ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl40f07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK100495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 2e-17
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 86 9e-14
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 86 9e-14
4gb|AC137069.2| Genomic sequence for Oryza sativa, Nipponbare str... 86 9e-14
5emb|BX649544.12| Zebrafish DNA sequence from clone CH211-123F23 ... 48 0.019
6emb|CR788230.7| Zebrafish DNA sequence from clone DKEY-57I11 in ... 46 0.076
7emb|BX005131.14| Zebrafish DNA sequence from clone DKEY-195B5 in... 46 0.076
8gb|AC012001.6| Homo sapiens BAC clone RP11-465G21 from 2, comple... 42 1.2
9dbj|AP005901.2| Homo sapiens genomic DNA, chromosome 18 clone:RP... 42 1.2
10gb|AC135922.2| Oryza sativa (japonica cultivar-group) chromosome... 40 4.7
11gb|AC130726.2| Oryza sativa (japonica cultivar-group) chromosome... 40 4.7
12gb|AC142086.3| Homo sapiens chromosome 16 clone RP11-989E6, comp... 40 4.7
13gb|AC007908.4| Homo sapiens chromosome 16 clone RP11-499D5, comp... 40 4.7
14gb|AC122857.2| Mus musculus BAC clone RP23-125A8 from 2, complet... 40 4.7
15emb|AL732509.4| Human DNA sequence from clone CTD-2245E12 on chr... 40 4.7
16emb|AL031601.4|HSY237C10 Human DNA sequence from clone XX-Y237C1... 40 4.7
17gb|AC141587.2| Homo sapiens chromosome 16 clone RP11-1046E19, co... 40 4.7
18gb|AC106029.8| Homo sapiens chromosome 15, clone CTD-2538I11, co... 40 4.7
19gb|AC182642.2| Pan troglodytes BAC clone CH251-216C21 from chrom... 40 4.7
20gb|AC007882.3| Homo sapiens BAC clone RP11-499D5 from 16, comple... 40 4.7
21gb|AC007028.3| Homo sapiens chromosome 16 clone RP5-835P2, compl... 40 4.7
22gb|AC093314.1| Homo sapiens chromosome 22 clone ll22nc01-20b5 ma... 40 4.7
23dbj|AK044414.1| Mus musculus adult retina cDNA, RIKEN full-lengt... 40 4.7
24dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.7
25gb|AC010539.9| Homo sapiens chromosome 16 clone RP11-373A21, com... 40 4.7
26gb|AC138807.2| Homo sapiens chromosome 16 clone RP11-1022I24, co... 40 4.7
27gb|AC140899.3| Homo sapiens chromosome 16 clone RP11-792K9, comp... 40 4.7
28gb|AC136616.4| Homo sapiens chromosome 16 clone RP11-44A7, compl... 40 4.7
29gb|AC141248.2| Homo sapiens chromosome 16 clone RP11-1251B5, com... 40 4.7
30gb|AC127533.9| Homo sapiens chromosome 15, clone RP11-1363O20, c... 40 4.7
31gb|AC134678.7| Homo sapiens chromosome 15, clone RP13-199M12, co... 40 4.7
32gb|AC136428.3| Homo sapiens chromosome 16 clone RP11-104C4, comp... 40 4.7
33gb|AC136440.3| Homo sapiens chromosome 16 clone RP11-378C4, comp... 40 4.7
34gb|AY595979.1| Aegla violacea voucher KACavi14 28S large subunit... 40 4.7
35gb|AY595978.1| Aegla violacea voucher KACavi12 28S large subunit... 40 4.7
36gb|AY595977.1| Aegla violacea voucher KACavi11 28S large subunit... 40 4.7
37emb|AL928914.15| Mouse DNA sequence from clone RP23-399J8 on chr... 40 4.7
38gb|AC132257.5| Mus musculus BAC clone RP24-361A4 from 5, complet... 40 4.7
39gb|AF053099.1| Chlamydomonas reinhardtii zygote-specific lectin-... 40 4.7
40gb|AF053098.1| Chlamydomonas reinhardtii zygote-specific lectin-... 40 4.7
41dbj|AK090402.1| Homo sapiens mRNA for FLJ00282 protein 40 4.7 
>dbj|AK100495.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023099A04, full
           insert sequence
          Length = 2618

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 58/61 (95%)
 Strand = Plus / Plus

                                                                       
Query: 209 attccgacagaggggagggggatttggagattgggttggcgtcgccggggtcggagggag 268
           ||||||||| |||||||||||||||||||||||||||||||||||||| | |||||||||
Sbjct: 218 attccgacaaaggggagggggatttggagattgggttggcgtcgccggaggcggagggag 277

