ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl40c07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_190478.1| Oryza sativa (japonica cultivar-group), predic... 178 1e-41
2dbj|AK065821.1| Oryza sativa (japonica cultivar-group) cDNA clon... 168 1e-38
3ref|XM_475386.1| Oryza sativa (japonica cultivar-group), predic... 163 6e-37
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 103 5e-19
5dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic D... 103 5e-19
6gb|AY022729.1| Oryza sativa microsatellite MRG5054 containing (C... 72 2e-09
7gb|AC121361.3| Oryza sativa (japonica cultivar-group) chromosome... 72 2e-09
8gb|AC108503.4| Oryza sativa (japonica cultivar-group) chromosome... 72 2e-09
9dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
10ref|XM_493851.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.10
11ref|XM_320082.2| Anopheles gambiae str. PEST ENSANGP00000012260 ... 44 0.40
12gb|AY607900.1| Gackstroemia weindorferi ATP synthase beta chain ... 42 1.6
13gb|AC103610.9| Mus musculus chromosome 9, clone RP23-364M24, com... 42 1.6
14gb|AC126438.3| Mus musculus BAC clone RP24-255G1 from chromosome... 42 1.6
15gb|AC124534.4| Mus musculus BAC clone RP23-316G7 from chromosome... 42 1.6
16gb|AC007161.1| Homo sapiens BAC clone GS1-165B14 from 7, complet... 42 1.6
17emb|AL391069.11| Human DNA sequence from clone RP11-126K1 on chr... 42 1.6
18gb|AC154569.2| Mus musculus BAC clone RP23-385I2 from chromosome... 42 1.6
19dbj|AB182627.1| Klebsiella sp. PAMU-1.2 paaZ, paaA, paaB, paaC, ... 42 1.6
20gb|AC161614.4| Pan troglodytes BAC clone CH251-575E11 from chrom... 42 1.6
21gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 42 1.6
22gb|AC102297.12| Mus musculus chromosome 1, clone RP24-392K18, co... 40 6.3
23gb|AC121870.2| Mus musculus chromosome 9 clone RP24-121D5, compl... 40 6.3
24gb|AC166162.6| Mus musculus BAC clone RP23-436K10 from chromosom... 40 6.3
25gb|AY790940.1| Homo sapiens insulin-like growth factor 1 (somato... 40 6.3
26gb|AC132404.5| Mus musculus BAC clone RP23-328O21 from chromosom... 40 6.3
27gb|AC100427.25| Mus musculus chromosome 10, clone RP23-136J15, c... 40 6.3
28gb|AC129162.5| Rattus norvegicus 9 BAC CH230-108L13 (Children's ... 40 6.3
29gb|AC116811.15| Mus musculus chromosome 6, clone RP24-356D15, co... 40 6.3
30ref|XM_322131.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.3
31ref|XM_951064.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.3
32gb|AC101093.9| Mus musculus chromosome 3, clone RP23-90B11, comp... 40 6.3
33ref|XM_705703.1| Candida albicans SC5314 hypothetical protein (C... 40 6.3
34ref|XM_705690.1| Candida albicans SC5314 hypothetical protein (C... 40 6.3
35gb|AC124602.5| Mus musculus BAC clone RP23-37L7 from chromosome ... 40 6.3
36gb|AC140333.2| Mus musculus BAC clone RP24-326A21 from chromosom... 40 6.3
37gb|AC158925.4| Mus musculus chromosome 1, clone RP23-22I7, compl... 40 6.3
38gb|AC099934.14| Mus musculus chromosome 12, clone RP23-17K9, com... 40 6.3
39gb|AC164431.2| Mus musculus BAC clone RP23-430N15 from chromosom... 40 6.3
40gb|AC167241.2| Mus musculus BAC clone RP24-560M14 from chromosom... 40 6.3
41gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 6.3
42ref|XM_001000649.1| PREDICTED: Mus musculus protease, serine, 36... 40 6.3
43ref|XM_001000660.1| PREDICTED: Mus musculus protease, serine, 36... 40 6.3
44ref|XM_001000668.1| PREDICTED: Mus musculus protease, serine, 36... 40 6.3
45gb|AC140841.2| Mus musculus BAC clone RP24-470M20 from chromosom... 40 6.3
46ref|XM_990161.1| PREDICTED: Mus musculus protease, serine, 36, t... 40 6.3
47ref|XM_990188.1| PREDICTED: Mus musculus protease, serine, 36, t... 40 6.3
48ref|XM_990219.1| PREDICTED: Mus musculus protease, serine, 36, t... 40 6.3
49ref|XM_001004440.1| PREDICTED: Mus musculus protease, serine, 36... 40 6.3
50ref|XM_620569.3| PREDICTED: Mus musculus protease, serine, 36, t... 40 6.3
51ref|XM_902328.2| PREDICTED: Mus musculus protease, serine, 36, t... 40 6.3
52gb|AC132237.3| Mus musculus BAC clone RP24-501M9 from chromosome... 40 6.3
53gb|AC124461.3| Mus musculus BAC clone RP24-144C5 from chromosome... 40 6.3
54gb|AC140053.4| Mus musculus BAC clone RP23-258J2 from chromosome... 40 6.3
55gb|AC122238.4| Mus musculus BAC clone RP23-143D4 from chromosome... 40 6.3
56ref|XM_808667.1| Trypanosoma cruzi strain CL Brener surface prot... 40 6.3
57gb|AC129082.6| Mus musculus BAC clone RP24-324M11 from chromosom... 40 6.3
58gb|AC124347.4| Mus musculus BAC clone RP24-462J14 from chromosom... 40 6.3
59gb|AC127254.3| Mus musculus BAC clone RP24-290D19 from chromosom... 40 6.3
60gb|AC122864.3| Mus musculus BAC clone RP23-142M19 from 6, comple... 40 6.3
61emb|BX842591.2| Rhesus DNA sequence from clone bRH-242L13, compl... 40 6.3
62gb|AC112144.4| Mus musculus BAC clone RP23-32B4 from 19, complet... 40 6.3
