ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl41a06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK070398.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 5e-24
2gb|AC145477.2| Oryza sativa (japonica cultivar-group) chromosome... 96 8e-17
3gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome... 96 8e-17
4dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 96 8e-17
5ref|NM_121194.2| Arabidopsis thaliana catalytic AT5G11560 mRNA, ... 52 0.001
6emb|BX932832.1| Gallus gallus finished cDNA, clone ChEST276k16 50 0.004
7gb|AY714813.1| Cercopithecine herpesvirus 2, complete genome 42 1.0
8ref|NM_001004367.2| Mus musculus CXXC finger 4 (Cxxc4), mRNA 42 1.0
9gb|BC082332.1| Mus musculus CXXC finger 4, mRNA (cDNA clone MGC:... 42 1.0
10gb|BC067052.1| Mus musculus CXXC finger 4, mRNA (cDNA clone MGC:... 42 1.0
11ref|XM_415471.1| PREDICTED: Gallus gallus similar to chromosome ... 42 1.0
12gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 42 1.0
13gb|BC065149.1| Mus musculus CXXC finger 4, mRNA (cDNA clone IMAG... 42 1.0
14ref|XM_984932.1| PREDICTED: Mus musculus CXXC finger 4 (Cxxc4), ... 42 1.0
15ref|XM_541615.2| PREDICTED: Canis familiaris similar to Periaxin... 42 1.0
16emb|CR759881.16| Zebrafish DNA sequence from clone CH211-165K16 ... 42 1.0
17gb|AC164408.4| Mus musculus chromosome 3, clone RP23-384A11, com... 42 1.0
18gb|AC119840.12| Mus musculus chromosome 3, clone RP24-112E5, com... 42 1.0
19gb|AE012355.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 1.0
20dbj|AK136882.1| Mus musculus adult male diencephalon cDNA, RIKEN... 42 1.0
21gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 42 1.0
22dbj|AK038550.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 42 1.0
23gb|AY757327.1| Oreochromis niloticus isolate B6a Hox protein gen... 42 1.0
24gb|AF272158.1|AF272158 Rattus norvegicus Dvl-binding protein Ida... 42 1.0
25ref|NM_053342.1| Rattus norvegicus CXXC finger 4 (Cxxc4), mRNA 42 1.0
26emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromo... 42 1.0
27gb|U70053.1|XCU70053 Xanthomonas campestris gumN, gumO and gumP ... 42 1.0
28gb|DQ215390.1| Taeniopygia guttata clone 0058P0059G11 chromosome... 40 4.0
29gb|DQ215389.1| Taeniopygia guttata clone 0061P0002H10 chromosome... 40 4.0
30gb|AC121363.2| Oryza sativa (japonica cultivar-group) chromosome... 40 4.0
31gb|AC113271.10| Mus musculus chromosome 5, clone RP23-376H8, com... 40 4.0
32gb|AC104631.2| Drosophila melanogaster clone BACR35D19, complete... 40 4.0
33ref|XM_591904.2| PREDICTED: Bos taurus similar to alpha-2-plasmi... 40 4.0
34gb|AY596618.1| Saccharum officinarum clone SCCCCL4009G04, comple... 40 4.0
35gb|AC130726.2| Oryza sativa (japonica cultivar-group) chromosome... 40 4.0
36gb|BC062176.1| Mus musculus RIKEN cDNA 2400003N08 gene, mRNA (cD... 40 4.0
37gb|AC132418.3| Mus musculus BAC clone RP23-251N2 from chromosome... 40 4.0
38ref|XM_384357.1| Gibberella zeae PH-1 chromosome 2 conserved hyp... 40 4.0
39emb|CR716878.2|CNS0GG3B Tetraodon nigroviridis full-length cDNA 40 4.0
40gb|BC055764.1| Mus musculus RIKEN cDNA 2400003N08 gene, mRNA (cD... 40 4.0
41gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 4.0
42emb|BX072038.1|CNS09RQY Single read from an extremity of a full-... 40 4.0
43emb|BX072037.1|CNS09RQX Single read from an extremity of a full-... 40 4.0
44emb|BX071074.1|CNS09R06 Single read from an extremity of a full-... 40 4.0
45emb|BX071073.1|CNS09R05 Single read from an extremity of a full-... 40 4.0
46emb|BX069043.1|CNS09PFR Single read from an extremity of a full-... 40 4.0
47emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-... 40 4.0
48emb|BX065976.1|CNS09N2K Single read from an extremity of a full-... 40 4.0
49emb|BX065975.1|CNS09N2J Single read from an extremity of a full-... 40 4.0
50emb|BX064684.1|CNS09M2O Single read from an extremity of a full-... 40 4.0
51emb|BX063673.1|CNS09LAL Single read from an extremity of a full-... 40 4.0
52emb|BX061993.1|CNS09JZX Single read from an extremity of a full-... 40 4.0
53emb|BX061992.1|CNS09JZW Single read from an extremity of a full-... 40 4.0
54emb|BX058974.1|CNS09HO2 Single read from an extremity of a full-... 40 4.0
55emb|BX058973.1|CNS09HO1 Single read from an extremity of a full-... 40 4.0
56emb|BX054844.1|CNS09EHC Single read from an extremity of a full-... 40 4.0
57emb|BX054383.1|CNS09E4J Single read from an extremity of a full-... 40 4.0
58emb|BX054382.1|CNS09E4I Single read from an extremity of a full-... 40 4.0
59emb|BX052598.1|CNS09CQY Single read from an extremity of a full-... 40 4.0
60emb|BX052597.1|CNS09CQX Single read from an extremity of a full-... 40 4.0
61emb|BX052105.1|CNS09CD9 Single read from an extremity of a full-... 40 4.0
62emb|BX051766.1|CNS09C3U Single read from an extremity of a full-... 40 4.0
63emb|BX051765.1|CNS09C3T Single read from an extremity of a full-... 40 4.0
64emb|BX050826.1|CNS09BDQ Single read from an extremity of a full-... 40 4.0
65emb|BX050825.1|CNS09BDP Single read from an extremity of a full-... 40 4.0
66emb|BX049822.1|CNS09ALU Single read from an extremity of a full-... 40 4.0
67emb|BX049821.1|CNS09ALT Single read from an extremity of a full-... 40 4.0
68emb|BX030920.1|CNS08W0S Single read from an extremity of a full-... 40 4.0
69emb|BX030919.1|CNS08W0R Single read from an extremity of a full-... 40 4.0
70emb|BX030864.1|CNS08VZ8 Single read from an extremity of a full-... 40 4.0
71emb|BX045807.1|CNS097IB Single read from an extremity of a full-... 40 4.0
72emb|BX045806.1|CNS097IA Single read from an extremity of a full-... 40 4.0
73emb|BX042049.1|CNS094LX Single read from an extremity of a full-... 40 4.0
74emb|BX042048.1|CNS094LW Single read from an extremity of a full-... 40 4.0
75emb|BX040221.1|CNS09375 Single read from an extremity of a full-... 40 4.0
76emb|BX040220.1|CNS09374 Single read from an extremity of a full-... 40 4.0
77emb|BX037502.1|CNS0913M Single read from an extremity of a full-... 40 4.0
78emb|BX037471.1|CNS0912R Single read from an extremity of a full-... 40 4.0
79emb|BX036960.1|CNS090OK Single read from an extremity of a full-... 40 4.0
80emb|BX036959.1|CNS090OJ Single read from an extremity of a full-... 40 4.0
81emb|BX036058.1|CNS08ZZI Single read from an extremity of a full-... 40 4.0
82emb|BX036057.1|CNS08ZZH Single read from an extremity of a full-... 40 4.0
83emb|BX035771.1|CNS08ZRJ Single read from an extremity of a full-... 40 4.0
84emb|BX035770.1|CNS08ZRI Single read from an extremity of a full-... 40 4.0
85emb|BX034963.1|CNS08Z53 Single read from an extremity of a full-... 40 4.0
86emb|BX034962.1|CNS08Z52 Single read from an extremity of a full-... 40 4.0
87emb|BX034217.1|CNS08YKD Single read from an extremity of a full-... 40 4.0
88emb|BX033994.1|CNS08YE6 Single read from an extremity of a full-... 40 4.0
89emb|BX033035.1|CNS08XNJ Single read from an extremity of a full-... 40 4.0