            
Query: 269 g 269
           |
Sbjct: 278 g 278



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 318 ctccgggaagcgcctcgaccagtcgccg 345
           |||||||||||| || ||||||||||||
Sbjct: 351 ctccgggaagcggctggaccagtcgccg 378
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 49/51 (96%)
 Strand = Plus / Plus

                                                                  
Query: 219     aggggagggggatttggagattgggttggcgtcgccggggtcggagggagg 269
               |||||||||||||||||||||||||||||||||||||| | ||||||||||
Sbjct: 9577513 aggggagggggatttggagattgggttggcgtcgccggaggcggagggagg 9577563



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 318     ctccgggaagcgcctcgaccagtcgccg 345
               |||||||||||| || ||||||||||||
Sbjct: 9577636 ctccgggaagcggctggaccagtcgccg 9577663
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 49/51 (96%)
 Strand = Plus / Plus

                                                                  
Query: 219     aggggagggggatttggagattgggttggcgtcgccggggtcggagggagg 269
               |||||||||||||||||||||||||||||||||||||| | ||||||||||
Sbjct: 9575634 aggggagggggatttggagattgggttggcgtcgccggaggcggagggagg 9575684



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 318     ctccgggaagcgcctcgaccagtcgccg 345
               |||||||||||| || ||||||||||||
Sbjct: 9575757 ctccgggaagcggctggaccagtcgccg 9575784
to top
>gb|AC137069.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0009C19, from chromosome 3, complete sequence
          Length = 131709

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                                
Query: 219   aggggagggggatttggagattgggttggcgtcgccggggtcggagggagg 269
             |||||||||||||||||||||||||||||||||||||| | ||||||||||
Sbjct: 35173 aggggagggggatttggagattgggttggcgtcgccggaggcggagggagg 35123



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 318   ctccgggaagcgcctcgaccagtcgccg 345
             |||||||||||| || ||||||||||||
Sbjct: 35050 ctccgggaagcggctggaccagtcgccg 35023
to top
>emb|BX649544.12| Zebrafish DNA sequence from clone CH211-123F23 in linkage group 9,
              complete sequence
          Length = 168473

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 2      tttcatttcatttcattcgatcat 25
              ||||||||||||||||||||||||
Sbjct: 158017 tttcatttcatttcattcgatcat 157994
to top
>emb|CR788230.7| Zebrafish DNA sequence from clone DKEY-57I11 in linkage group 2, complete
              sequence
          Length = 223248

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 24     atctcatcacacacaacaccaaa 46
              |||||||||||||||||||||||
Sbjct: 213864 atctcatcacacacaacaccaaa 213886
to top
>emb|BX005131.14| Zebrafish DNA sequence from clone DKEY-195B5 in linkage group 2,
           complete sequence
          Length = 147345

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 24  atctcatcacacacaacaccaaa 46
           |||||||||||||||||||||||
Sbjct: 919 atctcatcacacacaacaccaaa 897
to top
>gb|AC012001.6| Homo sapiens BAC clone RP11-465G21 from 2, complete sequence
          Length = 151336

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 25     tctcatcacacacaacaccaa 45
              |||||||||||||||||||||
Sbjct: 139428 tctcatcacacacaacaccaa 139408
to top
>dbj|AP005901.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-454P7, complete
             sequence
          Length = 194034

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 4     tcatttcatttcattcgatcatctcatca 32
             ||||||||||||||| |||||| ||||||
Sbjct: 32621 tcatttcatttcatttgatcatttcatca 32649
to top
>gb|AC135922.2| Oryza sativa (japonica cultivar-group) chromosome 5 PAC clone P0411C02,
             complete sequence
          Length = 145676

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   ccgacagaggggagggggat 231
             ||||||||||||||||||||
Sbjct: 45716 ccgacagaggggagggggat 45697
to top
>gb|AC130726.2| Oryza sativa (japonica cultivar-group) chromosome 5 PAC clone P0508G08,
              complete sequence
          Length = 141383

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    ccgacagaggggagggggat 231
              ||||||||||||||||||||
Sbjct: 126193 ccgacagaggggagggggat 126174
to top
>gb|AC142086.3| Homo sapiens chromosome 16 clone RP11-989E6, complete sequence
          Length = 177574

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 1     atttcatttcatttcattcgatcatctcatca 32
             ||||||||||||||||||  ||||| ||||||
Sbjct: 13940 atttcatttcatttcatttcatcatttcatca 13971
to top
>gb|AC007908.4| Homo sapiens chromosome 16 clone RP11-499D5, complete sequence
          Length = 214110

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 1     atttcatttcatttcattcgatcatctcatca 32
             ||||||||||||||||||  ||||| ||||||
Sbjct: 11420 atttcatttcatttcatttcatcatttcatca 11389
to top
>gb|AC122857.2| Mus musculus BAC clone RP23-125A8 from 2, complete sequence
          Length = 221951