63gb|AC150314.5| Mus musculus BAC clone RP23-269O24 from chromosom... 40 6.3
64gb|AC160125.2| Mus musculus BAC clone RP23-317M11 from chromosom... 40 6.3
65emb|AL355472.19| Human DNA sequence from clone RP5-827C21 on chr... 40 6.3
66emb|AL049747.1|HS62D4 Human DNA sequence from clone CITF22-62D4 ... 40 6.3
67gb|AC118541.12| Mus musculus strain 129/SvJ chromosome 17 clone ... 40 6.3
68gb|AC166246.1| Mus musculus BAC clone RP24-80F22 from chromosome... 40 6.3
69emb|AJ784939.1| Mus musculus mRNA for polyserase-2 protein 40 6.3
70emb|AJ784938.1| Rattus norvegicus mRNA for polyserase-2 protein 40 6.3
71gb|AC120393.16| Mus musculus chromosome 7, clone RP24-312B12, co... 40 6.3
72gb|AC164579.5| Mus musculus 6 BAC RP23-384P24 (Roswell Park Canc... 40 6.3
73gb|AC084083.10| Homo sapiens chromosome 8, clone RP11-550A5, com... 40 6.3
74gb|AC105337.7| Homo sapiens chromosome 17, clone CTD-2116F7, com... 40 6.3
75gb|AC153163.2| Ornithorhynchus anatinus BAC clone OABb-434A1 fro... 40 6.3
76gb|AC005342.1| Homo sapiens 12p13.3 PAC RPCI5-1096D14 (Roswell P... 40 6.3
77gb|AC010202.6| Homo sapiens 12q BAC RP11-210L7 (Roswell Park Can... 40 6.3
78gb|AC106810.2| Homo sapiens chromosome 5 clone RP11-549K20, comp... 40 6.3
79gb|AC156984.9| Mus musculus chromosome 5, clone RP23-418H8, comp... 40 6.3
80gb|AC151285.2| Mus musculus BAC clone RP23-426D6 from chromosome... 40 6.3
81gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome 40 6.3
82gb|AC154538.2| Mus musculus BAC clone RP23-451M23 from chromosom... 40 6.3
83gb|AC158996.2| Mus musculus BAC clone RP24-137I10 from chromosom... 40 6.3
84dbj|AK050092.1| Mus musculus adult male liver tumor cDNA, RIKEN ... 40 6.3
85dbj|AK054042.1| Mus musculus 2 days pregnant adult female oviduc... 40 6.3
86dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
87gb|AY260957.1| Homo sapiens insulin-like growth factor 1 (somato... 40 6.3
88gb|AC084882.2|AC084882 Homo sapiens chromosome 15 clone RP11-408... 40 6.3
89ref|NM_001011560.1| Rattus norvegicus polyserase-2 (LOC497040), ... 40 6.3
90gb|AC157519.2| Mus musculus BAC clone RP23-202O17 from chromosom... 40 6.3
91gb|AC121491.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3
92gb|AC153374.5| Mus musculus 6 BAC RP23-281H4 (Roswell Park Cance... 40 6.3
93gb|AC007305.40| Mus musculus strain 129/SvJ clone mgs1-211l20 ma... 40 6.3
94dbj|AK057909.1| Homo sapiens cDNA FLJ25180 fis, clone CBR09247 40 6.3
95emb|BX537128.6| Mouse DNA sequence from clone RP23-12K23 on chro... 40 6.3
96gb|AC154222.2| Mus musculus BAC clone RP24-375M13 from 13, compl... 40 6.3
97gb|AC149222.4| Mus musculus BAC clone RP23-325D10 from 7, comple... 40 6.3
98emb|CT030636.13| Mouse DNA sequence from clone RP23-432O2 on chr... 40 6.3
99gb|AC116804.22| Mus musculus chromosome 17, clone RP24-343C24, c... 40 6.3
100emb|Y11666.1|MMHEXII1 Mus musculus gene for hexokinase II, exon ... 40 6.3
101gb|AC107633.11| Mus musculus chromosome 12, clone RP23-7P3, comp... 40 6.3
102dbj|AP001458.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 6.3
103emb|AL713913.10| Mouse DNA sequence from clone RP23-125F10 on ch... 40 6.3
104emb|CT573284.1| Platypus DNA sequence from clone CLM1-349H20, co... 40 6.3
105gb|AC119921.12| Mus musculus chromosome 12, clone RP24-252B23, c... 40 6.3
106gb|AC167817.4| Mus musculus BAC clone RP23-146N9 from chromosome... 40 6.3
107emb|CT030648.7| Mouse DNA sequence from clone RP24-440M15 on chr... 40 6.3
108emb|AL935309.8| Mouse DNA sequence from clone RP24-113M11 on chr... 40 6.3
109gb|AC140324.3| Mus musculus BAC clone RP23-402K14 from 6, comple... 40 6.3
110emb|AL772271.11| Mouse DNA sequence from clone RP23-17P12 on chr... 40 6.3
111gb|AC153850.3| Mus musculus 6 BAC RP23-81F19 (Roswell Park Cance... 40 6.3
112gb|AC079445.28| Mus musculus strain C57BL/6J chromosome 5 clone ... 40 6.3
113gb|AC073435.26| Mus musculus strain C57BL/6J chromosome 9 clone ... 40 6.3
114gb|AC157945.2| Mus musculus BAC clone RP23-289C11 from chromosom... 40 6.3
115dbj|AP006641.1| Lotus japonicus genomic DNA, chromosome 3, clone... 40 6.3
116gb|AC118547.41| Mus musculus strain C57BL/6J clone rp23-3g4 map ... 40 6.3
117gb|AC158398.2| Mus musculus BAC clone RP23-63H11 from chromosome... 40 6.3
118emb|AL805904.12| Mouse DNA sequence from clone RP23-47B18 on chr... 40 6.3
119emb|AL591495.12| Mouse DNA sequence from clone RP23-61O3 on chro... 40 6.3
120emb|AL662893.12| Mouse DNA sequence from clone RP23-202G21 on ch... 40 6.3
121gb|AC148774.4| Mus musculus chromosome 3, clone RP24-400J22, com... 40 6.3
122gb|AC104431.2| Homo sapiens chromosome 8 clone RP11-550A5 map 8q... 40 6.3
123gb|AC093175.9| Mus musculus Strain C57BL6/J Chromosome 7 BAC, RP... 40 6.3 
>ref|NM_190478.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2997

