarchaeum symbiosum clone C08E01, complete sequence
          Length = 37303

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 63    gccccgcggcgatcgtcgac 82
             ||||||||||||||||||||
Sbjct: 32712 gccccgcggcgatcgtcgac 32693
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 154     cgagccgccgccgcaggacc 173
               ||||||||||||||||||||
Sbjct: 6513296 cgagccgccgccgcaggacc 6513315
to top
>gb|AC104698.2| Homo sapiens BAC clone RP11-517F1 from 2, complete sequence
          Length = 115170

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 146   cgcgcccccgagccgccgcc 165
             ||||||||||||||||||||
Sbjct: 29985 cgcgcccccgagccgccgcc 30004
to top
>gb|AC007058.2|AC007058 Homo sapiens chromosome 14 clone containing intron for neurexin III,
             complete sequence
          Length = 95956

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 332   agaaagatccactctgatgt 351
             ||||||||||||||||||||
Sbjct: 44375 agaaagatccactctgatgt 44394
to top
>dbj|AK104423.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-E09, full
           insert sequence
          Length = 1319

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 154 cgagccgccgccgcaggacc 173
           ||||||||||||||||||||
Sbjct: 677 cgagccgccgccgcaggacc 658
to top
>dbj|AK070170.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023041A11, full
           insert sequence
          Length = 1329

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 154 cgagccgccgccgcaggacc 173
           ||||||||||||||||||||
Sbjct: 680 cgagccgccgccgcaggacc 661
to top
>emb|AJ307029.1|BTA307029 Bos taurus partial COL1A1 gene for pro alpha 1(I) collagen, exon 1
            and joined CDS
          Length = 5417

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 21   ctctcccctaaaccctagca 40
            ||||||||||||||||||||
Sbjct: 3011 ctctcccctaaaccctagca 2992
to top
>emb|AL139316.5|CNS01DXH Human chromosome 14 DNA sequence BAC R-698F20 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 192440

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 151   ccccgagccgccgccgcagg 170
             ||||||||||||||||||||
Sbjct: 97250 ccccgagccgccgccgcagg 97269
to top
>gb|AF031421.1|HSLGALS3S1 Homo sapiens galectin 3 (LGALS3) gene, exon 1
          Length = 1403

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 151 ccccgagccgccgccgcagg 170
           ||||||||||||||||||||
Sbjct: 704 ccccgagccgccgccgcagg 685


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,962,407
Number of Sequences: 3902068
Number of extensions: 2962407
Number of successful extensions: 56992
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56673
Number of HSP's gapped (non-prelim): 319
length of query: 383
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 361
effective length of database: 17,147,199,772
effective search space: 6190139117692
effective search space used: 6190139117692
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top