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 255    ggggtcggagggaggagggg 274
              ||||||||||||||||||||
Sbjct: 126915 ggggtcggagggaggagggg 126896
to top
>emb|AL732509.4| Human DNA sequence from clone CTD-2245E12 on chromosome X Contains the 5'
              end of the PHKA2 gene for phosphorylase kinase, alpha 2
              (liver), the 3' end of the GPR64 gene for G protein-coupled
              receptor 64 and a CpG island, complete sequence
          Length = 128189

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tttcattcgatcatctcatc 31
              ||||||||||||||||||||
Sbjct: 121753 tttcattcgatcatctcatc 121772
to top
>emb|AL031601.4|HSY237C10 Human DNA sequence from clone XX-Y237C10 on chromosome 10 Contains a
             poly(A) binding protein, cytoplasmic 1 (PABPC1)
             pseudogene, an Ig kappa chain precursor V region
             pseudogene, a pseudogene similar to part of kinase
             suppressor of ras (KSR) and four CpG islands, complete
             sequence
          Length = 197700

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 1     atttcatttcatttcattcgatcatctcatca 32
             ||||||||||||||||||  ||||| ||||||
Sbjct: 45218 atttcatttcatttcatttcatcatttcatca 45249
to top
>gb|AC141587.2| Homo sapiens chromosome 16 clone RP11-1046E19, complete sequence
          Length = 186890

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 4      tcatttcatttcattcgatcatctcatc 31
              ||||||||||||||| |||||| |||||
Sbjct: 111853 tcatttcatttcatttgatcatttcatc 111826
to top
>gb|AC106029.8| Homo sapiens chromosome 15, clone CTD-2538I11, complete sequence
          Length = 180591

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 1     atttcatttcatttcattcgatcatctcatca 32
             |||||||||||||||||  | |||||||||||
Sbjct: 27907 atttcatttcatttcatcagttcatctcatca 27876
to top
>gb|AC182642.2| Pan troglodytes BAC clone CH251-216C21 from chromosome 21, complete
              sequence
          Length = 187371

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 1      atttcatttcatttcattcgatcatctcatca 32
              |||||||||||||||||||  |||| ||||||
Sbjct: 143935 atttcatttcatttcattctttcatttcatca 143966
to top
>gb|AC007882.3| Homo sapiens BAC clone RP11-499D5 from 16, complete sequence
          Length = 214025

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 1      atttcatttcatttcattcgatcatctcatca 32
              ||||||||||||||||||  ||||| ||||||
Sbjct: 202606 atttcatttcatttcatttcatcatttcatca 202637
to top
>gb|AC007028.3| Homo sapiens chromosome 16 clone RP5-835P2, complete sequence
          Length = 148807

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 4     tcatttcatttcattcgatcatctcatc 31
             ||||||||||||||| |||||| |||||
Sbjct: 97245 tcatttcatttcatttgatcatttcatc 97272
to top
>gb|AC093314.1| Homo sapiens chromosome 22 clone ll22nc01-20b5 map 22q11, complete
            sequence
          Length = 28026

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 1    atttcatttcatttcattcgatcatctcatca 32
            ||||||||||||||||| | ||||| ||||||
Sbjct: 1625 atttcatttcatttcatgccatcatttcatca 1594
to top
>dbj|AK044414.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library,
            clone:A930011G23 product:hypothetical protein, full
            insert sequence
          Length = 2525

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 7    tttcatttcattcgatcatctcat 30
            |||||||||||||||||| |||||
Sbjct: 1189 tttcatttcattcgatcaactcat 1166
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 212      ccgacagaggggagggggat 231
                ||||||||||||||||||||
Sbjct: 12965647 ccgacagaggggagggggat 12965628
to top
>gb|AC010539.9| Homo sapiens chromosome 16 clone RP11-373A21, complete sequence
          Length = 101043

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 1     atttcatttcatttcattcgatcatctcatca 32
             ||||||||||||||||||  ||||| ||||||
Sbjct: 34581 atttcatttcatttcatttcatcatttcatca 34612
to top
>gb|AC138807.2| Homo sapiens chromosome 16 clone RP11-1022I24, complete sequence
          Length = 196021

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 1      atttcatttcatttcattcgatcatctcatca 32
              ||||||||||||||||||  ||||| ||||||
Sbjct: 184599 atttcatttcatttcatttcatcatttcatca 184630
to top
>gb|AC140899.3| Homo sapiens chromosome 16 clone RP11-792K9, complete sequence
          Length = 194490

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 1      atttcatttcatttcattcgatcatctcatca 32
              ||||||||||||||||||  ||||| ||||||
Sbjct: 149591 atttcatttcatttcatttcatcatttcatca 149622
to top
>gb|AC136616.4| Homo sapiens chromosome 16 clone RP11-44A7, complete sequence
          Length = 174477