 Score =  178 bits (90), Expect = 1e-41
 Identities = 123/134 (91%)
 Strand = Plus / Plus

                                                                       
Query: 260 tatggtttcgctgtgcggccacaacacttgcaacggtacagagagtatgccaacatctac 319
           ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 496 tatggattcgctgtgcggccacaacacttgcaacggtacagagagtatgcaaacatctac 555

                                                                       
Query: 320 caggaggaggaagaggggaggtctgatagatggaagaactttctggataggcaggcagag 379
            ||||||||||||||| ||| ||||| ||||||||||| ||||||||||| || || |||
Sbjct: 556 aaggaggaggaagaggagagatctgagagatggaagaattttctggatagccaagctgag 615

                         
Query: 380 gacgatgaatcatc 393
            |||||||||||||
Sbjct: 616 tacgatgaatcatc 629
to top
>dbj|AK065821.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013043G04, full
           insert sequence
          Length = 3034

 Score =  168 bits (85), Expect = 1e-38
 Identities = 151/173 (87%)
 Strand = Plus / Plus

                                                                       
Query: 206 gagatgaaggccaagagcctccccttcatcgccttcgagcacaagcgggacgcctatggt 265
           ||||||||| | ||||||||||| |||||||||||||||||||||||||| |||||||| 
Sbjct: 172 gagatgaagccgaagagcctcccgttcatcgccttcgagcacaagcgggatgcctatggc 231

                                                                       
Query: 266 ttcgctgtgcggccacaacacttgcaacggtacagagagtatgccaacatctaccaggag 325
           ||||| || ||||| ||||||||||| || ||||  ||||||||   ||||||| |||||
Sbjct: 232 ttcgcagttcggccccaacacttgcagcgttacaaggagtatgcaggcatctacaaggag 291

                                                                
Query: 326 gaggaagaggggaggtctgatagatggaagaactttctggataggcaggcaga 378
           |||||||||| ||| || |||||||||||||| |||||||| |||||| ||||
Sbjct: 292 gaggaagaggagagatccgatagatggaagaattttctggagaggcagtcaga 344
to top
>ref|XM_475386.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2493

 Score =  163 bits (82), Expect = 6e-37
 Identities = 148/170 (87%)
 Strand = Plus / Plus

                                                                       
Query: 209 atgaaggccaagagcctccccttcatcgccttcgagcacaagcgggacgcctatggtttc 268
           |||||| | ||||||||||| |||||||||||||||||||||||||| |||||||| |||
Sbjct: 1   atgaagccgaagagcctcccgttcatcgccttcgagcacaagcgggatgcctatggcttc 60

                                                                       
Query: 269 gctgtgcggccacaacacttgcaacggtacagagagtatgccaacatctaccaggaggag 328
           || || ||||| ||||||||||| || ||||  ||||||||   ||||||| ||||||||
Sbjct: 61  gcagttcggccccaacacttgcagcgttacaaggagtatgcaggcatctacaaggaggag 120

                                                             
Query: 329 gaagaggggaggtctgatagatggaagaactttctggataggcaggcaga 378
           ||||||| ||| || |||||||||||||| |||||||| |||||| ||||
Sbjct: 121 gaagaggagagatccgatagatggaagaattttctggagaggcagtcaga 170
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  103 bits (52), Expect = 5e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                            
Query: 260      tatggtttcgctgtgcggccacaacacttgcaacggtacagagagtatgccaacatctac 319
                ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 35786087 tatggattcgctgtgcggccacaacacttgcaacggtacagagagtatgcaaacatctac 35786028



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 67/75 (89%)
 Strand = Plus / Minus

                                                                            
Query: 319      ccaggaggaggaagaggggaggtctgatagatggaagaactttctggataggcaggcaga 378
                ||||||||||||||||| ||| ||||| ||||||||||| ||||||||||| || || ||
Sbjct: 35785948 ccaggaggaggaagaggagagatctgagagatggaagaattttctggatagccaagctga 35785889

                               
Query: 379      ggacgatgaatcatc 393
                | |||||||||||||
Sbjct: 35785888 gtacgatgaatcatc 35785874



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                                
Query: 206      gagatgaaggccaagagcctccccttcatcgccttcgagcacaagcgg 253
                ||||||||||| ||||||||||| ||||||||||  ||||||||||||
Sbjct: 35786714 gagatgaaggcgaagagcctcccgttcatcgcctcggagcacaagcgg 35786667
to top
>dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0506B12
          Length = 170759

 Score =  103 bits (52), Expect = 5e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                         
Query: 260   tatggtttcgctgtgcggccacaacacttgcaacggtacagagagtatgccaacatctac 319
             ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 50545 tatggattcgctgtgcggccacaacacttgcaacggtacagagagtatgcaaacatctac 50486



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 67/75 (89%)
 Strand = Plus / Minus

                                                                         
Query: 319   ccaggaggaggaagaggggaggtctgatagatggaagaactttctggataggcaggcaga 378
             ||||||||||||||||| ||| ||||| ||||||||||| ||||||||||| || || ||
Sbjct: 50406 ccaggaggaggaagaggagagatctgagagatggaagaattttctggatagccaagctga 50347

                            
Query: 379   ggacgatgaatcatc 393
             | |||||||||||||
Sbjct: 50346 gtacgatgaatcatc 50332



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                             
Query: 206   gagatgaaggccaagagcctccccttcatcgccttcgagcacaagcgg 253
             ||||||||||| ||||||||||| ||||||||||  ||||||||||||
Sbjct: 51172 gagatgaaggcgaagagcctcccgttcatcgcctcggagcacaagcgg 51125
to top
>gb|AY022729.1| Oryza sativa microsatellite MRG5054 containing (CCG)X12, closest to
           marker S964, genomic sequence
          Length = 236

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 206 gagatgaaggccaagagcctccccttcatcgccttcgagcacaagcgg 253
           ||||||||| | ||||||||||| ||||||||||||||||||||||||
Sbjct: 163 gagatgaagccgaagagcctcccgttcatcgccttcgagcacaagcgg 210
to top
>gb|AC121361.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0009E21, complete sequence
          Length = 153214

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                             
Query: 206   gagatgaaggccaagagcctccccttcatcgccttcgagcacaagcgg 253
             ||||||||| | ||||||||||| ||||||||||||||||||||||||
Sbjct: 51894 gagatgaagccgaagagcctcccgttcatcgccttcgagcacaagcgg 51847