90emb|BX033034.1|CNS08XNI Single read from an extremity of a full-... 40 4.0
91emb|BX030395.1|CNS08VM7 Single read from an extremity of a full-... 40 4.0
92emb|BX028992.1|CNS08UJ8 Single read from an extremity of a full-... 40 4.0
93emb|BX028991.1|CNS08UJ7 Single read from an extremity of a full-... 40 4.0
94emb|BX028005.1|CNS08TRT Single read from an extremity of a full-... 40 4.0
95emb|BX028004.1|CNS08TRS Single read from an extremity of a full-... 40 4.0
96emb|BX027756.1|CNS08TKW Single read from an extremity of a full-... 40 4.0
97emb|BX024641.1|CNS08R6D Single read from an extremity of a full-... 40 4.0
98emb|BX024640.1|CNS08R6C Single read from an extremity of a full-... 40 4.0
99emb|BX023222.1|CNS08Q2Y Single read from an extremity of a full-... 40 4.0
100emb|BX023221.1|CNS08Q2X Single read from an extremity of a full-... 40 4.0
101emb|BX022052.1|CNS08P6G Single read from an extremity of a full-... 40 4.0
102emb|BX022051.1|CNS08P6F Single read from an extremity of a full-... 40 4.0
103emb|BX019569.1|CNS08N9H Single read from an extremity of a full-... 40 4.0
104emb|BX019568.1|CNS08N9G Single read from an extremity of a full-... 40 4.0
105emb|BX020483.1|CNS08NYV Single read from an extremity of a full-... 40 4.0
106emb|BX020459.1|CNS08NY7 Single read from an extremity of a full-... 40 4.0
107emb|BX019149.1|CNS08MXT Single read from an extremity of a full-... 40 4.0
108emb|BX018722.1|CNS08MLY Single read from an extremity of a full-... 40 4.0
109emb|BX018239.1|CNS08M8J Single read from an extremity of a full-... 40 4.0
110emb|BX018238.1|CNS08M8I Single read from an extremity of a full-... 40 4.0
111emb|BX017233.1|CNS08LGL Single read from an extremity of a full-... 40 4.0
112emb|BX017232.1|CNS08LGK Single read from an extremity of a full-... 40 4.0
113emb|BX016670.1|CNS08L0Y Single read from an extremity of a full-... 40 4.0
114emb|BX016619.1|CNS08KZJ Single read from an extremity of a full-... 40 4.0
115emb|BX016618.1|CNS08KZI Single read from an extremity of a full-... 40 4.0
116emb|BX016202.1|CNS08KNY Single read from an extremity of a full-... 40 4.0
117emb|BX016201.1|CNS08KNX Single read from an extremity of a full-... 40 4.0
118emb|BX016072.1|CNS08KKC Single read from an extremity of a full-... 40 4.0
119emb|BX016071.1|CNS08KKB Single read from an extremity of a full-... 40 4.0
120emb|BX016032.1|CNS08KJ8 Single read from an extremity of a full-... 40 4.0
121emb|BX016031.1|CNS08KJ7 Single read from an extremity of a full-... 40 4.0
122emb|BX014845.1|CNS08JM9 Single read from an extremity of a full-... 40 4.0
123emb|BX014835.1|CNS08JLZ Single read from an extremity of a full-... 40 4.0
124emb|BX014834.1|CNS08JLY Single read from an extremity of a full-... 40 4.0
125emb|BX014823.1|CNS08JLN Single read from an extremity of a full-... 40 4.0
126emb|BX012788.1|CNS08I14 Single read from an extremity of a full-... 40 4.0
127emb|BX011620.1|CNS08H4O Single read from an extremity of a full-... 40 4.0
128emb|BX009503.1|CNS08FHV Single read from an extremity of a full-... 40 4.0
129emb|BX009502.1|CNS08FHU Single read from an extremity of a full-... 40 4.0
130emb|BX009476.1|CNS08FH4 Single read from an extremity of a full-... 40 4.0
131emb|BX009475.1|CNS08FH3 Single read from an extremity of a full-... 40 4.0
132emb|BX007868.1|CNS08E8G Single read from an extremity of a full-... 40 4.0
133emb|BX007867.1|CNS08E8F Single read from an extremity of a full-... 40 4.0
134emb|BX007827.1|CNS08E7B Single read from an extremity of a full-... 40 4.0
135emb|BX007826.1|CNS08E7A Single read from an extremity of a full-... 40 4.0
136emb|BX007030.1|CNS08DL6 Single read from an extremity of a full-... 40 4.0
137emb|BX007029.1|CNS08DL5 Single read from an extremity of a full-... 40 4.0
138emb|BX006166.1|CNS08CX6 Single read from an extremity of a full-... 40 4.0
139emb|BX006165.1|CNS08CX5 Single read from an extremity of a full-... 40 4.0
140gb|CP000088.1| Thermobifida fusca YX, complete genome 40 4.0
141emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ... 40 4.0
142emb|AL606649.4|OSJN00094 Oryza sativa genomic DNA, chromosome 4,... 40 4.0
143emb|AL163815.1|ATF15N18 Arabidopsis thaliana DNA chromosome 5, B... 40 4.0
144gb|AF469109.1| Mus musculus SDS3 mRNA, complete cds 40 4.0
145dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038 40 4.0
146ref|NM_134584.2| Drosophila melanogaster CG32512-RA (CG32512), mRNA 40 4.0
147dbj|AK138947.1| Mus musculus adult male aorta and vein cDNA, RIK... 40 4.0
148dbj|AK150633.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 4.0
149gb|AY060370.1| Drosophila melanogaster LD23009 full length cDNA 40 4.0
150dbj|AK010274.1| Mus musculus ES cells cDNA, RIKEN full-length en... 40 4.0
151gb|AC135355.3| Mus musculus BAC clone RP24-495F22 from chromosom... 40 4.0
152dbj|AK045475.1| Mus musculus adult male corpora quadrigemina cDN... 40 4.0
153dbj|AK043652.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 40 4.0
154dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.0
155dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.0
156gb|AC016747.7| Homo sapiens BAC clone RP11-493E12 from 2, comple... 40 4.0
157gb|AY119788.1| Mus musculus SMAD4 (Smad4) gene, complete cds 40 4.0
158ref|NM_178622.3| Mus musculus RIKEN cDNA 2400003N08 gene (240000... 40 4.0
159dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 4.0
160dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g... 40 4.0
161dbj|AP007273.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.0
162dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 4.0
163dbj|AP005966.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.0
164ref|XM_565436.1| Anopheles gambiae str. PEST ENSANGP00000028147 ... 40 4.0
165ref|XM_308979.2| Anopheles gambiae str. PEST ENSANGP00000020323 ... 40 4.0
166dbj|AK103423.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.0
167dbj|AK102042.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.0
168dbj|AK070184.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.0
169dbj|AK068789.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.0
170emb|CR925778.5| Zebrafish DNA sequence from clone DKEY-63L2 in l... 40 4.0
171gb|AE003569.4| Drosophila melanogaster chromosome X, section 70 ... 40 4.0
172dbj|AP004243.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 4.0
173dbj|AP003965.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 4.0
174gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome 40 4.0
175gb|AC144778.3| Mus musculus BAC clone RP23-278A22 from 6, comple... 40 4.0
176dbj|AP005233.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 4.0
177gb|AY839756.1| Ovine herpesvirus 2 strain BJ1035, complete genome 40 4.0
178emb|AL683878.9| Mouse DNA sequence from clone RP23-201G13 on chr... 40 4.0 
>dbj|AK070398.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023048G06, full
           insert sequence
          Length = 3440