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 1     atttcatttcatttcattcgatcatctcatca 32
             ||||||||||||||||||  ||||| ||||||
Sbjct: 23622 atttcatttcatttcatttcatcatttcatca 23653
to top
>gb|AC141248.2| Homo sapiens chromosome 16 clone RP11-1251B5, complete sequence
          Length = 173206

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 4     tcatttcatttcattcgatcatctcatc 31
             ||||||||||||||| |||||| |||||
Sbjct: 51564 tcatttcatttcatttgatcatttcatc 51537
to top
>gb|AC127533.9| Homo sapiens chromosome 15, clone RP11-1363O20, complete sequence
          Length = 165791

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 1      atttcatttcatttcattcgatcatctcatca 32
              |||||||||||||||||  | |||||||||||
Sbjct: 117094 atttcatttcatttcatcagttcatctcatca 117063



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 1      atttcatttcatttcattcgatcatctcatca 32
              |||||||||||||||||  | |||||||||||
Sbjct: 116992 atttcatttcatttcatcagttcatctcatca 116961
to top
>gb|AC134678.7| Homo sapiens chromosome 15, clone RP13-199M12, complete sequence
          Length = 200389

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 1     atttcatttcatttcattcgatcatctcatca 32
             |||||||||||||||||  | |||||||||||
Sbjct: 85520 atttcatttcatttcatcagttcatctcatca 85551
to top
>gb|AC136428.3| Homo sapiens chromosome 16 clone RP11-104C4, complete sequence
          Length = 193708

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 4      tcatttcatttcattcgatcatctcatc 31
              ||||||||||||||| |||||| |||||
Sbjct: 122257 tcatttcatttcatttgatcatttcatc 122230
to top
>gb|AC136440.3| Homo sapiens chromosome 16 clone RP11-378C4, complete sequence
          Length = 175691

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 1      atttcatttcatttcattcgatcatctcatca 32
              ||||||||||||||||||  ||||| ||||||
Sbjct: 136209 atttcatttcatttcatttcatcatttcatca 136178
to top
>gb|AY595979.1| Aegla violacea voucher KACavi14 28S large subunit ribosomal RNA
           gene, partial sequence
          Length = 2648

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 272 gggtttcgcccgccgcccca 291
           ||||||||||||||||||||
Sbjct: 679 gggtttcgcccgccgcccca 660
to top
>gb|AY595978.1| Aegla violacea voucher KACavi12 28S large subunit ribosomal RNA
           gene, partial sequence
          Length = 2648

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 272 gggtttcgcccgccgcccca 291
           ||||||||||||||||||||
Sbjct: 679 gggtttcgcccgccgcccca 660
to top
>gb|AY595977.1| Aegla violacea voucher KACavi11 28S large subunit ribosomal RNA
           gene, partial sequence
          Length = 2648

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 272 gggtttcgcccgccgcccca 291
           ||||||||||||||||||||
Sbjct: 679 gggtttcgcccgccgcccca 660
to top
>emb|AL928914.15| Mouse DNA sequence from clone RP23-399J8 on chromosome 2, complete
              sequence
          Length = 199873

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 255    ggggtcggagggaggagggg 274
              ||||||||||||||||||||
Sbjct: 168473 ggggtcggagggaggagggg 168454
to top
>gb|AC132257.5| Mus musculus BAC clone RP24-361A4 from 5, complete sequence
          Length = 171729

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 7     tttcatttcattcgatcatctcat 30
             |||||||||||||||||| |||||
Sbjct: 81240 tttcatttcattcgatcaactcat 81217
to top
>gb|AF053099.1| Chlamydomonas reinhardtii zygote-specific lectin-like protein (zsp2)
            gene, zsp2-2 allele, complete cds
          Length = 3828

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 241  gggttggcgtcgccggggtcggag 264
            |||||||||||||||||| |||||
Sbjct: 2518 gggttggcgtcgccgggggcggag 2495
to top
>gb|AF053098.1| Chlamydomonas reinhardtii zygote-specific lectin-like protein (zsp2)
            gene, zsp2-1 allele, complete cds
          Length = 4109

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 241  gggttggcgtcgccggggtcggag 264
            |||||||||||||||||| |||||
Sbjct: 2174 gggttggcgtcgccgggggcggag 2151
to top
>dbj|AK090402.1| Homo sapiens mRNA for FLJ00282 protein
          Length = 5789

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 12   tttcattcgatcatctcatc 31
            ||||||||||||||||||||
Sbjct: 3920 tttcattcgatcatctcatc 3901


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,619,050
Number of Sequences: 3902068
Number of extensions: 2619050
Number of successful extensions: 79888
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78780
Number of HSP's gapped (non-prelim): 1099
length of query: 353
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 331
effective length of database: 17,147,199,772
effective search space: 5675723124532
effective search space used: 5675723124532
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top