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                        
Query: 320   caggaggaggaagaggggaggtctgatagatggaagaactttctggataggcaggcaga 378
             |||||||||||||||| ||| || |||||||||||||| |||||||| |||||| ||||
Sbjct: 51137 caggaggaggaagaggagagatccgatagatggaagaattttctggagaggcagtcaga 51079



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252   gggacgcctatggtttcgctgtgcggccacaacacttgcaacggtacagagagtatgc 309
             |||| |||||||| ||||| || ||||| ||||||||||| || ||||  ||||||||
Sbjct: 51290 gggatgcctatggcttcgcagttcggccccaacacttgcagcgttacaaggagtatgc 51233
to top
>gb|AC108503.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1387_F08,
            complete sequence
          Length = 141535

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                            
Query: 206  gagatgaaggccaagagcctccccttcatcgccttcgagcacaagcgg 253
            ||||||||| | ||||||||||| ||||||||||||||||||||||||
Sbjct: 6252 gagatgaagccgaagagcctcccgttcatcgccttcgagcacaagcgg 6205



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 320  caggaggaggaagaggggaggtctgatagatggaagaactttctggataggcaggcaga 378
            |||||||||||||||| ||| || |||||||||||||| |||||||| |||||| ||||
Sbjct: 5495 caggaggaggaagaggagagatccgatagatggaagaattttctggagaggcagtcaga 5437



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 252  gggacgcctatggtttcgctgtgcggccacaacacttgcaacggtacagagagtatgc 309
            |||| |||||||| ||||| || ||||| ||||||||||| || ||||  ||||||||
Sbjct: 5648 gggatgcctatggcttcgcagttcggccccaacacttgcagcgttacaaggagtatgc 5591
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                                
Query: 206      gagatgaaggccaagagcctccccttcatcgccttcgagcacaagcgg 253
                ||||||||| | ||||||||||| ||||||||||||||||||||||||
Sbjct: 22696695 gagatgaagccgaagagcctcccgttcatcgccttcgagcacaagcgg 22696648



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                           
Query: 320      caggaggaggaagaggggaggtctgatagatggaagaactttctggataggcaggcaga 378
                |||||||||||||||| ||| || |||||||||||||| |||||||| |||||| ||||
Sbjct: 22695938 caggaggaggaagaggagagatccgatagatggaagaattttctggagaggcagtcaga 22695880



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                          
Query: 252      gggacgcctatggtttcgctgtgcggccacaacacttgcaacggtacagagagtatgc 309
                |||| |||||||| ||||| || ||||| ||||||||||| || ||||  ||||||||
Sbjct: 22696091 gggatgcctatggcttcgcagttcggccccaacacttgcagcgttacaaggagtatgc 22696034
to top
>ref|XM_493851.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3145

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 98/123 (79%)
 Strand = Plus / Plus

                                                                       
Query: 238 cttcgagcacaagcgggacgcctatggtttcgctgtgcggccacaacacttgcaacggta 297
           ||||||| ||||| ||||||| ||||| ||||| |||||||| || ||  |||| || | 
Sbjct: 30  cttcgagtacaagagggacgcgtatggattcgcggtgcggccgcagcatctgcagcgttt 89

                                                                       
Query: 298 cagagagtatgccaacatctaccaggaggaggaagaggggaggtctgatagatggaagaa 357
           | | ||||||||||| || ||| |||| || ||||||| |||  | || ||||||||| |
Sbjct: 90  ccgcgagtatgccaagatttacaaggaagaagaagaggagagagcggacagatggaagga 149

              
Query: 358 ctt 360
           |||
Sbjct: 150 ctt 152
to top
>ref|XM_320082.2| Anopheles gambiae str. PEST ENSANGP00000012260 (ENSANGG00000009771),
            partial mRNA
          Length = 4257

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 232  catcgccttcgagcacaagcgg 253
            ||||||||||||||||||||||
Sbjct: 3993 catcgccttcgagcacaagcgg 4014
to top
>gb|AY607900.1| Gackstroemia weindorferi ATP synthase beta chain (atpB) gene,
           partial cds; chloroplast
          Length = 1108

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 383 gatgaatcatctgaagaagat 403
           |||||||||||||||||||||
Sbjct: 890 gatgaatcatctgaagaagat 910
to top
>gb|AC103610.9| Mus musculus chromosome 9, clone RP23-364M24, complete sequence
          Length = 205900

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 321    aggaggaggaagaggggaggt 341
              |||||||||||||||||||||
Sbjct: 148920 aggaggaggaagaggggaggt 148940
to top
>gb|AC126438.3| Mus musculus BAC clone RP24-255G1 from chromosome 17, complete sequence
          Length = 152802

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 353   aagaactttctggataggcaggcag 377
             |||||||| ||||||||||||||||
Sbjct: 76274 aagaacttgctggataggcaggcag 76298
to top
>gb|AC124534.4| Mus musculus BAC clone RP23-316G7 from chromosome 1, complete sequence
          Length = 177675

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 321   aggaggaggaagaggggaggt 341
             |||||||||||||||||||||
Sbjct: 56058 aggaggaggaagaggggaggt 56078
to top
>gb|AC007161.1| Homo sapiens BAC clone GS1-165B14 from 7, complete sequence
          Length = 109343

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 321   aggaggaggaagaggggaggt 341
             |||||||||||||||||||||
Sbjct: 53813 aggaggaggaagaggggaggt 53833
to top
>emb|AL391069.11| Human DNA sequence from clone RP11-126K1 on chromosome 1 Contains the 3'
              end of the PSMD4 gene for proteasome (prosome, macropain)
              26S subunit non-ATPase 4, two novel genes, gene KIAA1441
              (FLJ13043), the PIK4CB genen for phosphatidylinositol
              4-kinase catalytic beta polypeptide, the RFX5 gene for
              regulatory factor X 5 (influences HLA class II expression),
              the SELENBP1 gene for selenium binding protein 1 and two
              CpG islands, complete sequence
          Length = 121357

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 320    caggaggaggaagaggggagg 340
              |||||||||||||||||||||
Sbjct: 111123 caggaggaggaagaggggagg 111103
to top
>gb|AC154569.2| Mus musculus BAC clone RP23-385I2 from chromosome 17, complete sequence
          Length = 180258