 Score =  119 bits (60), Expect = 5e-24
 Identities = 93/104 (89%)
 Strand = Plus / Plus

                                                                       
Query: 202 gtcggcctcgctgactggcatcagaaatacataggcaaagttaagcaggcagtttaccac 261
           ||||||||||| |||||||||||||| ||||| |||||||| ||||||||||| ||||||
Sbjct: 198 gtcggcctcgcggactggcatcagaagtacatcggcaaagtaaagcaggcagtctaccac 257

                                                       
Query: 262 actcaaaagagtgggaggaggcgtgttgtggtcttgacagagga 305
           | ||| || ||||| ||||| ||||||||||| |||||||||||
Sbjct: 258 agtcagaaaagtggaaggagacgtgttgtggtgttgacagagga 301



 Score = 46.1 bits (23), Expect = 0.065
 Identities = 40/45 (88%), Gaps = 3/45 (6%)
 Strand = Plus / Plus

                                                        
Query: 100 tcggcgatggcgctgccgccgcgccaactcctcctcgtcctcctc 144
           |||||||||||   |||||||||||| ||||||||| ||||||||
Sbjct: 93  tcggcgatggc---gccgccgcgccatctcctcctcctcctcctc 134
to top
>gb|AC145477.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1402B06,
              complete sequence
          Length = 134001

 Score = 95.6 bits (48), Expect = 8e-17
 Identities = 78/88 (88%)
 Strand = Plus / Plus

                                                                          
Query: 218    ggcatcagaaatacataggcaaagttaagcaggcagtttaccacactcaaaagagtggga 277
              |||||||||| ||||| |||||||| ||||||||||| ||||||| ||| || ||||| |
Sbjct: 106597 ggcatcagaagtacatcggcaaagtaaagcaggcagtctaccacagtcagaaaagtggaa 106656

                                          
Query: 278    ggaggcgtgttgtggtcttgacagagga 305
              |||| ||||||||||| |||||||||||
Sbjct: 106657 ggagacgtgttgtggtgttgacagagga 106684



 Score = 46.1 bits (23), Expect = 0.065
 Identities = 40/45 (88%), Gaps = 3/45 (6%)
 Strand = Plus / Plus

                                                           
Query: 100    tcggcgatggcgctgccgccgcgccaactcctcctcgtcctcctc 144
              |||||||||||   |||||||||||| ||||||||| ||||||||
Sbjct: 104426 tcggcgatggc---gccgccgcgccatctcctcctcctcctcctc 104467
to top
>gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0042F15, complete sequence
          Length = 162959

 Score = 95.6 bits (48), Expect = 8e-17
 Identities = 78/88 (88%)
 Strand = Plus / Plus

                                                                         
Query: 218   ggcatcagaaatacataggcaaagttaagcaggcagtttaccacactcaaaagagtggga 277
             |||||||||| ||||| |||||||| ||||||||||| ||||||| ||| || ||||| |
Sbjct: 13786 ggcatcagaagtacatcggcaaagtaaagcaggcagtctaccacagtcagaaaagtggaa 13845

                                         
Query: 278   ggaggcgtgttgtggtcttgacagagga 305
             |||| ||||||||||| |||||||||||
Sbjct: 13846 ggagacgtgttgtggtgttgacagagga 13873



 Score = 46.1 bits (23), Expect = 0.065
 Identities = 40/45 (88%), Gaps = 3/45 (6%)
 Strand = Plus / Plus

                                                          
Query: 100   tcggcgatggcgctgccgccgcgccaactcctcctcgtcctcctc 144
             |||||||||||   |||||||||||| ||||||||| ||||||||
Sbjct: 11615 tcggcgatggc---gccgccgcgccatctcctcctcctcctcctc 11656
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 95.6 bits (48), Expect = 8e-17
 Identities = 78/88 (88%)
 Strand = Plus / Plus

