>ref|NM_020248.2| Homo sapiens catenin, beta interacting protein 1 (CTNNBIP1),
           transcript variant 1, mRNA
          Length = 2995

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 86  tctcggatcgggaggcggaggctg 109
           ||||||| ||||||||||||||||
Sbjct: 7   tctcggagcgggaggcggaggctg 30

>ref|NM_001012329.1| Homo sapiens catenin, beta interacting protein 1 (CTNNBIP1),
           transcript variant 2, mRNA
          Length = 2961

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 86  tctcggatcgggaggcggaggctg 109
           ||||||| ||||||||||||||||
Sbjct: 7   tctcggagcgggaggcggaggctg 30

>emb|AL357140.33| Human DNA sequence from clone RP11-84A14 on chromosome 1 Contains the 5'
              end of the CLSTN1 gene for calsyntenin 1, the CTNNBIP1 gene
              for catenin, beta interacting protein 1, two novel genes,
              the LZIC gene for leucine zipper and CTNNBIP1 domain
              containing, the 5' end of the NMNAT1 gene for nicotinamide
              nucleotide adenylyltransferase 1 and a CpG island, complete
              sequence
          Length = 177470

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 86     tctcggatcgggaggcggaggctg 109
              ||||||| ||||||||||||||||
Sbjct: 115119 tctcggagcgggaggcggaggctg 115096


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,672,614
Number of Sequences: 3902068
Number of extensions: 1672614
Number of successful extensions: 170026
Number of sequences better than 10.0: 3
Number of HSP's better than 10.0 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 170007
Number of HSP's gapped (non-prelim): 19
length of query: 201
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 179
effective length of database: 17,147,199,772
effective search space: 3069348759188
effective search space used: 3069348759188
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)