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 321   aggaggaggaagaggggaggt 341
             |||||||||||||||||||||
Sbjct: 25802 aggaggaggaagaggggaggt 25782
to top
>dbj|AB182627.1| Klebsiella sp. PAMU-1.2 paaZ, paaA, paaB, paaC, paaD, paaE, paaF,
            paaG, paaH, paaI, paaJ, paaK, paaX, paaY, MP genes,
            complete cds
          Length = 15036

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 59   ctaccctgaatcgcgctgcgctgca 83
            ||||||||||||||| |||||||||
Sbjct: 1111 ctaccctgaatcgcggtgcgctgca 1135
to top
>gb|AC161614.4| Pan troglodytes BAC clone CH251-575E11 from chromosome unknown, complete
              sequence
          Length = 172771

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 320    caggaggaggaagaggggagg 340
              |||||||||||||||||||||
Sbjct: 111410 caggaggaggaagaggggagg 111430
to top
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 198     cgcggcgcgagatgaaggccaagag 222
               |||||||||||||| ||||||||||
Sbjct: 1608606 cgcggcgcgagatgcaggccaagag 1608630
to top
>gb|AC102297.12| Mus musculus chromosome 1, clone RP24-392K18, complete sequence
          Length = 167248

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 121486 aggaggaggaagaggggagg 121467
to top
>gb|AC121870.2| Mus musculus chromosome 9 clone RP24-121D5, complete sequence
          Length = 191747

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 14627 aggaggaggaagaggggagg 14646
to top
>gb|AC166162.6| Mus musculus BAC clone RP23-436K10 from chromosome 6, complete sequence
          Length = 181038

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 179107 aggaggaggaagaggggagg 179126
to top
>gb|AY790940.1| Homo sapiens insulin-like growth factor 1 (somatomedin C) (IGF1) gene,
             complete cds
          Length = 88577

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   gccacaacacttgcaacggt 296
             ||||||||||||||||||||
Sbjct: 43458 gccacaacacttgcaacggt 43439
to top
>gb|AC132404.5| Mus musculus BAC clone RP23-328O21 from chromosome 17, complete sequence
          Length = 207685

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 144839 aggaggaggaagaggggagg 144820
to top
>gb|AC100427.25| Mus musculus chromosome 10, clone RP23-136J15, complete sequence
          Length = 206339

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 91204 aggaggaggaagaggggagg 91223
to top
>gb|AC129162.5| Rattus norvegicus 9 BAC CH230-108L13 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 245677

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 100239 aggaggaggaagaggggagg 100220
to top
>gb|AC116811.15| Mus musculus chromosome 6, clone RP24-356D15, complete sequence
          Length = 150909

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 130346 aggaggaggaagaggggagg 130365
to top
>ref|XM_322131.1| Neurospora crassa OR74A hypothetical protein (NCU00046.1) partial
           mRNA
          Length = 2562

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 229 cttcatcgccttcgagcaca 248
           ||||||||||||||||||||
Sbjct: 191 cttcatcgccttcgagcaca 210
to top
>ref|XM_951064.1| Neurospora crassa OR74A hypothetical protein (NCU00046.1) partial
           mRNA
          Length = 2562

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 229 cttcatcgccttcgagcaca 248
           ||||||||||||||||||||
Sbjct: 191 cttcatcgccttcgagcaca 210
to top
>gb|AC101093.9| Mus musculus chromosome 3, clone RP23-90B11, complete sequence
          Length = 167727

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 147482 aggaggaggaagaggggagg 147501
to top
>ref|XM_705703.1| Candida albicans SC5314 hypothetical protein (CaO19.3765), mRNA
          Length = 4182

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 386 gaatcatctgaagaagatgc 405
           ||||||||||||||||||||
Sbjct: 874 gaatcatctgaagaagatgc 893
to top
>ref|XM_705690.1| Candida albicans SC5314 hypothetical protein (CaO19.11249), mRNA
          Length = 4182

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 386 gaatcatctgaagaagatgc 405
           ||||||||||||||||||||
Sbjct: 874 gaatcatctgaagaagatgc 893
to top
>gb|AC124602.5| Mus musculus BAC clone RP23-37L7 from chromosome 7, complete sequence
          Length = 189065

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 316    ctaccaggaggaggaagagg 335
              ||||||||||||||||||||
Sbjct: 181077 ctaccaggaggaggaagagg 181058
to top
>gb|AC140333.2| Mus musculus BAC clone RP24-326A21 from chromosome 10, complete sequence
          Length = 157738

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 390    catctgaagaagatgctaag 409
              ||||||||||||||||||||
Sbjct: 112256 catctgaagaagatgctaag 112237
to top
>gb|AC158925.4| Mus musculus chromosome 1, clone RP23-22I7, complete sequence
          Length = 181897

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 122704 aggaggaggaagaggggagg 122723
to top
>gb|AC099934.14| Mus musculus chromosome 12, clone RP23-17K9, complete sequence
          Length = 234795

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 147747 aggaggaggaagaggggagg 147766
to top
>gb|AC164431.2| Mus musculus BAC clone RP23-430N15 from chromosome 17, complete sequence
          Length = 190724

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 166333 aggaggaggaagaggggagg 166314
to top
>gb|AC167241.2| Mus musculus BAC clone RP24-560M14 from chromosome 17, complete
            sequence
          Length = 184079

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 321  aggaggaggaagaggggagg 340
            ||||||||||||||||||||
Sbjct: 9760 aggaggaggaagaggggagg 9779
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 321      aggaggaggaagaggggagg 340
                ||||||||||||||||||||
Sbjct: 12700813 aggaggaggaagaggggagg 12700832
to top
>ref|XM_001000649.1| PREDICTED: Mus musculus protease, serine, 36, transcript variant 1
           (Prss36), mRNA
          Length = 1334

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctaccaggaggaggaagagg 335
           ||||||||||||||||||||
Sbjct: 464 ctaccaggaggaggaagagg 483
to top
>ref|XM_001000660.1| PREDICTED: Mus musculus protease, serine, 36, transcript variant 2
            (Prss36), mRNA
          Length = 3031

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 316  ctaccaggaggaggaagagg 335
            ||||||||||||||||||||
Sbjct: 1751 ctaccaggaggaggaagagg 1770
to top
>ref|XM_001000668.1| PREDICTED: Mus musculus protease, serine, 36, transcript variant 3
            (Prss36), mRNA
          Length = 3062