                                                                           
Query: 218     ggcatcagaaatacataggcaaagttaagcaggcagtttaccacactcaaaagagtggga 277
               |||||||||| ||||| |||||||| ||||||||||| ||||||| ||| || ||||| |
Sbjct: 7829011 ggcatcagaagtacatcggcaaagtaaagcaggcagtctaccacagtcagaaaagtggaa 7829070

                                           
Query: 278     ggaggcgtgttgtggtcttgacagagga 305
               |||| ||||||||||| |||||||||||
Sbjct: 7829071 ggagacgtgttgtggtgttgacagagga 7829098



 Score = 46.1 bits (23), Expect = 0.065
 Identities = 40/45 (88%), Gaps = 3/45 (6%)
 Strand = Plus / Plus

                                                            
Query: 100     tcggcgatggcgctgccgccgcgccaactcctcctcgtcctcctc 144
               |||||||||||   |||||||||||| ||||||||| ||||||||
Sbjct: 7826840 tcggcgatggc---gccgccgcgccatctcctcctcctcctcctc 7826881



 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 122      gccaactcctcctcgtcctcctcg 145
                |||||||||||||| |||||||||
Sbjct: 16783637 gccaactcctcctcctcctcctcg 16783614



 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 126      actcctcctcgtcctcctcg 145
                ||||||||||||||||||||
Sbjct: 12858725 actcctcctcgtcctcctcg 12858744
to top
>ref|NM_121194.2| Arabidopsis thaliana catalytic AT5G11560 mRNA, complete cds
          Length = 3237

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 195 agatcaagtcggcctcgctgactggcatcagaaatacataggcaaagttaagcaggcagt 254
           |||||||| ||||||| |||| ||||| || |  ||||| || ||||| ||||| |||||
Sbjct: 119 agatcaagccggcctcactgattggcaccaaaggtacattgggaaagtgaagcatgcagt 178

                                             
Query: 255 ttaccacactcaaaagagtgggaggaggcgtgtt 288
            | |||||||||||||| ||| || | |||||||
Sbjct: 179 attccacactcaaaagactggaagaaagcgtgtt 212
to top
>emb|BX932832.1| Gallus gallus finished cDNA, clone ChEST276k16
          Length = 570

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 128 tcctcctcgtcctcctcgggttcct 152
           |||||||||||||||||||||||||
Sbjct: 84  tcctcctcgtcctcctcgggttcct 60
to top
>gb|AY714813.1| Cercopithecine herpesvirus 2, complete genome
          Length = 150715

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 127   ctcctcctcgtcctcctcggg 147
             |||||||||||||||||||||
Sbjct: 79400 ctcctcctcgtcctcctcggg 79420
to top
>ref|NM_001004367.2| Mus musculus CXXC finger 4 (Cxxc4), mRNA
          Length = 4852

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 127 ctcctcctcgtcctcctcggg 147
           |||||||||||||||||||||
Sbjct: 597 ctcctcctcgtcctcctcggg 617
to top
>gb|BC082332.1| Mus musculus CXXC finger 4, mRNA (cDNA clone MGC:90862
           IMAGE:30537505), complete cds
          Length = 4852

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 127 ctcctcctcgtcctcctcggg 147
           |||||||||||||||||||||
Sbjct: 597 ctcctcctcgtcctcctcggg 617
to top
>gb|BC067052.1| Mus musculus CXXC finger 4, mRNA (cDNA clone MGC:86040
           IMAGE:30619087), complete cds
          Length = 1313

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 127 ctcctcctcgtcctcctcggg 147
           |||||||||||||||||||||
Sbjct: 910 ctcctcctcgtcctcctcggg 930
to top
>ref|XM_415471.1| PREDICTED: Gallus gallus similar to chromosome 9 open reading frame
           78; hepatocellular carcinoma-associated antigen 59
           (LOC417189), mRNA
          Length = 1138

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 128 tcctcctcgtcctcctcgggttcct 152
           |||||||| ||||||||||||||||
Sbjct: 83  tcctcctcatcctcctcgggttcct 59
to top
>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 101     cggcgatggcgctgccgccgc 121
               |||||||||||||||||||||
Sbjct: 5148443 cggcgatggcgctgccgccgc 5148423
to top
>gb|BC065149.1| Mus musculus CXXC finger 4, mRNA (cDNA clone IMAGE:6853043), partial
            cds
          Length = 5216

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 127  ctcctcctcgtcctcctcggg 147
            |||||||||||||||||||||
Sbjct: 1066 ctcctcctcgtcctcctcggg 1086
to top
>ref|XM_984932.1| PREDICTED: Mus musculus CXXC finger 4 (Cxxc4), mRNA
          Length = 1184

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 127 ctcctcctcgtcctcctcggg 147
           |||||||||||||||||||||
Sbjct: 360 ctcctcctcgtcctcctcggg 380
to top
>ref|XM_541615.2| PREDICTED: Canis familiaris similar to Periaxin (LOC484501), mRNA
          Length = 4410

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 127  ctcctcctcgtcctcctcggg 147
            |||||||||||||||||||||
Sbjct: 4107 ctcctcctcgtcctcctcggg 4087
to top
>emb|CR759881.16| Zebrafish DNA sequence from clone CH211-165K16 in linkage group 18,
             complete sequence
          Length = 123400

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 131   tcctcgtcctcctcgggttcc 151
             |||||||||||||||||||||
Sbjct: 57566 tcctcgtcctcctcgggttcc 57586
to top
>gb|AC164408.4| Mus musculus chromosome 3, clone RP23-384A11, complete sequence
          Length = 202604

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 127   ctcctcctcgtcctcctcggg 147
             |||||||||||||||||||||
Sbjct: 45679 ctcctcctcgtcctcctcggg 45699
to top
>gb|AC119840.12| Mus musculus chromosome 3, clone RP24-112E5, complete sequence
          Length = 206159

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 127  ctcctcctcgtcctcctcggg 147
            |||||||||||||||||||||
Sbjct: 7161 ctcctcctcgtcctcctcggg 7181
to top
>gb|AE012355.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 263
            of 460 of the complete genome
          Length = 10666

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 100  tcggcgatggcgctgccgccg 120
            |||||||||||||||||||||
Sbjct: 5459 tcggcgatggcgctgccgccg 5439
to top
>dbj|AK136882.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330164G18
           product:unclassifiable, full insert sequence
          Length = 4243

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 127 ctcctcctcgtcctcctcggg 147
           |||||||||||||||||||||
Sbjct: 129 ctcctcctcgtcctcctcggg 109
to top
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 100     tcggcgatggcgctgccgccg 120
               |||||||||||||||||||||
Sbjct: 2010193 tcggcgatggcgctgccgccg 2010213
to top
>dbj|AK038550.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length
           enriched library, clone:A230035L11 product:inhibitor of
           the Dvl and Axin complex, full insert sequence
          Length = 4296

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 127 ctcctcctcgtcctcctcggg 147
           |||||||||||||||||||||
Sbjct: 24  ctcctcctcgtcctcctcggg 4
to top
>gb|AY757327.1| Oreochromis niloticus isolate B6a Hox protein gene, partial cds
          Length = 225

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 124 caactcctcctcgtcctcctc 144
           |||||||||||||||||||||
Sbjct: 153 caactcctcctcgtcctcctc 173
to top
>gb|AF272158.1|AF272158 Rattus norvegicus Dvl-binding protein Idax mRNA, complete cds
          Length = 761

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 127 ctcctcctcgtcctcctcggg 147
           |||||||||||||||||||||
Sbjct: 366 ctcctcctcgtcctcctcggg 386
to top
>ref|NM_053342.1| Rattus norvegicus CXXC finger 4 (Cxxc4), mRNA
          Length = 761

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 127 ctcctcctcgtcctcctcggg 147
           |||||||||||||||||||||
Sbjct: 366 ctcctcctcgtcctcctcggg 386
to top
>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib
          Length = 2013089

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 147     gttccttgtcgctgtctctct 167
               |||||||||||||||||||||
Sbjct: 1722061 gttccttgtcgctgtctctct 1722081
to top
>gb|U70053.1|XCU70053 Xanthomonas campestris gumN, gumO and gumP genes, complete cds
          Length = 4028

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 100  tcggcgatggcgctgccgccg 120
            |||||||||||||||||||||
Sbjct: 2350 tcggcgatggcgctgccgccg 2370
to top
>gb|DQ215390.1| Taeniopygia guttata clone 0058P0059G11 chromosome 10 open reading
           frame 104-like mRNA, complete sequence
          Length = 606

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 99  ctcctcctcgtcctcctcgg 118
to top
>gb|DQ215389.1| Taeniopygia guttata clone 0061P0002H10 chromosome 10 open reading
           frame 104-like mRNA, complete sequence
          Length = 1027

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 63  ctcctcctcgtcctcctcgg 82
to top
>gb|AC121363.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0036C12,
              complete sequence
          Length = 145517

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 122    gccaactcctcctcgtcctcctcg 145
              |||||||||||||| |||||||||
Sbjct: 107747 gccaactcctcctcctcctcctcg 107724
to top
>gb|AC113271.10| Mus musculus chromosome 5, clone RP23-376H8, complete sequence
          Length = 185353

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   ccaactcctcctcgtcctcc 142
             ||||||||||||||||||||
Sbjct: 72337 ccaactcctcctcgtcctcc 72318
to top
>gb|AC104631.2| Drosophila melanogaster clone BACR35D19, complete sequence
          Length = 166908

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   ctcctcctcgtcctcctcgg 146
             ||||||||||||||||||||
Sbjct: 49055 ctcctcctcgtcctcctcgg 49036
to top
>ref|XM_591904.2| PREDICTED: Bos taurus similar to alpha-2-plasmin inhibitor
            (LOC514104), mRNA
          Length = 6896

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 127  ctcctcctcgtcctcctcgg 146
            ||||||||||||||||||||
Sbjct: 3483 ctcctcctcgtcctcctcgg 3464
to top
>gb|AY596618.1| Saccharum officinarum clone SCCCCL4009G04, complete sequence
          Length = 811

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 110 ctcctcctcgtcctcctcgg 129
to top
>gb|AC130726.2| Oryza sativa (japonica cultivar-group) chromosome 5 PAC clone P0508G08,
             complete sequence
          Length = 141383

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   actcctcctcgtcctcctcg 145
             ||||||||||||||||||||
Sbjct: 19271 actcctcctcgtcctcctcg 19290
to top
>gb|BC062176.1| Mus musculus RIKEN cDNA 2400003N08 gene, mRNA (cDNA clone MGC:70133
           IMAGE:6514171), complete cds
          Length = 1480

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 123 ccaactcctcctcgtcctcc 142
           ||||||||||||||||||||
Sbjct: 138 ccaactcctcctcgtcctcc 119
to top
>gb|AC132418.3| Mus musculus BAC clone RP23-251N2 from chromosome 18, complete sequence
          Length = 206588

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 259    cacactcaaaagagtgggag 278
              ||||||||||||||||||||
Sbjct: 152342 cacactcaaaagagtgggag 152361
to top
>ref|XM_384357.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein
            (FG04181.1) partial mRNA
          Length = 3138

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 127  ctcctcctcgtcctcctcgg 146
            ||||||||||||||||||||
Sbjct: 1299 ctcctcctcgtcctcctcgg 1280
to top
>emb|CR716878.2|CNS0GG3B Tetraodon nigroviridis full-length cDNA
          Length = 576

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 64  ccctcctctcagatcagagg 83
           ||||||||||||||||||||
Sbjct: 335 ccctcctctcagatcagagg 316
to top
>gb|BC055764.1| Mus musculus RIKEN cDNA 2400003N08 gene, mRNA (cDNA clone
           IMAGE:6402735), partial cds
          Length = 2389

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 123 ccaactcctcctcgtcctcc 142
           ||||||||||||||||||||
Sbjct: 224 ccaactcctcctcgtcctcc 205
to top
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    gcgatggcgctgccgccgcg 122
              ||||||||||||||||||||
Sbjct: 350637 gcgatggcgctgccgccgcg 350656
to top
>emb|BX072038.1|CNS09RQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 681 ctcctcctcgtcctcctcgg 700
to top
>emb|BX072037.1|CNS09RQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 551 ctcctcctcgtcctcctcgg 532
to top
>emb|BX071074.1|CNS09R06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 688 ctcctcctcgtcctcctcgg 707
to top
>emb|BX071073.1|CNS09R05 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 554 ctcctcctcgtcctcctcgg 535
to top
>emb|BX069043.1|CNS09PFR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 222 ctcctcctcgtcctcctcgg 241
to top
>emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 731 ctcctcctcgtcctcctcgg 712
to top
>emb|BX065976.1|CNS09N2K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 676 ctcctcctcgtcctcctcgg 695
to top
>emb|BX065975.1|CNS09N2J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 513 ctcctcctcgtcctcctcgg 494
to top
>emb|BX064684.1|CNS09M2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 567

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 526 ctcctcctcgtcctcctcgg 507
to top
>emb|BX063673.1|CNS09LAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 499 ctcctcctcgtcctcctcgg 480
to top
>emb|BX061993.1|CNS09JZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 703 ctcctcctcgtcctcctcgg 722
to top
>emb|BX061992.1|CNS09JZW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1057