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 316  ctaccaggaggaggaagagg 335
            ||||||||||||||||||||
Sbjct: 1784 ctaccaggaggaggaagagg 1803
to top
>gb|AC140841.2| Mus musculus BAC clone RP24-470M20 from chromosome 9, complete sequence
          Length = 163348

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 54220 aggaggaggaagaggggagg 54201
to top
>ref|XM_990161.1| PREDICTED: Mus musculus protease, serine, 36, transcript variant 1
           (Prss36), mRNA
          Length = 1334

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctaccaggaggaggaagagg 335
           ||||||||||||||||||||
Sbjct: 464 ctaccaggaggaggaagagg 483
to top
>ref|XM_990188.1| PREDICTED: Mus musculus protease, serine, 36, transcript variant 2
            (Prss36), mRNA
          Length = 3030

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 316  ctaccaggaggaggaagagg 335
            ||||||||||||||||||||
Sbjct: 1750 ctaccaggaggaggaagagg 1769
to top
>ref|XM_990219.1| PREDICTED: Mus musculus protease, serine, 36, transcript variant 3
            (Prss36), mRNA
          Length = 3061

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 316  ctaccaggaggaggaagagg 335
            ||||||||||||||||||||
Sbjct: 1783 ctaccaggaggaggaagagg 1802
to top
>ref|XM_001004440.1| PREDICTED: Mus musculus protease, serine, 36, transcript variant 3
           (Prss36), mRNA
          Length = 1334

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctaccaggaggaggaagagg 335
           ||||||||||||||||||||
Sbjct: 464 ctaccaggaggaggaagagg 483
to top
>ref|XM_620569.3| PREDICTED: Mus musculus protease, serine, 36, transcript variant 1
            (Prss36), mRNA
          Length = 3030

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 316  ctaccaggaggaggaagagg 335
            ||||||||||||||||||||
Sbjct: 1750 ctaccaggaggaggaagagg 1769
to top
>ref|XM_902328.2| PREDICTED: Mus musculus protease, serine, 36, transcript variant 2
            (Prss36), mRNA
          Length = 3061

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 316  ctaccaggaggaggaagagg 335
            ||||||||||||||||||||
Sbjct: 1783 ctaccaggaggaggaagagg 1802
to top
>gb|AC132237.3| Mus musculus BAC clone RP24-501M9 from chromosome 12, complete sequence
          Length = 212186

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 133025 aggaggaggaagaggggagg 133006
to top
>gb|AC124461.3| Mus musculus BAC clone RP24-144C5 from chromosome 7, complete sequence
          Length = 185788

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 316    ctaccaggaggaggaagagg 335
              ||||||||||||||||||||
Sbjct: 104676 ctaccaggaggaggaagagg 104657
to top
>gb|AC140053.4| Mus musculus BAC clone RP23-258J2 from chromosome 19, complete sequence
          Length = 186595

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 107670 aggaggaggaagaggggagg 107651
to top
>gb|AC122238.4| Mus musculus BAC clone RP23-143D4 from chromosome 10, complete sequence
          Length = 188476

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 82418 aggaggaggaagaggggagg 82437
to top
>ref|XM_808667.1| Trypanosoma cruzi strain CL Brener surface protease GP63
            (Tc00.1047053511153.40) partial mRNA
          Length = 2352

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 316  ctaccaggaggaggaagagg 335
            ||||||||||||||||||||
Sbjct: 1273 ctaccaggaggaggaagagg 1292
to top
>gb|AC129082.6| Mus musculus BAC clone RP24-324M11 from chromosome 8, complete sequence
          Length = 141671

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 81075 aggaggaggaagaggggagg 81056
to top
>gb|AC124347.4| Mus musculus BAC clone RP24-462J14 from chromosome 19, complete
             sequence
          Length = 179915

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 37387 aggaggaggaagaggggagg 37406
to top
>gb|AC127254.3| Mus musculus BAC clone RP24-290D19 from chromosome 9, complete sequence
          Length = 187995

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 103816 aggaggaggaagaggggagg 103835
to top
>gb|AC122864.3| Mus musculus BAC clone RP23-142M19 from 6, complete sequence
          Length = 210148

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 101047 aggaggaggaagaggggagg 101066



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 100916 aggaggaggaagaggggagg 100935
to top
>emb|BX842591.2| Rhesus DNA sequence from clone bRH-242L13, complete sequence
          Length = 196103

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 320   caggaggaggaagaggggag 339
             ||||||||||||||||||||
Sbjct: 56598 caggaggaggaagaggggag 56617
to top
>gb|AC112144.4| Mus musculus BAC clone RP23-32B4 from 19, complete sequence
          Length = 216521

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 190635 aggaggaggaagaggggagg 190654
to top
>gb|AC150314.5| Mus musculus BAC clone RP23-269O24 from chromosome 10, complete sequence
          Length = 243006

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 390    catctgaagaagatgctaag 409
              ||||||||||||||||||||
Sbjct: 234859 catctgaagaagatgctaag 234878
to top
>gb|AC160125.2| Mus musculus BAC clone RP23-317M11 from chromosome 9, complete sequence
          Length = 209835

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 144611 aggaggaggaagaggggagg 144630
to top
>emb|AL355472.19| Human DNA sequence from clone RP5-827C21 on chromosome 1 Contains a
             ribosomal protein S15 (RPS15) pseudogene, three novel
             genes (LOC388753), the 3' end of the TARBP1 gene for TAR
             (HIV) RNA binding protein 1 and a CpG island, complete
             sequence
          Length = 92628

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 69869 aggaggaggaagaggggagg 69888
to top
>emb|AL049747.1|HS62D4 Human DNA sequence from clone CITF22-62D4 on chromosome 22, complete
             sequence
          Length = 40665

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 21998 aggaggaggaagaggggagg 22017
to top
>gb|AC118541.12| Mus musculus strain 129/SvJ chromosome 17 clone mgs1-205i23, complete
              sequence
          Length = 179569

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 130719 aggaggaggaagaggggagg 130738
to top
>gb|AC166246.1| Mus musculus BAC clone RP24-80F22 from chromosome 17, complete sequence
          Length = 194452

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 14394 aggaggaggaagaggggagg 14375
to top
>emb|AJ784939.1| Mus musculus mRNA for polyserase-2 protein
          Length = 2550