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 552 ctcctcctcgtcctcctcgg 533
to top
>emb|BX058974.1|CNS09HO2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 684 ctcctcctcgtcctcctcgg 703
to top
>emb|BX058973.1|CNS09HO1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 539 ctcctcctcgtcctcctcgg 520
to top
>emb|BX054844.1|CNS09EHC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 454

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 356 ctcctcctcgtcctcctcgg 337
to top
>emb|BX054383.1|CNS09E4J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 717

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 120 ctcctcctcgtcctcctcgg 139
to top
>emb|BX054382.1|CNS09E4I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 478 ctcctcctcgtcctcctcgg 459
to top
>emb|BX052598.1|CNS09CQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 789

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 694 ctcctcctcgtcctcctcgg 713
to top
>emb|BX052597.1|CNS09CQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 213 ctcctcctcgtcctcctcgg 194
to top
>emb|BX052105.1|CNS09CD9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 570 ctcctcctcgtcctcctcgg 551
to top
>emb|BX051766.1|CNS09C3U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 686 ctcctcctcgtcctcctcgg 705
to top
>emb|BX051765.1|CNS09C3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 551 ctcctcctcgtcctcctcgg 532
to top
>emb|BX050826.1|CNS09BDQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 686 ctcctcctcgtcctcctcgg 705
to top
>emb|BX050825.1|CNS09BDP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 544 ctcctcctcgtcctcctcgg 525
to top
>emb|BX049822.1|CNS09ALU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 694 ctcctcctcgtcctcctcgg 713
to top
>emb|BX049821.1|CNS09ALT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 548 ctcctcctcgtcctcctcgg 529
to top
>emb|BX030920.1|CNS08W0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 702 ctcctcctcgtcctcctcgg 721
to top
>emb|BX030919.1|CNS08W0R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 593 ctcctcctcgtcctcctcgg 574
to top
>emb|BX030864.1|CNS08VZ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 571 ctcctcctcgtcctcctcgg 552
to top
>emb|BX045807.1|CNS097IB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 691 ctcctcctcgtcctcctcgg 710
to top
>emb|BX045806.1|CNS097IA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 547 ctcctcctcgtcctcctcgg 528
to top
>emb|BX042049.1|CNS094LX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 689 ctcctcctcgtcctcctcgg 708
to top
>emb|BX042048.1|CNS094LW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 543 ctcctcctcgtcctcctcgg 524
to top
>emb|BX040221.1|CNS09375 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 688 ctcctcctcgtcctcctcgg 707
to top
>emb|BX040220.1|CNS09374 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 513 ctcctcctcgtcctcctcgg 494
to top
>emb|BX037502.1|CNS0913M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 397

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 239 ctcctcctcgtcctcctcgg 258
to top
>emb|BX037471.1|CNS0912R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 561 ctcctcctcgtcctcctcgg 542
to top
>emb|BX036960.1|CNS090OK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 701 ctcctcctcgtcctcctcgg 720
to top
>emb|BX036959.1|CNS090OJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 573 ctcctcctcgtcctcctcgg 554
to top
>emb|BX036058.1|CNS08ZZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 698 ctcctcctcgtcctcctcgg 717
to top
>emb|BX036057.1|CNS08ZZH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 564 ctcctcctcgtcctcctcgg 545
to top
>emb|BX035771.1|CNS08ZRJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 694 ctcctcctcgtcctcctcgg 713
to top
>emb|BX035770.1|CNS08ZRI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 565 ctcctcctcgtcctcctcgg 546
to top
>emb|BX034963.1|CNS08Z53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 684 ctcctcctcgtcctcctcgg 703
to top
>emb|BX034962.1|CNS08Z52 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 550 ctcctcctcgtcctcctcgg 531
to top
>emb|BX034217.1|CNS08YKD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 589 ctcctcctcgtcctcctcgg 570
to top
>emb|BX033994.1|CNS08YE6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 551 ctcctcctcgtcctcctcgg 532
to top
>emb|BX033035.1|CNS08XNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 468

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 210 ctcctcctcgtcctcctcgg 229
to top
>emb|BX033034.1|CNS08XNI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 785

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 583 ctcctcctcgtcctcctcgg 564
to top
>emb|BX030395.1|CNS08VM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 560 ctcctcctcgtcctcctcgg 541
to top
>emb|BX028992.1|CNS08UJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 762

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 581 ctcctcctcgtcctcctcgg 600
to top
>emb|BX028991.1|CNS08UJ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 575 ctcctcctcgtcctcctcgg 556
to top
>emb|BX028005.1|CNS08TRT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 703 ctcctcctcgtcctcctcgg 722
to top
>emb|BX028004.1|CNS08TRS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 560 ctcctcctcgtcctcctcgg 541
to top
>emb|BX027756.1|CNS08TKW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 311

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 218 ctcctcctcgtcctcctcgg 237
to top
>emb|BX024641.1|CNS08R6D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 585 ctcctcctcgtcctcctcgg 604
to top
>emb|BX024640.1|CNS08R6C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 539 ctcctcctcgtcctcctcgg 520
to top
>emb|BX023222.1|CNS08Q2Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 698

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 525 ctcctcctcgtcctcctcgg 544
to top
>emb|BX023221.1|CNS08Q2X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 555 ctcctcctcgtcctcctcgg 536
to top
>emb|BX022052.1|CNS08P6G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 618

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 583 ctcctcctcgtcctcctcgg 602
to top
>emb|BX022051.1|CNS08P6F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 710

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 562 ctcctcctcgtcctcctcgg 543
to top
>emb|BX019569.1|CNS08N9H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 700 ctcctcctcgtcctcctcgg 719
to top
>emb|BX019568.1|CNS08N9G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 574 ctcctcctcgtcctcctcgg 555
to top
>emb|BX020483.1|CNS08NYV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 569 ctcctcctcgtcctcctcgg 550
to top
>emb|BX020459.1|CNS08NY7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 560 ctcctcctcgtcctcctcgg 541
to top
>emb|BX019149.1|CNS08MXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 261

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 104 ctcctcctcgtcctcctcgg 85
to top
>emb|BX018722.1|CNS08MLY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 571 ctcctcctcgtcctcctcgg 552
to top
>emb|BX018239.1|CNS08M8J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 687 ctcctcctcgtcctcctcgg 706
to top
>emb|BX018238.1|CNS08M8I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 584 ctcctcctcgtcctcctcgg 565
to top
>emb|BX017233.1|CNS08LGL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 696 ctcctcctcgtcctcctcgg 715
to top
>emb|BX017232.1|CNS08LGK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 893

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 585 ctcctcctcgtcctcctcgg 566
to top
>emb|BX016670.1|CNS08L0Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 216 ctcctcctcgtcctcctcgg 235
to top
>emb|BX016619.1|CNS08KZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 711 ctcctcctcgtcctcctcgg 730
to top
>emb|BX016618.1|CNS08KZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 577 ctcctcctcgtcctcctcgg 558
to top
>emb|BX016202.1|CNS08KNY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 679 ctcctcctcgtcctcctcgg 698
to top
>emb|BX016201.1|CNS08KNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 548 ctcctcctcgtcctcctcgg 529
to top
>emb|BX016072.1|CNS08KKC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 536 ctcctcctcgtcctcctcgg 555
to top
>emb|BX016071.1|CNS08KKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 446

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 295 ctcctcctcgtcctcctcgg 276
to top
>emb|BX016032.1|CNS08KJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 692 ctcctcctcgtcctcctcgg 711
to top
>emb|BX016031.1|CNS08KJ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 547 ctcctcctcgtcctcctcgg 528
to top
>emb|BX014845.1|CNS08JM9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 689 ctcctcctcgtcctcctcgg 708
to top
>emb|BX014835.1|CNS08JLZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 669 ctcctcctcgtcctcctcgg 688
to top
>emb|BX014834.1|CNS08JLY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 556 ctcctcctcgtcctcctcgg 537
to top
>emb|BX014823.1|CNS08JLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 583 ctcctcctcgtcctcctcgg 564
to top
>emb|BX012788.1|CNS08I14 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 616

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 509 ctcctcctcgtcctcctcgg 490
to top
>emb|BX011620.1|CNS08H4O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 565 ctcctcctcgtcctcctcgg 546
to top
>emb|BX009503.1|CNS08FHV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 699 ctcctcctcgtcctcctcgg 718
to top
>emb|BX009502.1|CNS08FHU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 560 ctcctcctcgtcctcctcgg 541
to top
>emb|BX009476.1|CNS08FH4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 679 ctcctcctcgtcctcctcgg 698
to top
>emb|BX009475.1|CNS08FH3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 563 ctcctcctcgtcctcctcgg 544
to top
>emb|BX007868.1|CNS08E8G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 657 ctcctcctcgtcctcctcgg 676
to top
>emb|BX007867.1|CNS08E8F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 480 ctcctcctcgtcctcctcgg 461
to top
>emb|BX007827.1|CNS08E7B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 704 ctcctcctcgtcctcctcgg 723
to top
>emb|BX007826.1|CNS08E7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 554 ctcctcctcgtcctcctcgg 535
to top
>emb|BX007030.1|CNS08DL6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 699 ctcctcctcgtcctcctcgg 718
to top
>emb|BX007029.1|CNS08DL5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 585 ctcctcctcgtcctcctcgg 566
to top
>emb|BX006166.1|CNS08CX6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 690 ctcctcctcgtcctcctcgg 709
to top
>emb|BX006165.1|CNS08CX5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 563 ctcctcctcgtcctcctcgg 544
to top
>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 127     ctcctcctcgtcctcctcgg 146
               ||||||||||||||||||||
Sbjct: 3328076 ctcctcctcgtcctcctcgg 3328095
to top
>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 222     tcagaaatacataggcaaag 241
               ||||||||||||||||||||
Sbjct: 2715041 tcagaaatacataggcaaag 2715022
to top
>emb|AL606649.4|OSJN00094 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0003B01,
              complete sequence
          Length = 153643

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    ctcctcctcgtcctcctcgg 146
              ||||||||||||||||||||
Sbjct: 105299 ctcctcctcgtcctcctcgg 105318
to top
>emb|AL163815.1|ATF15N18 Arabidopsis thaliana DNA chromosome 5, BAC clone F15N18 (ESSA project)
          Length = 101665

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                         
Query: 229   tacataggcaaagttaagcaggcagtttaccacactcaaaagagtgggaggaggcgtgtt 288
             ||||| || ||||| ||||| ||||| | |||||||||||||| ||| || | |||||||
Sbjct: 75369 tacattgggaaagtgaagcatgcagtattccacactcaaaagactggaagaaagcgtgtt 75310
to top
>gb|AF469109.1| Mus musculus SDS3 mRNA, complete cds
          Length = 2373

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 123 ccaactcctcctcgtcctcc 142
           ||||||||||||||||||||
Sbjct: 211 ccaactcctcctcgtcctcc 192
to top
>dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038
          Length = 1725576

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 278    ggaggcgtgttgtggtcttg 297
              ||||||||||||||||||||
Sbjct: 142340 ggaggcgtgttgtggtcttg 142321
to top
>ref|NM_134584.2| Drosophila melanogaster CG32512-RA (CG32512), mRNA
          Length = 2197

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 525 ctcctcctcgtcctcctcgg 544
to top
>dbj|AK138947.1| Mus musculus adult male aorta and vein cDNA, RIKEN full-length
           enriched library, clone:A530026J10 product:SDS3, full
           insert sequence
          Length = 2369

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 123 ccaactcctcctcgtcctcc 142
           ||||||||||||||||||||
Sbjct: 222 ccaactcctcctcgtcctcc 203
to top
>dbj|AK150633.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830012P03 product:SDS3, full
           insert sequence
          Length = 2356

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 123 ccaactcctcctcgtcctcc 142
           ||||||||||||||||||||
Sbjct: 209 ccaactcctcctcgtcctcc 190
to top
>gb|AY060370.1| Drosophila melanogaster LD23009 full length cDNA
          Length = 3563

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 525 ctcctcctcgtcctcctcgg 544
to top
>dbj|AK010274.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2400003N08 product:weakly similar to CG14220
           PROTEIN [Drosophila melanogaster], full insert sequence
          Length = 1568

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 123 ccaactcctcctcgtcctcc 142
           ||||||||||||||||||||
Sbjct: 174 ccaactcctcctcgtcctcc 155
to top
>gb|AC135355.3| Mus musculus BAC clone RP24-495F22 from chromosome 6, complete sequence
          Length = 171057

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 73    cagatcagaggtcgaatccaaacc 96
             ||||||||||||| ||||||||||
Sbjct: 82273 cagatcagaggtccaatccaaacc 82296
to top
>dbj|AK045475.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN
           full-length enriched library, clone:B230206B20
           product:hypothetical protein, full insert sequence
          Length = 2369

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 123 ccaactcctcctcgtcctcc 142
           ||||||||||||||||||||
Sbjct: 225 ccaactcctcctcgtcctcc 206
to top
>dbj|AK043652.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length
           enriched library, clone:A830015I06 product:FLJ00052
           PROTEIN (FRAGMENT) homolog [Homo sapiens], full insert
           sequence
          Length = 1607