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 316  ctaccaggaggaggaagagg 335
            ||||||||||||||||||||
Sbjct: 1470 ctaccaggaggaggaagagg 1489
to top
>emb|AJ784938.1| Rattus norvegicus mRNA for polyserase-2 protein
          Length = 2628

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 316  ctaccaggaggaggaagagg 335
            ||||||||||||||||||||
Sbjct: 1542 ctaccaggaggaggaagagg 1561
to top
>gb|AC120393.16| Mus musculus chromosome 7, clone RP24-312B12, complete sequence
          Length = 183977

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 120362 aggaggaggaagaggggagg 120343
to top
>gb|AC164579.5| Mus musculus 6 BAC RP23-384P24 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 214578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 46150 aggaggaggaagaggggagg 46169
to top
>gb|AC084083.10| Homo sapiens chromosome 8, clone RP11-550A5, complete sequence
          Length = 209859

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 360    ttctggataggcaggcagag 379
              ||||||||||||||||||||
Sbjct: 114530 ttctggataggcaggcagag 114549
to top
>gb|AC105337.7| Homo sapiens chromosome 17, clone CTD-2116F7, complete sequence
          Length = 126083

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 36842 aggaggaggaagaggggagg 36823
to top
>gb|AC153163.2| Ornithorhynchus anatinus BAC clone OABb-434A1 from chromosome unknown,
             complete sequence
          Length = 156066

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 31894 aggaggaggaagaggggagg 31875
to top
>gb|AC005342.1| Homo sapiens 12p13.3 PAC RPCI5-1096D14 (Roswell Park Cancer Institute
             Human PAC Library) complete sequence
          Length = 220257

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 54182 aggaggaggaagaggggagg 54201
to top
>gb|AC010202.6| Homo sapiens 12q BAC RP11-210L7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 170004

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 277    gccacaacacttgcaacggt 296
              ||||||||||||||||||||
Sbjct: 125528 gccacaacacttgcaacggt 125509
to top
>gb|AC106810.2| Homo sapiens chromosome 5 clone RP11-549K20, complete sequence
          Length = 91853

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 66210 aggaggaggaagaggggagg 66229
to top
>gb|AC156984.9| Mus musculus chromosome 5, clone RP23-418H8, complete sequence
          Length = 171080

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 22380 aggaggaggaagaggggagg 22399
to top
>gb|AC151285.2| Mus musculus BAC clone RP23-426D6 from chromosome 17, complete sequence
          Length = 225650

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 168526 aggaggaggaagaggggagg 168507



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 96814 aggaggaggaagaggggagg 96795
to top
>gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome
          Length = 2839318

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 405    ctaagattgcgccgtccatc 424
              ||||||||||||||||||||
Sbjct: 365636 ctaagattgcgccgtccatc 365617



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 405    ctaagattgcgccgtccatc 424
              ||||||||||||||||||||
Sbjct: 348886 ctaagattgcgccgtccatc 348867
to top
>gb|AC154538.2| Mus musculus BAC clone RP23-451M23 from chromosome 16, complete
             sequence
          Length = 176390

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 68221 aggaggaggaagaggggagg 68240
to top
>gb|AC158996.2| Mus musculus BAC clone RP24-137I10 from chromosome 9, complete sequence
          Length = 154654

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 81806 aggaggaggaagaggggagg 81825
to top
>dbj|AK050092.1| Mus musculus adult male liver tumor cDNA, RIKEN full-length
           enriched library, clone:C730014I16
           product:unclassifiable, full insert sequence
          Length = 1753

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 321 aggaggaggaagaggggagg 340
           ||||||||||||||||||||
Sbjct: 491 aggaggaggaagaggggagg 510
to top
>dbj|AK054042.1| Mus musculus 2 days pregnant adult female oviduct cDNA, RIKEN
           full-length enriched library, clone:E230014E18
           product:unclassifiable, full insert sequence
          Length = 860

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 catctgaagaagatgctaag 409
           ||||||||||||||||||||
Sbjct: 520 catctgaagaagatgctaag 539
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 321      aggaggaggaagaggggagg 340
                ||||||||||||||||||||
Sbjct: 12697576 aggaggaggaagaggggagg 12697595
to top
>gb|AY260957.1| Homo sapiens insulin-like growth factor 1 (somatomedin C) (IGF1) gene,
             complete cds
          Length = 88066

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   gccacaacacttgcaacggt 296
             ||||||||||||||||||||
Sbjct: 43424 gccacaacacttgcaacggt 43405
to top
>gb|AC084882.2|AC084882 Homo sapiens chromosome 15 clone RP11-408J6 map 15q21.1, complete
             sequence
          Length = 193804

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 80235 aggaggaggaagaggggagg 80216
to top
>ref|NM_001011560.1| Rattus norvegicus polyserase-2 (LOC497040), mRNA
          Length = 2628

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 316  ctaccaggaggaggaagagg 335
            ||||||||||||||||||||
Sbjct: 1542 ctaccaggaggaggaagagg 1561
to top
>gb|AC157519.2| Mus musculus BAC clone RP23-202O17 from chromosome 19, complete sequence
          Length = 215073

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 171911 aggaggaggaagaggggagg 171892
to top
>gb|AC121491.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0050D18, complete sequence
          Length = 126350

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 55266 aggaggaggaagaggggagg 55285
to top
>gb|AC153374.5| Mus musculus 6 BAC RP23-281H4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 204379

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 31601 aggaggaggaagaggggagg 31582
to top
>gb|AC007305.40| Mus musculus strain 129/SvJ clone mgs1-211l20 map 6, complete sequence
          Length = 214840

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 42163 aggaggaggaagaggggagg 42182
to top
>dbj|AK057909.1| Homo sapiens cDNA FLJ25180 fis, clone CBR09247
          Length = 2289

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 321  aggaggaggaagaggggagg 340
            ||||||||||||||||||||
Sbjct: 1628 aggaggaggaagaggggagg 1609
to top
>emb|BX537128.6| Mouse DNA sequence from clone RP23-12K23 on chromosome X, complete
             sequence
          Length = 173195

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 81492 aggaggaggaagaggggagg 81473
to top
>gb|AC154222.2| Mus musculus BAC clone RP24-375M13 from 13, complete sequence
          Length = 169114