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 123 ccaactcctcctcgtcctcc 142
           ||||||||||||||||||||
Sbjct: 214 ccaactcctcctcgtcctcc 195
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 127      ctcctcctcgtcctcctcgg 146
                ||||||||||||||||||||
Sbjct: 32586565 ctcctcctcgtcctcctcgg 32586584
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 121      cgccaactcctcctcgtcctcctc 144
                ||||| ||||||||||||||||||
Sbjct: 22605216 cgccacctcctcctcgtcctcctc 22605239
to top
>gb|AC016747.7| Homo sapiens BAC clone RP11-493E12 from 2, complete sequence
          Length = 152345

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 222    tcagaaatacataggcaaag 241
              ||||||||||||||||||||
Sbjct: 144173 tcagaaatacataggcaaag 144154
to top
>gb|AY119788.1| Mus musculus SMAD4 (Smad4) gene, complete cds
          Length = 58218

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 259  cacactcaaaagagtgggag 278
            ||||||||||||||||||||
Sbjct: 8221 cacactcaaaagagtgggag 8240
to top
>ref|NM_178622.3| Mus musculus RIKEN cDNA 2400003N08 gene (2400003N08Rik), mRNA
          Length = 2373

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 123 ccaactcctcctcgtcctcc 142
           ||||||||||||||||||||
Sbjct: 211 ccaactcctcctcgtcctcc 192
to top
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 104     cgatggcgctgccgccgcgc 123
               ||||||||||||||||||||
Sbjct: 3765538 cgatggcgctgccgccgcgc 3765519
to top
>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome
          Length = 3147090

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 98      cgtcggcgatggcgctgccg 117
               ||||||||||||||||||||
Sbjct: 3012813 cgtcggcgatggcgctgccg 3012832
to top
>dbj|AP007273.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBb0035K09
          Length = 124866

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 121   cgccaactcctcctcgtcctcctc 144
             ||||| ||||||||||||||||||
Sbjct: 89168 cgccacctcctcctcgtcctcctc 89191
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 105     gatggcgctgccgccgcgcc 124
               ||||||||||||||||||||
Sbjct: 3346872 gatggcgctgccgccgcgcc 3346853
to top
>dbj|AP005966.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:B1047H05
          Length = 187273

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 121   cgccaactcctcctcgtcctcctc 144
             ||||| ||||||||||||||||||
Sbjct: 70625 cgccacctcctcctcgtcctcctc 70648
to top
>ref|XM_565436.1| Anopheles gambiae str. PEST ENSANGP00000028147
           (ENSANGG00000017834), partial mRNA
          Length = 619

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 520 ctcctcctcgtcctcctcgg 501
to top
>ref|XM_308979.2| Anopheles gambiae str. PEST ENSANGP00000020323
           (ENSANGG00000017834), partial mRNA
          Length = 694

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 556 ctcctcctcgtcctcctcgg 537
to top
>dbj|AK103423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128K14, full
           insert sequence
          Length = 3531

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 ctcctcctcgtcctcctcgg 146
           ||||||||||||||||||||
Sbjct: 114 ctcctcctcgtcctcctcgg 133
to top
>dbj|AK102042.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033081J05, full
           insert sequence
          Length = 2213

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 122 gccaactcctcctcgtcctcctcg 145
           |||||||||||||| |||||||||
Sbjct: 181 gccaactcctcctcctcctcctcg 158
to top
>dbj|AK070184.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023044E03, full
           insert sequence
          Length = 1210

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 127 ctcctcctcgtcctcctcgggttc 150
           ||||||||| ||||||||||||||
Sbjct: 216 ctcctcctcctcctcctcgggttc 239
to top
>dbj|AK068789.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013166J08, full
           insert sequence
          Length = 2426

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 126 actcctcctcgtcctcctcg 145
           ||||||||||||||||||||
Sbjct: 297 actcctcctcgtcctcctcg 278
to top
>emb|CR925778.5| Zebrafish DNA sequence from clone DKEY-63L2 in linkage group 10,
             complete sequence
          Length = 211740

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 128   tcctcctcgtcctcctcgggttcc 151
             ||||||||||||||||||| ||||
Sbjct: 61642 tcctcctcgtcctcctcggcttcc 61619
to top
>gb|AE003569.4| Drosophila melanogaster chromosome X, section 70 of 74 of the complete
              sequence
          Length = 283558

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 127    ctcctcctcgtcctcctcgg 146
              ||||||||||||||||||||
Sbjct: 145287 ctcctcctcgtcctcctcgg 145268
to top
>dbj|AP004243.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-312N17, complete
             sequences
          Length = 167368

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 61    cctccctcctctcagatcag 80
             ||||||||||||||||||||
Sbjct: 36171 cctccctcctctcagatcag 36152
to top
>dbj|AP003965.2| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-31O9, complete
             sequence
          Length = 121852

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 125   aactcctcctcgtcctcctc 144
             ||||||||||||||||||||
Sbjct: 16733 aactcctcctcgtcctcctc 16714
to top
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 127    ctcctcctcgtcctcctcgg 146
              ||||||||||||||||||||
Sbjct: 584069 ctcctcctcgtcctcctcgg 584050
to top
>gb|AC144778.3| Mus musculus BAC clone RP23-278A22 from 6, complete sequence
          Length = 187115

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 73     cagatcagaggtcgaatccaaacc 96
              ||||||||||||| ||||||||||
Sbjct: 185032 cagatcagaggtccaatccaaacc 185055
to top
>dbj|AP005233.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-211G23, complete
             sequence
          Length = 157200

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 125   aactcctcctcgtcctcctc 144
             ||||||||||||||||||||
Sbjct: 39696 aactcctcctcgtcctcctc 39677
to top
>gb|AY839756.1| Ovine herpesvirus 2 strain BJ1035, complete genome
          Length = 135135

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 14    atccccgagcccgtgcagta 33
             ||||||||||||||||||||
Sbjct: 42365 atccccgagcccgtgcagta 42384
to top
>emb|AL683878.9| Mouse DNA sequence from clone RP23-201G13 on chromosome 2, complete
             sequence
          Length = 195221

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 121   cgccaactcctcctcgtcctcctc 144
             ||||||||||||||| ||||||||
Sbjct: 25438 cgccaactcctcctcctcctcctc 25461


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,242,240
Number of Sequences: 3902068
Number of extensions: 2242240
Number of successful extensions: 63078
Number of sequences better than 10.0: 178
Number of HSP's better than 10.0 without gapping: 180
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62218
Number of HSP's gapped (non-prelim): 860
length of query: 305
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 283
effective length of database: 17,147,199,772
effective search space: 4852657535476
effective search space used: 4852657535476
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top