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 106424 aggaggaggaagaggggagg 106443
to top
>gb|AC149222.4| Mus musculus BAC clone RP23-325D10 from 7, complete sequence
          Length = 220651

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 316   ctaccaggaggaggaagagg 335
             ||||||||||||||||||||
Sbjct: 18527 ctaccaggaggaggaagagg 18546
to top
>emb|CT030636.13| Mouse DNA sequence from clone RP23-432O2 on chromosome 17, complete
             sequence
          Length = 204320

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 12820 aggaggaggaagaggggagg 12839
to top
>gb|AC116804.22| Mus musculus chromosome 17, clone RP24-343C24, complete sequence
          Length = 186153

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 38515 aggaggaggaagaggggagg 38534
to top
>emb|Y11666.1|MMHEXII1 Mus musculus gene for hexokinase II, exon 1 (and joined CDS)
          Length = 6151

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 321  aggaggaggaagaggggagg 340
            ||||||||||||||||||||
Sbjct: 2764 aggaggaggaagaggggagg 2745
to top
>gb|AC107633.11| Mus musculus chromosome 12, clone RP23-7P3, complete sequence
          Length = 202640

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 198424 aggaggaggaagaggggagg 198405
to top
>dbj|AP001458.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-831H9, complete
             sequence
          Length = 177433

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 320   caggaggaggaagaggggag 339
             ||||||||||||||||||||
Sbjct: 16442 caggaggaggaagaggggag 16461
to top
>emb|AL713913.10| Mouse DNA sequence from clone RP23-125F10 on chromosome 2, complete
              sequence
          Length = 190485

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 176479 aggaggaggaagaggggagg 176460
to top
>emb|CT573284.1| Platypus DNA sequence from clone CLM1-349H20, complete sequence
          Length = 151975

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 45531 aggaggaggaagaggggagg 45512
to top
>gb|AC119921.12| Mus musculus chromosome 12, clone RP24-252B23, complete sequence
          Length = 162290

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 96031 aggaggaggaagaggggagg 96050
to top
>gb|AC167817.4| Mus musculus BAC clone RP23-146N9 from chromosome 17, complete sequence
          Length = 213670

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 106092 aggaggaggaagaggggagg 106111
to top
>emb|CT030648.7| Mouse DNA sequence from clone RP24-440M15 on chromosome 17, complete
             sequence
          Length = 206631

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 90580 aggaggaggaagaggggagg 90561
to top
>emb|AL935309.8| Mouse DNA sequence from clone RP24-113M11 on chromosome 2, complete
             sequence
          Length = 45336

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 41262 aggaggaggaagaggggagg 41243
to top
>gb|AC140324.3| Mus musculus BAC clone RP23-402K14 from 6, complete sequence
          Length = 200190

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 177379 aggaggaggaagaggggagg 177360
to top
>emb|AL772271.11| Mouse DNA sequence from clone RP23-17P12 on chromosome 2, complete
              sequence
          Length = 204136

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 104994 aggaggaggaagaggggagg 105013
to top
>gb|AC153850.3| Mus musculus 6 BAC RP23-81F19 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 194042

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 89645 aggaggaggaagaggggagg 89626
to top
>gb|AC079445.28| Mus musculus strain C57BL/6J chromosome 5 clone rp23-403l21, complete
              sequence
          Length = 189517

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 102120 aggaggaggaagaggggagg 102139
to top
>gb|AC073435.26| Mus musculus strain C57BL/6J chromosome 9 clone rp23-383h20, complete
            sequence
          Length = 221953

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 321  aggaggaggaagaggggagg 340
            ||||||||||||||||||||
Sbjct: 3501 aggaggaggaagaggggagg 3482
to top
>gb|AC157945.2| Mus musculus BAC clone RP23-289C11 from chromosome 9, complete sequence
          Length = 216396

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 215876 aggaggaggaagaggggagg 215895
to top
>dbj|AP006641.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT34I09, TM0246b,
             complete sequence
          Length = 32298

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 29092 aggaggaggaagaggggagg 29111
to top
>gb|AC118547.41| Mus musculus strain C57BL/6J clone rp23-3g4 map 17, complete sequence
          Length = 234061

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 57716 aggaggaggaagaggggagg 57697
to top
>gb|AC158398.2| Mus musculus BAC clone RP23-63H11 from chromosome 12, complete sequence
          Length = 171334

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 64355 aggaggaggaagaggggagg 64374
to top
>emb|AL805904.12| Mouse DNA sequence from clone RP23-47B18 on chromosome 4, complete
             sequence
          Length = 132319

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 41586 aggaggaggaagaggggagg 41605
to top
>emb|AL591495.12| Mouse DNA sequence from clone RP23-61O3 on chromosome 2, complete
              sequence
          Length = 239758

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 237359 aggaggaggaagaggggagg 237378
to top
>emb|AL662893.12| Mouse DNA sequence from clone RP23-202G21 on chromosome 11, complete
              sequence
          Length = 205405

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    aggaggaggaagaggggagg 340
              ||||||||||||||||||||
Sbjct: 133743 aggaggaggaagaggggagg 133724
to top
>gb|AC148774.4| Mus musculus chromosome 3, clone RP24-400J22, complete sequence
          Length = 135817

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   aggaggaggaagaggggagg 340
             ||||||||||||||||||||
Sbjct: 45439 aggaggaggaagaggggagg 45420
to top
>gb|AC104431.2| Homo sapiens chromosome 8 clone RP11-550A5 map 8q24.2, complete
             sequence
          Length = 209870

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 360   ttctggataggcaggcagag 379
             ||||||||||||||||||||
Sbjct: 95329 ttctggataggcaggcagag 95310
to top
>gb|AC093175.9| Mus musculus Strain C57BL6/J Chromosome 7 BAC, RP23-200D13, complete
              sequence
          Length = 219763

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 316    ctaccaggaggaggaagagg 335
              ||||||||||||||||||||
Sbjct: 180710 ctaccaggaggaggaagagg 180729


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,248,216
Number of Sequences: 3902068
Number of extensions: 3248216
Number of successful extensions: 112872
Number of sequences better than 10.0: 123
Number of HSP's better than 10.0 without gapping: 122
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 112277
Number of HSP's gapped (non-prelim): 596
length of query: 468
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 446
effective length of database: 17,147,199,772
effective search space: 7647651098312
effective search space used: 7647651098312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top